1-Nitropyrene Stabilizes the mRNA of Cytochrome P450 1a1, a

Dec 4, 2009 - Cytochrome P450 1a1 (Cyp1a1) is a phase I xenobiotic-metabolizing enzyme, the expression of which is mainly driven by the aryl hydrocarb...
0 downloads 0 Views 2MB Size
Download PDF
1938

Chem. Res. Toxicol. 2009, 22, 1938–1947

1-Nitropyrene Stabilizes the mRNA of Cytochrome P450 1a1, a Carcinogen-Metabolizing Enzyme, via the Akt Pathway Wen-Cheng Chu,†,§ Wei-Fu Hong,‡,§ Min-Cong Huang,† Fei-Yun Chen,† Shin-Chang Lin,† Pei-Jyuan Liao,† and Jyan-Gwo J. Su*,† Department of Biochemical Science and Technology, National Chiayi UniVersity, Chiayi 600, Taiwan, R.O.C., and Department of Bioresources, National Chiayi UniVersity, Chiayi 600, Taiwan, R.O.C ReceiVed July 17, 2009

Cytochrome P450 1a1 (Cyp1a1) is a phase I xenobiotic-metabolizing enzyme, the expression of which is mainly driven by the aryl hydrocarbon receptor (AhR). Cyp1a1 messenger (m)RNA is labile. Our study indicates that 1-nitropyrene (1-NP) highly induced Cyp1a1 protein expression, although its induction of AhR transactivation activity was negligible. The fact that the nuclear receptors, CAR, FXR LXR, or PXR, did not induce Cyp1a1 expression indicates that they do not mediate 1-NP’s action. When the AhR transcript was degraded by small hairpin (sh)RNA-AhR, 1-NP-induced Cyp1a1 expression largely decreased. In addition, 1-NP did not induce Cyp1a1 in AhR pathway-deficient mutant cells, which indicates that the AhR is essential for 1-NP’s action. When Cyp1a1’s turnover was examined, 1-NP was able to stabilize the 1-NP- and benzo[a]pyrene (BaP)-induced Cyp1a1 mRNA, but not protein. 1-NP-induced Cyp1a1 mRNA stabilization was mediated by Akt, but not by p38 MAPK, MEK1/2, or JNK. Among aryl hydrocarbons with four annealed phenyl rings, including pyrene, 1-NP, fluoranthene, 3-nitrofluoranthene, chrysene, and 6-nitrochrysene, only 1-NP was able to stabilize Cyp1a1 mRNA. 1-NP’s action was gene specific. In conclusion, stabilizing Cyp1a1 mRNA greatly contributed to 1-NP-induced Cyp1a1 expression, which provides new insight into gene regulation by the AhR ligand and mRNA stabilization. Introduction 1

Cytochrome P450s (CYPs ) belong to a superfamily of hemoproteins and provide monooxygenase activity in xenobiotic metabolism and biosynthesis of steroids and lipids (1, 2). In response to xenobiotics for the purpose of detoxification, cytochrome P450 (CYP) members are induced and are responsible for oxidation of xenobiotics into epoxide derivatives, as the initial step in converting them to the water-soluble derivatives for excretion (2, 3). However, the epoxide derivatives may also be further metabolized and become reactive intermediates which potentially attack DNA, resulting in DNA mutation and carcinogenesis (2, 3). CYP1A1, the best-known CYP member, is one of the major aryl hydrocarbon receptor (AhR)-sensitive targets and is highly induced by benzo[a]pyrene (BaP) (2). It was reported that the BaP-induced CYP1A1 enzyme mediates BaP-induced toxicity (4, 5). Therefore, CYP1A1, as a representative CYP, is widely used in studies of xenobiotic metabolism. In addition, CYP1A1 messenger (m)RNA is much more labile than other CYP members and most other gene transcripts (6). BaP is a well-known environmental toxicant and a prototype of carcinogenic polycyclic aromatic hydrocarbons (PAHs) (2). * To whom correspondence should be addressed. Tel: +886-5-271-7785. Fax: +886-5-271-7999. E-mail: [email protected]. † Department of Biochemical Science and Technology. ‡ Department of Bioresources. § These two authors contributed equally to this work. 1 Abbreviations: ActD, actinomycin D; AhR, aryl hydrocarbon receptor; AHRE, aryl hydrocarbon response element; ARNT, AhR nuclear translocator; BaP, benzo[a]pyrene; CAR, constitutive androstane receptor; CDCA, chenodeoxycholic acid; CHX, cycloheximide; CYP, cytochrome P450; DEP, diesel exhaust particle; FXR, farnesoid X receptor; LXR, liver X receptor; 1-NP, 1-nitropyrene; PCN, 5-pregnen-3β-ol-20-one-16R-carbonitrile; PAHs, polycyclic aromatic hydrocarbons; PXR, pregnane X receptor; RV, resveratrol; TCPOBOP, 1,4-bis-[2-(3,5-dichloropyridyloxy)]benzene.

Its induction on target genes is mediated by binding to and activation of the AhR (3-7). The AhR is a cytoplasmic protein and, upon activation by BaP, is translocated to the nucleus to form a heterodimer with the AhR nuclear translocator (ARNT) (1). Subsequently, this heterodimer binds to the aryl hydrocarbon response element (AHRE) (also called the dioxin response element (DRE) and xenobiotic response element (XRE)) in the 5′ flanking region of target genes such as CYP1A1, CYP1A2, CYP1B1, NAD(P)H quinone reductase 1, and aldehyde dehydrogenase 3A1 (8). In response to environmental toxicants, the AhR mediates carcinogenesis, teratogenesis, changes in thymocyte development, and T cell-dependent immune reactions, and triggers inflammatory skin lesions (1). Nitro-PAHs coexist with PAHs in diesel exhaust particles (DEPs). 1-Nitropyrene (1-NP) is the most abundant nitro-PAH in DEPs which contains hundreds of times more 1-NP than BaP (9, 10). Thirty percent of the directly acting mutagenicity is contributed by 1-NP in the extract of DEPs (11). 1-NP activates p53 and induces apoptosis and S phase retention (12). In addition, it increases the phosphorylation of Akt, ERK1/2, p38, and JNK (13). It is thought that AhR-targeting gene expressions are stimulated by PAHs, mediated by the highly increased transactivation activity of the AhR (14). Although it is known that 1-NP, as many PAHs and nitro-PAHs, induces Cyp1a1 (13), we found that the 1-NP-induced transactivation activity of AhR was negligible. In our investigation, we found that the way by which Cyp1a1 is induced by 1-NP is distinct from that by AhR ligands, such as BaP and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). We demonstrate that 1-NP, with structure-specificity, genespecifically induces the mRNA stability of Cyp1a1 via the Akt pathway, although the AhR is still essential for 1-NP’s action.

