A Bioengineered Positive Control for Rapid Detection of the Ebola

Article pubs.acs.org/journal/abseba

A Bioengineered Positive Control for Rapid Detection of the Ebola Virus by Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Patricia Lam,† Ruth A. Keri,‡,§,⊥ and Nicole F. Steinmetz*,†,⊥,||,#,△ †

Department of Biomedical Engineering, ‡Department of Pharmacology, §Department of Genetics, ⊥Case Comprehensive Cancer Center, Division of General Medical Sciences-Oncology, ||Department of Radiology, #Department of Materials Science and Engineering, and △Department of Macromolecular Science and Engineering, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, Ohio 44106, United States S Supporting Information *

ABSTRACT: The Ebola virus (EBOV) causes a highly virulent and deadly disease. The 2014 Ebola outbreak in West Africa was the largest in history. The rapid spread highlighted the need for a quick and accurate diagnostic method that can be employed in resource-limited conditions. In this study, we developed a probe that can be used as an internal positive control, coupled with a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay to accurately detect EBOV. This RT-LAMP assay is a simple one-step reaction performed at a constant temperature, and the results can be visualized by a colorimetric change from violet to sky blue. Our assay enabled detection of 10 copies of synthetic EBOV RNA within 1 h. Compared to traditional RT-qPCR, RT-LAMP requires no sophisticated equipment, the results are easier to interpret, and they can be obtained in less time. These features make RT-LAMP an ideal method for detection of EBOV in lowresource settings. KEYWORDS: RT-LAMP, diagnostics, Ebola virus, virus detection, nanoparticle

■

INTRODUCTION The largest Ebola outbreak to date started in December 2013 in Guinea and quickly spread to the neighboring countries of Liberia and Sierra Leone. Over the next two years, the Ebola virus (EBOV) ravaged West Africa, with isolated cases also being reported in the United States, Italy, the United Kingdom, and Spain. In 2016, the World Health Organization (WHO) declared the end of the Ebola epidemic after approximately 28 600 reported cases and 11 300 deaths worldwide.1 EBOV is a member of the Filoviridae family of viruses that is characterized by a single-stranded RNA genome surrounded by glycoproteins that form filamentous virions.2,3 It was named after the Ebola River, located near the village where it was first identified in 1976.4 EBOV is mainly transmitted through the bodily fluids of infected organisms. After exposure to EBOV, the incubation period is between 2 and 21 days. Early symptoms of Ebola virus disease (EVD) include fever, muscle ache and fatigue, which are common symptoms of viral infections. However, the disease quickly progresses to more severe symptoms such as vomiting, and internal and external bleeding.5 The mortality rate lies between 25 and 90%, depending on the strain. The high death rate is due to low blood pressure from fluid loss. Since the outbreak, research has focused on developing novel therapeutics for EVD. Experimental agents include small molecule drugs, such as the antiviral favipiravir.6,7 Favipirarvir © 2017 American Chemical Society

functions against RNA viruses by inhibiting replication through targeting the viral RNA-dependent RNA polymerase. Another experimental therapy utilizes gene silencing through small interfering RNAs (siRNAs). TKM-Ebola,8 developed by Tekmira, is a mixture of siRNAs encapsulated in liposomes for delivery. These siRNAs inhibit the replication, transcription, and assembly of EBOV in the host. Lastly, Zmapp,9 a drug composed of three chimerized monoclonal antibodies, was developed that specifically binds to the EBOV glycoprotein. Although these drugs have been used under compassionate circumstances during the outbreak, and have undergone clinical trials, there is still no approved treatment for EVD. The lack of approved vaccines and treatment for EVD necessitates the need for quick and accurate diagnosis of EVD. Immunoassays, such as the ReEBOV Antigen Rapid Test kit developed by Corgenix,10 detects the presence of EBOVspecific antigens in blood/serum samples. Alternatively, reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) detects the presence of EBOV-specific nucleic acid sequences. RT-qPCR-based methods are preferred by the WHO for EVD diagnostics, because they are more sensitive than immunoassays. When the two assays were compared, RTReceived: December 9, 2016 Accepted: January 16, 2017 Published: January 16, 2017 452

DOI: 10.1021/acsbiomaterials.6b00769 ACS Biomater. Sci. Eng. 2017, 3, 452−459

Article

ACS Biomaterials Science & Engineering Table 1. Sequences for Primers Used in This Study primer name

sequence (5′ − 3′)

nucleotide positions

for RT-LAMP EBOV_LAMP_FOP-F3 EBOV_LAMP_BOP-B3 EBOV_LAMP-FIP EBOV_LAMP-BIP EBOV-L1-F EBOV-L1-R EBOV-L1-probe

GGGCCGATTCTTAACACAA CCTTGACTATCAAAATAATGTTTAGC CATCTCCAGCCTTATCAATGTTCTACAGAAATTCGTGCACTAAAGC AGCTATTTTCCATTCAAAAACACTGGATCACCATAGGGCGTAATGC for RT-qPCR: GGGCCGATTCTTAACACAAATG GCGTCATCTCCAGCCTTATC TGCACTAAAGCCTTCACAGGCTCA

12528−12546 12826−12851 12584−12604, 12636−12660 12772−12791, 12680−12705 12528−12549 12664−12645 12594−12617

regions in the target sequence, making this reaction highly specific. The addition of reverse transcriptase to the reaction allows LAMP to use RNA as a template (RT-LAMP). A byproduct of LAMP is the formation of pyrophosphate ions, which yield magnesium pyrophosphate.17 Detection of the amplification product in a LAMP reaction can be performed by visualization of magnesium pyrophosphate, which forms a white precipitate that can be detected with the naked eye, or by photometric measurement of turbidity. To enhance the readout, DNA-intercalating dyes such as SYBR-green or Picogreen can be added after the reaction is complete, and visualized under ultraviolet light. Colorimetric read-outs have also been developed; metal chelators, such as calcein18 or hydoxy napthol blue (HNB),19 for example, can be used, as well as pH-sensitive dyes.20 Therefore, LAMP does not require specialized equipment for successful read-out and completion of the assay. The implementation of LAMP also does not require specialized equipment; the reaction proceeds at a constant temperature so a heat block or water bath is sufficient. Additionally, compared to PCR, LAMP is less sensitive to inhibitors that are present in biological samples.21 Therefore, LAMP and RT-LAMP are ideal in the field or in resourcelimited environments for diagnostics. LAMP and RT-LAMP have already been used to detect a number of pathogens, ranging from plants viruses,22,23 fungi and yeast,24 and human pathogens.25−27 Here, we describe the adaptation of our previous EBOV-TMV probe for use as a positive control in RTLAMP diagnostics of Ebola.

qPCR was able to detect the presence of EBOV up to 24−48 h prior to antigen detection.11 As with any diagnostic assay, an internal standard is needed to confirm positive results and negate false-negatives. Traditional positive controls are comprised of synthetic RNAs that are unstable and prone to degradation. Due to their inherent instability, these “naked” RNAs can not be spiked into primary samples to ensure that all stages of sample processing were performed correctly; rather these positive controls are only used to ensure that the RT-qPCR assay is being performed correctly, and does not validate the tissue processing and RNA extraction elements of the test. To overcome this technological challenge, we recently developed a stable positive control that can be used as an internal standard in RT-qPCR-based EBOV diagnostic assays.12 Specifically, we took a bioinspired approach and synthesized an EBOV mimicry using the nucleoprotein components from the plant virus tobacco mosaic virus (TMV). The TMV and