10.1021/tx900241g  2009 American Chemical Society Published on Web 12/04/2009

1-Nitropyrene Stabilizes Cytochrome P450 1a1 mRNA

Experimental Procedures Reagents and Antibodies. BaP was obtained from ChemService (West Chester, PA). 1-NP was obtained from Aldrich (St. Louis, MO). 1,4-Bis-[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP), chenodeoxycholic acid (CDCA), T0901317, rifampicin, resveratrol (RV), 5-pregnen-3β-ol-20-one-16R-carbonitrile (PCN), actinomycin D (ActD), cycloheximide (CHX), puromycin, and Dulbecco’s modified Eagle’s medium/nutrient mixture F12 phenol-free (DMEM/ F12) were obtained from Sigma (St. Louis, MO). Minimum essential medium (MEM), MEM alpha (MEMR), and fetal bovine serum (FBS) were obtained from Gibco (Grand Island, NY). The specific primary antibody against β-actin was obtained from Sigma. Anti-CYP1A1 (G-18), anti-AhR (N-19), donkey antigoat immunoglobulin G (IgG)-horseradish peroxidase (HRP), and goat antirabbit IgG-HRP were obtained from Santa Cruz Biotech (Santa Cruz, CA). An Akt inhibitor (deguelin), p38-MAPK inhibitors (SB203580, SB202190, and PD169316), an MEK1/2 inhibitor (PD98059), and a JNK inhibitor (SP600125) were obtained from Sigma. Akt inhibitor V (Triciribine) and Akt inhibitor X were obtained from Merck KGaA-Calbiochem (Darmstadt, Germany). Cell Culture. The mouse hepatoma cell lines, Hepa-1c1c7, c4 (B13NBii1), and c12 (B15ECiii2) were from American Type Tissue Collection (Rockville, MD). Both the c4 and c12 cell lines were derived from Hepa-1c1c7 and are deficient in Arnt and the AhR, respectively. Cells were maintained in MEMR supplemented with 10% heat-inactivated FBS, 2 mM L-glutamine, 100 units/mL penicillin, and 100 µg/mL streptomycin. When treated with the test compounds, cells were cultured in phenol red-free DMEM/F12 medium. All cultured cells were kept at 37 °C in a 95% air/5% CO2 environment. Agents were dissolved in dimethyl sulfoxide (DMSO).

Chem. Res. Toxicol., Vol. 22, No. 12, 2009 1939 Plasmid Construction and Luciferase Assay. p1646P1Luc3 contains murine Cyp1a1 5′ regulatory sequences from -1646 to +57, including 6 AHREs (also called DRE and XRE motifs), and pAhRDtkLuc3 (driven by the Cyp1a1 AhRD enhancer from -1100 to -896, containing 3 DRE motifs) (15) cloned into the pGL3basic vector. The other reporter (RSV-lacZ) expresses a lacZ geneencoded β-galactosidase, driven by a Rouse sarcoma virus long terminal repeat (LTR). Luciferase activity indicates the transcription activity of the promoter, and the β-galactosidase activity of RSVlacZ was used to normalize luciferase activity. For DNA transfection, Hepa-1c1c7 cells were seeded at 2.5 × 104 cells/well in a 24-well plate overnight, and then plasmids of a luciferase reporter and RSV-lacZ were transiently transfected into cells using Lipofectamine 2000 Transfection Reagent (Invitrogen, Carlsbad, CA) for 6 h, followed by treatment with the test compounds. Assays of reporter activity, luciferase and β-galactosidase, were performed as described previously (16). Reverse-Transcription Polymerase Chain Reaction (RT-PCR) and Quantitative PCR. Hepa-1c1c7 cells were seeded at 4 × 105 cells per 6-cm dish for 24 h and then were treated with the test compounds. The mRNA expressions of target genes were analyzed by quantitative RT-PCR. Total RNA of Hepa-1c1c7 cells was extracted using the TRIZOL reagent (Invitrogen, Carlsbad, CA). First-strand complementary (c)DNA was synthesized from RNA using M-MLV reverse transcriptase (Invitrogen) and oligo-dT25. For the quantitative PCR, first-strand cDNA was used for amplification in the quantitative PCR with specific oligonucleotide primers for AhR (GenBank: NM_013464) (forward, 5′-TGAAACCTATTCGTCCGACTTGA-3′ and reverse, 5′-TCCACCGGGTGTGATATCG-3′), Cyp1a1 (GenBank: NM_009992) (forward, 5′CTCTGGGCAGTAAAACCAGGTCTA-3′ and reverse, 5′-

Figure 1. Cyp1a1 promoter activity and expression profiles of mRNA and protein induced by 1-nitropyrene (1-NP) and benzo[a]pyrene (BaP). (A, B, and C) Hepa-1c1c7 cells were transfected with a plasmid of p1646P1Luc3 (A) and pAhRDtkLuc3 (B,C) together with RSV-lacZ, followed by treatment with 5 and 25 µM 1-NP, resveratrol (RV), BaP, or a binary mixture of 1-NP and BaP for 8 h. Afterward, cells were harvested, and luciferase and β-galactosidase activities of cell lysates were analyzed as described in Experimental Procedures. Results are expressed as the mean ( SEM, n ) 3. (D and E). Hepa-1c1c7 cells were treated with 1-NP (25 µM) and BaP (25 µM) until they were collected at 0-16 h for RNA analysis (D) and 0-20 h for protein analysis (E). Total RNA and protein were harvested for the analysis. The expression of Cyp1a1 mRNA was analyzed by quantitative PCR as described in Experimental Procedures. The expression of Cyp1a1 protein was analyzed by Western blots. Cyp1a1 protein level revealed by the Western blots was quantified and was standardized against the amount of β-actin protein. Results are expressed as the mean ( SEM, n ) 3. * and # compared to the bar indicated by the arrow. ***p < 0.001, **p < 0.01, *p < 0.05, ###p < 0.001, and ##p < 0.01.

1940

Chem. Res. Toxicol., Vol. 22, No. 12, 2009

Figure 2. Comparison of cytochrome P450 1a1 (Cyp1a1) expression induced by 1-nitropyrene (1-NP), resveratrol (RV), benzo[a]pyrene (BaP), and other ligands. (A) Hepa-1c1c7 cells were treated for 9 h with 1-NP (25 µM), RV (25 µM), BaP (25 µM), 1,4-bis-[2-(3,5dichloropyridyloxy)]benzene (TCPOBOP) (250 nM), chenodeoxycholic acid (CDCA) (10 µM), T0901317 (10 µM), rifampicin (50 µM), and 5-pregnen-3β-ol-20-one-16R-carbonitrile (PCN) (25 µM). Afterward, cells were harvested, and the Cyp1a1 protein expression of cell lysates was analyzed by Western blots. (B) The Cyp1a1 protein level revealed by the Western blots was quantified. Results are expressed as the mean ( SEM, n ) 3. ***p < 0.001, and **p < 0.01.

CAAGGCCTCCTTTGGTAGCA-3′),Cyp1a2(GenBank:NM_009993) (forward, 5′-CAGCATCCTCTTGCTATTTGGA-3′ and reverse, 5′GGTTCGAAGTGGCCAACCT-3′), p53 (GenBank: X01237) (forward, 5′-TGGACCCTGGCACCTACAAT-3′ and reverse, 5′GGAAAGTAGGCCCTGGAGGAT-3′), and β-actin (GenBank:

Chu et al. NM_007393) (forward, 5′-CTGACAGGATGCAGAAGGAGATTA3′ and reverse 5′-GCCACCGATCCACACAGAGT-3′). Primers were designed using the Primer Express 2.0 software following Applied Biosystems’ instructions for optimal primer design. To ensure that equal amounts of RNA and cells were applied, β-actin mRNA was also analyzed to normalize differences in sample uptake. A quantitative PCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) containing SYBR Green fluorescence dye, AmpliTaq Gold DNA Polymerase, a blend of dTTP/dUTP, and an optimized buffer component. The final primer concentration was 150 nM. After initial incubation at 50 °C for 2 min and 95 °C for 10 min, samples were amplified by running 40 cycles of 95 °C for 15 s followed by 60 °C for 1 min in an ABI PRISM 7500 Sequence Detection System (Applied Biosystems). For data analysis by quantitative PCR, baseline and threshold values (CT) for AhR, Cyp1a1, Cyp1a2, p53, and β-actin were set using ABI 7500 Prism Software, and the calculated CT values were transferred to Microsoft Excel for analysis. The relative expression of mRNA was calculated using the comparative CT method as described in the manufacturer’s instructions (Applied Biosystems). The relative amounts of AhR, Cyp1a1, Cyp1a2, and p53 mRNA, individually standardized against the amount of β-actin mRNA, in cells were expressed as -∆CT ) -[CTtarget - CTβ-actin]. The ratio of target gene mRNA/β-actin mRNA, i.e., the relative AhR, Cyp1a1, Cyp1a2, or p53 expression, was then calculated as 2-∆∆CT. An independent t-test was used to analyze differences in AhR, Cyp1a1, Cyp1a2, and p53 mRNA expressions between various groups. The graphs for the results of the quantitative real-time PCR were drawn using Graphpad Prism version Five for Windows (Graphpad Software, San Diego, CA). Cell Lysis and Western Blotting. Hepa-1c1c7 (4 × 105 cells/ well), c4 (B13NBii1) (5 × 105 cells/well), and c12 (B15ECiii2) (8.4 × 105 cells/well) cells were seeded in 6-well plates overnight and were individually treated with 1-NP, RV, and BaP. At the end

Figure 3. Effect of aryl hydrocarbon receptor (AhR) on the expression of cytochrome P450 1a1 (Cyp1a1) induced by 1-nitropyrene (1-NP) and benzo[a]pyrene (BaP). (A and B) A short hairpin (sh) RNA-AhR was produced in Hepa-1c1c7 cells as described in Experimental Procedures. Total RNA and protein were harvested from cells. Relative amounts of AhR mRNA (A) and protein (B) levels in cells without and with the shRNA-AhR are shown. mRNA levels of AhR and β-actin were revealed by quantitative PCR, as described in Experimental Procedures. The relative amounts of AhR mRNA were standardized against the amounts of β-actin mRNA. The AhR protein level revealed by the Western blots was quantified. The relative amounts of the AhR protein were standardized against the amounts of β-actin protein. Results are expressed as the mean ( SEM, n ) 3. ***p < 0.001, and **p < 0.01. (C) Cells, without and with the shRNA-AhR, were treated with 10 and 25 µM 1-NP and BaP for 9 h, and then the Cyp1a1 protein expression of their cell lysates was analyzed by Western blots. (D) Hepa-1c1c7, c4 (B13NBii1), and c12 (B15ECiii2) cells were treated with 25 µM 1-nitropyrene (1-NP), resveratrol (RV), and benzo[a]pyrene (BaP) individually for 9 h, and then the Cyp1a1 protein expression of their cell lysates was analyzed by Western blots.

1-Nitropyrene Stabilizes Cytochrome P450 1a1 mRNA

Chem. Res. Toxicol., Vol. 22, No. 12, 2009 1941 Table 1. Half-Lives of Cyp1a1 mRNA and Protein in Cells Treated with 1-Nitropyrene (1-NP), Benzo[r]pyrene (BaP), or Resveratrol (RV)a 1-NP-induced Cyp1a1 mRNA 1-NP-induced Cyp1a1 protein treatment

half-life of mRNA

increase (fold)

control 1-NPb 1-NP BaP RV

7.6 ( 0.8 9.7 ( 0.6* 11.0 ( 1.6* 10.0 ( 0.9* 5.9 ( 0.8*

1.3× 1.5× 1.3× 0.8×

half-life of protein

increase (fold)

5.0 ( 0.16

BaP-induced Cyp1a1 mRNA treatment

half-life of mRNA

increase (fold)

control BaPb 1-NP BaP RV

9.4 ( 1.6 9.6 ( 1.4 21.8 ( 2.2** 11.1 ( 1.5 7.3 ( 1.1

1.0× 2.3× 1.2× 0.8×

5.8 ( 0.57 5.1 ( 0.33 6.5 ( 1.28

1.2× 1.0× 1.3×

BaP-induced Cyp1a1 protein half-life of protein

increase (fold)

6.4 ( 0.20 6.4 ( 0.24 6.3 ( 0.69 6.6 ( 0.42

1.0× 1.0× 1.0×

a Note that half-lives (t1/2 (h)) are presented as the mean ( SEM, n ) 3. * Indicates a comparison with the control. ** p < 0.01, * p < 0.05. b Initial treatment with 1-NP or BaP was not removed from the culture medium while cells were treated with actinomycin D.

Figure 4. Effects of 1-nitropyrene (1-NP), benzo[a]pyrene (BaP), and resveratrol (RV) on the stability of cytochrome P450 1a1 (Cyp1a1) mRNA. Hepa-1c1c7 cells were individually pretreated with 1-NP (10 µM) (A) and BaP (5 µM) (B) for 8 h to induce Cyp1a1 mRNA expression. 1-NP and BaP were then either removed or not removed from the culture medium, followed by the addition of actinomycin D (ActD) (5 µg/mL). One-half hour after ActD treatment, 1-NP (10 µM), BaP (10 µM), and RV (10 µM) were individually added to the culture medium in which the initial treatment with 1-NP or BaP had been removed. Cellular total RNA was harvested at 0, 5, 10, 15, and 20 h after ActD treatment. mRNA levels of Cyp1a1 and β-actin were revealed by quantitative RT-PCR. The relative amounts of Cyp1a1 mRNA were standardized against the amounts of β-actin mRNA. Results are expressed as the mean ( SEM, n ) 3. The half-life (t1/2) of Cyp1a1 mRNA was calculated, as described in Experimental Procedures, on the basis of the results of quantitative PCR.

of the desired treatments, cell lysates were prepared, and Western blot was performed as described previously (16). Protein levels revealed by the Western blots were quantified using AlphaEase FC software (Alpha Innotech, San Leandro, CA), the data were exported to Microsoft Excel for calculation, and the plots were drawn using Sigmaplot 9.0. RNA Interference (RNAi). To perform RNAi, a short hairpin (sh)RNA for mouse AhR RNAi, designated shRNA-AhR, was produced from the pLKO.1 vector containing the short hairpin sequence, 5′ AAACCCAGGGCTGCCTTGGAAAAG 3′, with a clone ID of TRCN0000055412 (Open Biosystems, Huntsville, AL).

Hepa-1c1c7 cells were seeded at 4 × 105 cells/6-cm dish overnight, and then cells were transfected with either the control vector or shRNA-AhR-pLKO.1 for 6 h, using the Lipofectamine 2000 transfection reagent. At 48 h post-transfection, puromycin (6 µg/ mL) was added for 12 h to select stable transfectants, and afterward, cells were maintained in a medium containing puromycin (1 µg/ mL) for another 12 h, followed by treatment with the test compounds. To knock down Akt, a 21-nucleotide duplex corresponding to the mouse Akt1 mRNA (GenBank: NM_009652) was carried by a lentivirus (National RNAi Core Facility, Taipei, Taiwan). The two nucleotide duplexes for mouse Akt1 were Akt1-1 (GCACATCAAGATAACGGACTT, clone ID: TRCN0000022934) and Akt1-2 (CGTGTGACCATGAACGAGTTT, clone ID: TRCN0000022935). An 18-nucleotide duplex for green fluorescence protein (GFP; TATCATGGCCGACAAGCA, clone ID: TRCN0000072180) was used as a control for viral infection. Hepa-1c1c7 (1 × 105 cells/ well) cells were seeded in 6-well plates overnight and then infected by a lentivirus (4 × 105/well) for 24 h. Forty-eight hours after infection, cells with shRNA were selected by puromycin (0.5 µg/ mL). MTT Cell Viability Assay. Hepa-1c1c7 cells were plated in 96well plates at 1 × 104 cells with 0.1 mL of medium. After a 24-h culture, they were treated with a range of concentrations of drugs for 12 and 24 h. Then, cells were treated with methylthiazolyldiphenyltetrazolium bromide (MTT) (Sigma) for the assay. The optical densities at 550 nm were measured using an enzyme-linked immunosorbent assay (ELISA) plate reader (BIO-TEK, Winooski, VT). Six samples were assayed for each experiment and were repeated at least three times. Statistical Analysis. Data are representative of at least 3 independent experiments under identical conditions and are expressed as the mean ( SEM. Differences among data of the control and further treatments with various chemicals were analyzed by Student’s t-test. Statistical probability (p) was expressed as ***p < 0.001, **p < 0.01, and *p < 0.05 or ###p < 0.001, ##p < 0.01, and # p < 0.05. Means were considered significantly different at p < 0.05.

Results 1-NP Slightly Stimulates Transactivation Activity of the AhR. To identify the transcriptional function of the Cyp1a1 promoter and the AHRE in mediating 1-NP’s action, the p1646P1Luc3 reporter containing 1646 bp of the promoter region and the pAhRDtkLuc3 reporter containing 3 AHRE motifs were individually introduced into Hepa-1c1c7, followed

1942

Chem. Res. Toxicol., Vol. 22, No. 12, 2009

Chu et al.

Figure 5. Effects of 1-nitropyrene (1-NP), benzo[a]pyrene (BaP), and resveratrol (RV) on the stability of cytochrome P450 1a1 (Cyp1a1) protein. Cells were pretreated with 1-NP (10 µM) (A) and BaP (5 µM) (B), and then 9 h later, 1-NP and BaP were removed from the culture, followed by the addition of cycloheximide (CHX) (50 µg/mL). One-half hour after treatment with CHX, 1-NP (10 µM), BaP (10 µM), and RV (10 µM) were added to the culture. Cells were harvested at 0, 2, 4, 6, and 8 h after CHX treatment. Cell lysates were subjected to SDS-PAGE, followed by Western blotting using antibodies for anti-Cyp1a1 and anti-β-actin. Protein levels of Cyp1a1 and β-actin revealed by Western blots were quantified as described in Experimental Procedures. The relative amounts of Cyp1a1 protein were standardized against the amounts of β-actin protein. Results are expressed as the mean ( SEM, n ) 3. The half-life (t1/2) of Cyp1a1 protein was calculated, as described in Experimental Procedures.

by treatment with 5 or 25 µM 1-NP, RV, and BaP for 8 h. RV and BaP were used as reference compounds for 1-NP induction. BaP highly induced the transcriptional activity of the Cyp1a1 promoter and AHRE (Figure 1A,B). In contrast, RV and 1-NP caused minor stimulation of promoter activity; however, RV produced higher induction than 1-NP did. RV is known to antagonize BaP’s activation of the AhR (17); therefore, whether 1-NP also antagonizes BaP’s action was also tested here. 1-NP (25 µM) also reduced the BaP-induced transcriptional activity of AHRE by 30% in Hepa-1c1c7 cells (Figure 1C). 1-NP Time Course-Dependently Regulates the Expression of Cyp1a1 mRNA and Protein. Treatment with 1-NP (25 µM) and BaP (25 µM) largely increased Cyp1a1 mRNA with timecourse dependence in Hepa-1c1c7 cells. The induction of Cyp1a1 mRNA expression was detectable after 2 h of treatment with 1-NP and BaP, reached a maximum level at 8 and 6 h of treatment, respectively, and decreased thereafter (Figure 1D). Treatment with 1-NP and BaP for 6 h induced 4.9- and 16-fold increases, and for 8 h, 5.7- and 13-fold increases, respectively, in Cyp1a1 mRNA. Similarly, the protein level of Cyp1a1 reached maximum levels at 10 and 8 h of treatment with 1-NP and BaP, respectively, and also gradually decreased thereafter, although 1-NP and BaP were still individually present in the culture medium (Figure 1E).

AhR Is Essential for 1-NP’s Induction of Cyp1a1 Expression. To identify any receptor mediating 1-NP-induced Cyp1a1 expression, 1-NP, RV, BaP, TCPOBOP, CDCA, T0901317, rifampicin, and PCN were applied to the culture of Hepa-1c1c7 cells to detect Cyp1a1 expression. BaP, TCPOBOP, CDCA, T0901317, rifampicin, and PCN are respective ligands of the AhR, mouse constitutive androstane receptor (mCAR), farnesoid X receptor (FXR), liver X receptor (LXR), human pregnane X receptor (hPXR), and mouse pregnane X receptor (mPXR). Among these ligands, both 1-NP and BaP highly and RV slightly induced an increase in the Cyp1a1 protein level in Hepa-1c1c7 cells (Figure 2A,B). In contrast, nuclear receptors responsive to other ligands did not increase Cyp1a1 expression. To identify the necessity of the AhR for 1-NP’s induction of Cyp1a1, we introduced shRNA for the AhR into Hepa-1c1c7 cells to knock down AhR levels. The relative AhR mRNA and protein levels in cells, without and with shRNA-AhR, were measured by a quantitative PCR and Western blotting. The shRNA-AhR caused respective 58% and 53% decreases in AhR mRNA and protein levels in cells (Figure 3A,B). Cells transfected with either the control vector or the shRNA-AhR plasmid were treated with 10 and 25 µM 1-NP and BaP. Consistent with reduced AhR expression, 1-NP- and BaP-induced Cyp1a1 expressions were greatly reduced in cells containing shRNA-

1-Nitropyrene Stabilizes Cytochrome P450 1a1 mRNA

Figure 6. Effects of kinase inhibitors on 1-nitropyrene (1-NP)induced stabilization of cytochrome P450 1a1 (Cyp1a1) mRNA. (A and B) Hepa-1c1c7 cells were treated with benzo[a]pyrene (BaP) (10 µM) or actinomycin D (ActD) (5 µg/mL) for 8 h before being harvested for total RNA extraction. In the ActD chase experiment, cells were pretreated with BaP (10 µM) for 8 h to induce Cyp1a1 mRNA expression, and then BaP was removed from the culture medium, followed by treatment with ActD (5 µg/mL). One-half hour after ActD treatment, 1-NP (10 µM), kinase inhibitors, or the binary mixtures of 1-NP and kinase inhibitors were added to the culture medium. (A) The Akt inhibitor (deguelin, 0.2 µM), p38-MAPK inhibitors (SB203580 (25 µM), SB202190 (20 µM), and PD169316 (10 µM)), the MEK1/2 inhibitor (PD98059, 10 µM), and the JNK inhibitor (SP600125, 50 µM) were applied. (B) Akt inhibitor V (Akti V, 10 µM), Akt inhibitor X (Akti X, 10 µM), and deguelin (0.2 µM) were applied. Bars with a slash indicate that cells were treated with ActD after 8 h of induction by BaP, and bars with gray color indicate cells treated with 1-NP in the ActD chase experiment. Cellular total RNA was harvested at 12 h after ActD treatment, and mRNA levels of Cyp1a1 and β-actin were revealed by quantitative RT-PCR. The relative amounts of Cyp1a1 mRNA were standardized against the amounts of β-actin mRNA. Results are expressed as the mean ( SEM, n ) 3, of at least three separate experiments. (C) Hepa-1c1c7 cells were treated for 12 and 24 h with deguelin (0.2 and 0.4 µM), Akt inhibitor V (1, 3, and 10 µM), and Akt inhibitor X (1, 3, and 10 µM). Cell viability was analyzed by an MTT assay as described in Experimental Procedures. The data are presented as the mean ( SEM, n ) 6, of at least three separate experiments. ***p < 0.001, **p < 0.01, *p < 0.05, ###p < 0.001, ##p < 0.01, and # p < 0.05.

Chem. Res. Toxicol., Vol. 22, No. 12, 2009 1943

AhR (Figure 3C). In addition, the induction of Cyp1a1 expression by 1-NP and BaP was abolished in Arnt-deficient c4 cells and AhR-deficient c12 cells (Figure 3D). 1-NP Stabilizes Cyp1a1 mRNA but Not Protein. Whether 1-NP-induced increases in mRNA and protein of Cyp1a1 are partially due to 1-NP-induced stabilization was determined here. ActD is a transcription inhibitor. To analyze and compare the functions of 1-NP, BaP, and RV on stabilizing Cyp1a1 mRNA, Hepa-1c1c7 cells were individually treated with 1-NP (10 µM) and BaP (5 µM) for 8 h to induce Cyp1a1 transcription. 1-NP and BaP were then either removed or not removed from the culture medium, and transcription was halted by ActD (5 µg/ mL) treatment. One-half hour after ActD treatment, 1-NP (10 µM), BaP (10 µM), and RV (10 µM) were individually added to the culture medium in which the initial treatment with 1-NP or BaP was removed, and cellular total RNA was harvested at 0, 5, 10, 15, and 20 h after cellular transcription was inhibited by ActD. Cyp1a1 mRNA levels were measured by quantitative PCR, and their half-lives (t1/2) were calculated and are summarized in Figure 4 and Table 1. The half-lives of 1-NP-induced Cyp1a1 mRNA were 11.0 h (1-NP) > 10.0 h (BaP) > 9.7 h (1-NP not removed) > 7.6 h (control) > 5.9 h (RV) (Figure 4A and Table 1). The half-lives of BaP-induced Cyp1a1 mRNA were 21.8 h (1-NP) > 11.1 h (BaP) > 9.6 h (BaP not removed) > 9.4 h (control) > 7.3 h (RV) (Figure 4B and Table 1). We also further examined the functions of 1-NP, BaP, and RV in stabilizing the Cyp1a1 protein. Cells were pretreated with 1-NP (10 µM) and BaP (5 µM) individually for 9 h to induce Cyp1a1 protein expression. Afterward, 1-NP and BaP were removed from the culture medium, and translation was stopped by CHX (50 µg/mL) treatment. One-half hour after CHX treatment, 1-NP (10 µM), BaP (10 µM), and RV (10 µM) were individually added to the culture medium, and cell lysates were harvested at 0, 2, 4, 6, and 8 h after translation was inhibited by CHX. Cyp1a1 protein levels were quantified, and their halflives were measured and are summarized in Figure 5 and Table 1. The respective half-lives of the 1-NP-induced Cyp1a1 protein were 5.0, 5.8, 5.1, and 6.5 h for the control and treatment with 1-NP, BaP, and RV (Figure 5A and Table 1). The respective half-lives of the BaP-induced Cyp1a1 protein were 6.4, 6.4, 6.3, and 6.6 h. h for the control and treatment with 1-NP, BaP, and RV (Figure 5B and Table 1). Neither 1-NP, RV, nor BaP had a distinct effect on the stability of the induced Cyp1a1 protein. The Akt pathway mediates 1-NP-induced Cyp1a1 mRNA stabilization. We were interested in analyzing whether any kinase pathway mediated 1-NP-induced mRNA stabilization. Cells were treated with either ActD or BaP for 8 h. BaP increased Cyp1a1 mRNA expression 12-fold compared to that in the control. But treatment with ActD, as expected, abolished basal Cyp1a1 mRNA expression, and only 40% of the basal Cyp1a1 mRNA was left after 8 h of treatment (Figure 6A). In an ActD chase experiment, cells were pretreated with BaP to induce Cyp1a1 expression and then treated with ActD and 1-NP plus different kinase inhibitors for 12 h. The Akt inhibitor (deguelin), p38-MAPK inhibitors (SB203580, SB202190, and PD169316), MEK1/2 inhibitor (PD98059), and JNK inhibitor (SP600125) were applied individually or together with 1-NP treatment in the ActD chase experiment. Two-fold more Cyp1a1 mRNA remained in cells treated with 1-NP than in the control (Figure 6A). Among these kinase inhibitors, only deguelin neutralized 1-NP’s action in inducing Cyp1a1 mRNA stability. These kinase inhibitors themselves did not have an effect on Cyp1a1 mRNA stability. Two more Akt inhibitors, Akt inhibitor V and Akt inhibitor X, were also applied to examine the function

1944

Chem. Res. Toxicol., Vol. 22, No. 12, 2009

Chu et al.

Figure 7. Effect of Akt RNAi (interference) on 1-nitropyrene (1-NP)-induced cytochrome P450 1a1 (Cyp1a1) mRNA stabilization. Lentiviruses individually carrying a short hairpin (sh)RNA of green fluorescence protein (GFP) and two different shRNAs of Akt1, designated Akt1-1 and -2, were used to infect cells, and to create respective shRNA, as described in Experimental Procedures. Virus with shRNA-GFP was used as a control of viral infection. (A) Cells, without and with the shRNA-GFP and shRNA-Akt1, were treated with 1-NP (10 µM) for 9 h. The expressions of Akt, Cyp1a1, and β-actin proteins were analyzed by Western blots. Akt and Cyp1a1 protein levels revealed by the Western blots were quantified and standardized against the amount of β-actin protein. Results are expressed as the mean ( SEM, n ) 3. (B) Cells were treated with benzo[a]pyrene (BaP) (10 µM) for 8 h before being harvested for total RNA extraction. In the ActD chase experiment, cells were pretreated with BaP (10 µM) for 8 h to induce Cyp1a1 mRNA expression, and then BaP was removed from the culture medium, followed by the addition of actinomycin D (ActD) (5 µg/mL) and, one-half hour later, 1-NP (10 µM) to the culture medium. Cellular total RNA was harvested at 12 h after ActD treatment. mRNA levels of Cyp1a1 and β-actin were revealed by quantitative RT-PCR. The relative amounts of Cyp1a1 mRNA were standardized against the amounts of β-actin mRNA. Results are expressed as the mean ( SEM, n ) 3. ***p < 0.001, **p < 0.01, *p < 0.05, ###p < 0.001, and ##p < 0.01.

of Akt in 1-NP’s action. In the ActD chase experiment, Akt inhibitor V and Akt inhibitor X, respectively, reduced 48% and 77% of 1-NP-induced Cyp1a1 mRNA stabilization (Figure 6B). Neither Akt inhibitor V nor Akt inhibitor X themselves had a significant influence on Cyp1a1 mRNA stabilization. In order to understand the toxic effects of these Akt inhibitors on cell viability, an MTT assay was performed. Cells were treated for 12 and 24 h with deguelin (0.2 and 0.4 µM), Akt inhibitor V (1, 3, and 10 µM), and Akt inhibitor X (1, 3, and 10 µM). Cells treated individually with deguelin and Akt inhibitor V for 12 and 24 h had more than 87% viability (Figure 6C). In contrast, treatment with Akt inhibitor X (1, 3, and 10 µM) increased cell viability, up to 137% at 24 h at 10 µM. Therefore, the suppressive effect of Akt inhibitors on 1-NP’s action was not due to the influence of cell viability. To further identify the necessity of Akt in 1-NP’s induction of Cyp1a1 mRNA stabilization, shRNAs for the Akt1 were introduced into Hepa-1c1c7 cells by lentiviruses to knock down Akt levels. Lentiviruses were used to individually produce shRNA of the green fluorescence protein (GFP), and two different shRNAs of Akt1, designated Akt1-1 and -2, in virusinfected cells. Virus with shRNA-GFP was used as a control of viral infection. The relative Akt protein levels in cells, without

and with shRNA-GFP and shRNA-Akt1, were revealed by Western blotting. There was no difference of Akt protein levels between cells without shRNA and with shRNA-GFP (Figure 7A). There were only 30% and 40% of Akt left in cells with shRNA-Akt1-1 and -2, respectively. In an ActD chase experiment, cells were pretreated with BaP to induce Cyp1a1 expression and then treated with ActD and 1-NP for 12 h. 1-NP increased Cyp1a1 mRNA stability in noninfected cells and shRNA-GFP virus-infected cells (Figure 7B). In contrast, 1-NP did not increase Cyp1a1 mRNA stability in cells infected by viruses of shRNA-Akt1-1 and -2. Cells with shRNA-GFP, -Akt1-1, and -Akt1-2 had a slightly higher basal Cyp1a1 protein expression than cells without shRNA (Figure 7A). 1-NP-induced Cyp1a1 protein expression levels were slightly lower in cells with shRNA-Akt1-1 and -2 than in cells without shRNA. 1-NP, with Structural Uniqueness, Gene-Specifically Stabilizes Cyp1a1 mRNA. It was interesting to determine whether 1-NP is able to stabilize mRNA of genes other than Cyp1a1. Cells were pretreated with BaP for 8 h to induce Cyp1a1, Cyp1a2, and p53, followed by treatment with ActD plus 1-NP for 12 h. In the ActD chase experiment, 2.2-fold more mRNA of Cyp1a1, but not Cyp1a2 or p53, remained in cells treated with 1-NP than in the control (Figure 8).

1-Nitropyrene Stabilizes Cytochrome P450 1a1 mRNA

Chem. Res. Toxicol., Vol. 22, No. 12, 2009 1945

Figure 8. Gene-specificity of 1-nitropyrene (1-NP)-induced mRNA stabilization. Cells were treated with benzo[a]pyrene (BaP) (10 µM) for 8 h to induce mRNA expressions of cytochrome P450 (Cyp) 1a1, Cyp1a2, and p53, and then cellular total RNA was harvested. In the actinomycin D (ActD) chase experiment, cells were pretreated with BaP (10 µM) for 8 h, and then BaP was removed from the culture medium, followed by treatment with ActD (5 µg/mL). One-half hour after ActD treatment, 1-NP (10 µM) was added to the culture medium. Cellular total RNA was harvested at 12 h after ActD treatment, and mRNA levels were revealed by quantitative RT-PCR. The relative amounts of Cyp1a1, 1a2, and p53 mRNA were individually standardized against the amounts of β-actin mRNA. Results are expressed as the mean ( SEM, n ) 3; *** and ### p < 0.001.

To determine whether other PAHs or nitro-PAHs with 4 annealed phenyl rings are able to stabilize Cyp1a1 mRNA, we tested pyrene (Py), 1-NP, fluoranthene (Fla), 3-nitrofluoranthene (3-NF), chrysene (Chry), and 6-nitrochrysene (6-NC). The structures of these compounds and BaP are shown in Figure 9A. Cells were pretreated with BaP to induce Cyp1a1, followed by treatment for 12 h with ActD plus Py, 1-NP, Fla, 3-NF, Chry, or 6-NC individually. Among these tested compounds, only 1-NP was able to stabilize Cyp1a1 mRNA (Figure 9B).

Discussion Activated AhR binding to the AHRE on target genes is a well-known pathway mediating PAHs’ induction of CYP1A1, and few data are available for any other mechanism. We conducted experiments to analyze the action of 1-NP on inducing Cyp1a1 expression, and the results indicated that 1-NP’s induction of Cyp1a1 expression was due to an essential, but minor, increase in AhR activity, and was mainly due to an increase in Cyp1a1 mRNA stability. BaP highly stimulated the transcription activities of both the CYP1A1 promoter and AHRE, which are mediated by their binding to the AhR (7). RV was shown to be a competitive antagonist of AhR ligands such as BaP (17, 18) and highly inhibits BaP-induced CYP1A1 expression (17, 19, 20). In this study, BaP and RV were used as reference compounds for novel 1-NP’s action of inducing Cyp1a1 expression. Compared to the effect of BaP in Hepa-1c1c7 cells, the extent of the 1-NP- and RV-induced transcriptional activities of the Cyp1a1 promoter and AHRH was almost negligible. 1-NP was even less potent than RV in this case. In contrast, 1-NP induced higher Cyp1a1 protein expression than did RV. These results aroused our interest to analyze the effects of 1-NP on Cyp1a1 expression. 1-NP antagonized BaP-induced transactivation of the AHRE. It was also reported that 1-NP attenuates the formation of the BaP-DNA adduct in HepG2 cells (21). These results indicate that 1-NP induced less AhR activity than did BaP. Although 1-NP-induced transactivation activity of the AhR was less than one-tenth that induced by BaP, 1-NP was able to induce Cyp1a1

Figure 9. Effects of polycyclic aromatic hydrocarbons (PAHs) with 4 annealed phenyl rings on cytochrome P450 1a1 (Cyp1a1) mRNA stability. (A) Structures of benzo[a]pyrene (BaP), pyrene (Py), 1-nitropyrene (1-NP), fluoranthene (Fla), 3-nitrofluoranthene (3-NF), chrysene (Chry), and 6-nitrochrysene (6-NC). (B) Cells were treated with BaP (10 µM) for 8 h before being harvested for total RNA extraction. In the ActD chase experiment, cells were pretreated with BaP (10 µM) for 8 h to induce Cyp1a1 mRNA expression, and then BaP was removed from the culture medium, followed by treatment for 12 h with ActD (5 µg/mL). One-half hour after ActD treatment, 10 µM Py, 1-NP, Fla, 3-NF, Chry, or 6-NC was individually added to the culture medium. Bars with a slash indicate that cells were treated with ActD after 8 h of induction by BaP. Cellular total RNA was harvested at 12 h after ActD treatment, and mRNA levels of Cyp1a1 and β-actin were revealed by a quantitative RT-PCR. The relative amounts of Cyp1a1 mRNA were standardized against the amounts of β-actin mRNA. Results are expressed as the mean ( SEM, n ) 3; *** and ### p < 0.001.

mRNA and protein levels by up to 50% and 75%, respectively, of those induced by BaP. Relative to BaP, 1-NP only slightly stimulated transactivation activity of the AhR, but it highly increased the mRNA and protein levels of Cyp1a1. Thus, we hypothesized that the induction of Cyp1a1 expression by 1-NP is potentially mediated by an unknown mechanism other than that which applies to BaP. In our time-course studies of Cyp1a1 expression, 1-NP- and BaP-induced Cyp1a1 transcript levels reached maxima at 8 and 6 h, respectively, and afterward gradually diminished even in the presence of 1-NP and BaP. Cyp1a1 protein levels induced by 1-NP and BaP had similar expression patterns, peaked at 10 and 8 h, respectively, with the transcript levels. It was shown that the AhR level decreased after BaP treatment (5). Therefore, the decrease in Cyp1a1 after the induction reached a peak was potentially due to desensitization of the AhR. There was a 2-h

1946

Chem. Res. Toxicol., Vol. 22, No. 12, 2009

lag of induction peaks for Cyp1a1 mRNA and protein induced by 1-NP, relative to those by BaP, which implies the contribution of mRNA stability to 1-NP’s induction. In addition to the AhR, other nuclear receptors, such as CAR FXR, LXR, and PXR, also mediate the induction of CYP members, which are responsible for metabolizing endogenous and xenobiotic hydrocarbons (3, 22). TCPOBOP, CDCA, T0901317, rifampicin, and PCN are the respective ligands of mCAR, FXR, LXR, hPXR, and mPXR, and none of them could induce Cyp1a1 expression. The inability of these ligands (mCAR, FXR, LXR, hPXR, and mPXR) to induce Cyp1a1 expression was because either the ligands’ respective receptors were not present in Hepa-1c1c7 cells or their activated receptors did not induce Cyp1a1 expression. Either one of these conditions demonstrates that 1-NP’s action was not mediated by those receptors, but by the AhR. To further analyze the requirement of the AhR in 1-NP’s induction of Cyp1a1 expression, shRNA-AhR was introduced into cells to degrade the endogenous AhR mRNA. As expected, BaP-induced Cyp1a1 expression was abolished when the AhR expression level was reduced. Similarly, 1-NP’s induction of Cyp1a1 expression was also largely diminished. AhR- and ARNT-deficient mutants of Hepa-1c1c7 cells did not respond to 1-NP, RV, or BaP induction of Cyp1a1 expression either. These results demonstrate that the AhR is essential for 1-NP’s induction of Cyp1a1. Although CYP1A1 is one of the most AhR-sensitive targets, its mRNA is remarkably unstable, compared to that of many other CYP members. The half-life of CYP1A1 mRNA is 2.4 h, and those of CYP1A2, 1B1, and 2E2 mRNA are all >24 h in HepG2 cells (6). In the ActD chase experiment, results showed that 1-NP had a much greater ability to stabilize Cyp1a1 mRNA compared to BaP, while RV did not stabilize it. It is interesting that BaP-induced Cyp1a1 mRNA which was stabilized by 1-NP had the longest half-life in this experiment. Because 1-NP inducing Cyp1a1 mRNA stabilization contributed highly to 1-NP’s induction of Cyp1a1 expression, we hypothesized that long-term treatment with 1-NP may desensitize the pathway mediating Cyp1a1 mRNA stabilization. Therefore, after transcription was stopped, treatment with 1-NP was able to highly increase the half-life of Cyp1a1 mRNA induced by BaP, but not much further for that induced by 1-NP. Information on the mechanism of mRNA stabilization is limited. It was shown that 1-NP increases the phosphorylation of Akt, ERK1/2, p38, and JNK (13). Therefore, we further analyzed whether any kinase mediates 1-NP-induced Cyp1a1 mRNA stabilization. When kinase activities were blocked by their respective kinase inhibitors, only the Akt inhibitors neutralized 1-NP’s enhancement of mRNA stability. This result was further confirmed by application of shRNA-Akt, which knocked down the Akt expression level. Akt is defined as a signal-mediating growth/survival factor (23). Results indicate that Akt mediated 1-NP-induced Cyp1a1 mRNA stabilization. Whether this is due to the function of detoxification of Cyp1a1, which may favor cellular survival, remains to be determined. We were also interested in the gene specificity and structure relationship of the inducer of mRNA stabilization. When BaPinduced Cyp1a2 and p53 mRNAs were tested, they were not stabilized by 1-NP. In addition, PAHs and nitro-PAHs with 4 annealed phenyl rings, including pyrene, Fla, 3-NF, chry, and 6-NC, were tested, and none of them was able to stabilize Cyp1a1 mRNA. Nevertheless, 3-NF, Chry, and 6-NC were able to stimulate greater transcriptional activity of the Cyp1a1 promoter and AHRE and Cyp1a1 protein expressions than did

Chu et al.

1-NP (data not shown), which indicates that they use a different mechanism of induction from that of 1-NP. These results indicate that 1-NP was able to stabilize mRNA with structural uniqueness and gene specificity. The best characterized stability/instability elements are the AU-rich elements (AREs) (UUAUUUA(U/A)(U/A)). AREs, ciselements located in the 3′ untranslated region (3′ UTR) of many mRNAs, are bound by several proteins to either extend or shorten the mRNA lifespan, often in response to extracellular signals (24, 25). However, there is no ARE present in the Cyp1a1 3′ UTR. Other than AREs, several studies have recently reported on the regulation of mRNA stability by extracellular signals, but the correlation between regulatory enzymes and the mRNA structure is still unknown. For example, insulin increases the CYP19 half-life in FSH-induced granulose cells (26), and human T-lymphotropic virus type 1 Tax increases p21 mRNA stabilization (27). The ERK inhibitor attenuates TGF-β-induced FAK mRNA stability (28), and glucocorticoids deplete the pool of transcribed PPG mRNA (29). In summary, this is the first article that elucidates a mechanism for inducing the expression of the AhR-targeting gene, Cyp1a1, through stabilizing Cyp1a1 mRNA, which was mediated by Akt kinase. Cyp1a1 is labile; therefore, it is an appropriate target for studying mRNA stabilization. 1-NP was a novel AhR ligand, and it was able to stabilize Cyp1a1 mRNA via the Akt pathway. Our results provide a new direction and a new model to analyze 1-NP’s action, mRNA stabilization, and regulation of AhR-targeting genes. Acknowledgment. We thank Dr. Alvaro Puga (University of Cincinnati Medical Center, Cincinnati, OH) for the generous gift of the pAhRDtkLuc3 and p-1646P1Luc3 plasmids. Viruses carrying shRNA-GFP and -Akt were obtained from the National RNAi Core Facility located at the Institute of Molecular Biology/ Genomic Research Center, Academia Sinica, supported by the National Research Program for Genomic Medicine Grants of the National Science Council (NSC97-3112-B-001-016).

References (1) Kawajiri, K., and Fujii-Kuriyama, Y. (2007) Cytochrome P450 gene regulation and physiological functions mediated by the aryl hydrocarbon receptor. Arch. Biochem. Biophys. 464, 207–212. (2) Shimada, T. (2006) Xenobiotic-metabolizing enzymes involved in activation and detoxification of carcinogenic polycyclic aromatic hydrocarbons. Drug Metab. Pharmacokinet. 21, 257–276. (3) Nakata, K., Tanaka, Y., Nakano, T., Adachi, T., Tanaka, H., Kaminuma, T., and Ishikawa, T. (2006) Nuclear receptor-mediated transcriptional regulation in Phase I, II, and III xenobiotic metabolizing systems. Drug Metab. Pharmacokinet. 21, 437–457. (4) Solhaug, A., Refsnes, M., Lag, M., Schwarze, P. E., Husoy, T., and Holme, J. A. (2004) Polycyclic aromatic hydrocarbons induce both apoptotic and anti-apoptotic signals in Hepa1c1c7 cells. Carcinogenesis 25, 809–819. (5) Chung, J. Y., Kim, J. Y., Kim, W. R., Lee, S. G., Kim, Y. J., Park, J. E., Hong, Y. P., Chun, Y. J., Park, Y. C., Oh, S., Yoo, K. S., Yoo, Y. H., and Kim, J. M. (2007) Abundance of aryl hydrocarbon receptor potentiates benzo[a]pyrene-induced apoptosis in Hepa1c1c7 cells via CYP1A1 activation. Toxicology 235, 62–72. (6) Lekas, P., Tin, K. L., Lee, C., and Prokipcak, R. D. (2000) The human cytochrome P450 1A1 mRNA is rapidly degraded in HepG2 cells. Arch. Biochem. Biophys. 384, 311–318. (7) Whitlock, J. P., Jr. (1999) Induction of cytochrome P4501A1. Annu. ReV. Pharmacol. Toxicol. 39, 103–125. (8) Hanlon, P. R., Zheng, W., Ko, A. Y., and Jefcoate, C. R. (2005) Identification of novel TCDD-regulated genes by microarray analysis. Toxicol. Appl. Pharmacol. 202, 215–228. (9) NIST (2000) Certificate of Analysis, Standard Reference Material 2975, Diesel Particulate Matter (Industrial Forklift), pp 1-8, National Institute of Standards and Technology (NIST), Gaithersburg, MD.

1-Nitropyrene Stabilizes Cytochrome P450 1a1 mRNA (10) NIST (2008) Certificate of Analysis, Standard Reference Material 1975, Diesel Particulate Extract, pp 1-9, National Institute of Standards and Technology (NIST), Gaithersburg, MD. (11) Schuetzle, D., Lee, F. S., and Prater, T. J. (1981) The identification of polynuclear aromatic hydrocarbon (PAH) derivatives in mutagenic fractions of diesel particulate extracts. Int. J. EnViron. Anal. Chem. 9, 93–144. (12) Su, J. G., Liao, P. J., Huang, M. C., Chu, W. C., Lin, S. C., and Chang, Y. J. (2008) Aldo-keto reductase 1C2 is essential for 1-nitropyrene’s but not for benzo[a]pyrene’s induction of p53 phosphorylation and apoptosis. Toxicology 244, 257–270. (13) Landvik, N. E., Gorria, M., Arlt, V. M., Asare, N., Solhaug, A., Lagadic-Gossmann, D., and Holme, J. A. (2007) Effects of nitratedpolycyclic aromatic hydrocarbons and diesel exhaust particle extracts on cell signalling related to apoptosis: possible implications for their mutagenic and carcinogenic effects. Toxicology 231, 159–174. (14) Burczynski, M. E., and Penning, T. M. (2000) Genotoxic polycyclic aromatic hydrocarbon ortho-quinones generated by aldo-keto reductases induce CYP1A1 via nuclear translocation of the aryl hydrocarbon receptor. Cancer Res. 60, 908–915. (15) Chang, C. Y., and Puga, A. (1998) Constitutive activation of the aromatic hydrocarbon receptor. Mol. Cell. Biol. 18, 525–535. (16) Wang, S. H., Liang, C. T., Liu, Y. W., Huang, M. C., Huang, S. C., Hong, W. F., and Su, J. G. (2009) Crosstalk between activated forms of the aryl hydrocarbon receptor and glucocorticoid receptor. Toxicology 262, 87–97. (17) Revel, A., Raanani, H., Younglai, E., Xu, J., Rogers, I., Han, R., Savouret, J. F., and Casper, R. F. (2003) Resveratrol, a natural aryl hydrocarbon receptor antagonist, protects lung from DNA damage and apoptosis caused by benzo[a]pyrene. J. Appl. Toxicol. 23, 255–261. (18) Casper, R. F., Quesne, M., Rogers, I. M., Shirota, T., Jolivet, A., Milgrom, E., and Savouret, J. F. (1999) Resveratrol has antagonist activity on the aryl hydrocarbon receptor: implications for prevention of dioxin toxicity. Mol. Pharmacol. 56, 784–790. (19) Ciolino, H. P., Daschner, P. J., and Yeh, G. C. (1998) Resveratrol inhibits transcription of CYP1A1 in vitro by preventing activation of the aryl hydrocarbon receptor. Cancer Res. 58, 5707–5712.

Chem. Res. Toxicol., Vol. 22, No. 12, 2009 1947 (20) Mollerup, S., Ovrebo, S., and Haugen, A. (2001) Lung carcinogenesis: resveratrol modulates the expression of genes involved in the metabolism of PAH in human bronchial epithelial cells. Int. J. Cancer 92, 18–25. (21) Cherng, S. H., Hsu, S. L., Yang, J. L., Yu, C. T., and Lee, H. (2006) Suppressive effect of 1-nitropyrene on benzo[a]pyrene-induced CYP1A1 protein expression in HepG2 cells. Toxicol. Lett. 161, 236–243. (22) Xu, C., Li, C. Y., and Kong, A. N. (2005) Induction of phase I, II and III drug metabolism/transport by xenobiotics. Arch. Pharm. Res. 28, 249–268. (23) Mayo, L. D., and Donner, D. B. (2002) The PTEN, Mdm2, p53 tumor suppressor-oncoprotein network. Trends Biochem. Sci. 27, 462–467. (24) Chen, C. Y., and Shyu, A. B. (1995) AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem. Sci. 20, 465– 470. (25) Nguyen Chi, M., Chalmel, F., Agius, E., Vanzo, N., Khabar, K. S., Jegou, B., and Morello, D. (2009) Temporally regulated traffic of HuR and its associated ARE-containing mRNAs from the chromatoid body to polysomes during mouse spermatogenesis. PLoS ONE 4, e4900. (26) Sahmi, M., Nicola, E. S., and Price, C. A. (2006) Hormonal regulation of cytochrome P450 aromatase mRNA stability in non-luteinizing bovine granulosa cells in vitro. J. Endocrinol. 190, 107–115. (27) Zhang, L., Zhi, H., Liu, M., Kuo, Y. L., and Giam, C. Z. (2009) Induction of p21(CIP1/WAF1) expression by human T-lymphotropic virus type 1 Tax requires transcriptional activation and mRNA stabilization. RetroVirology 6, 35. (28) Suer, S., Ampasala, D., Walsh, M. F., and Basson, M. D. (2009) Role of ERK/mTOR signaling in TGFbeta-modulated focal adhesion kinase mRNA stability and protein synthesis in cultured rat IEC-6 intestinal epithelial cells. Cell Tissue Res. 336, 213–223. (29) Zhang, R., Packard, B. A., Tauchi, M., D’Alessio, D. A., and Herman, J. P. (2009) Glucocorticoid regulation of preproglucagon transcription and RNA stability during stress. Proc. Natl. Acad. Sci. U.S.A. 106, 5913–5918.

TX900241G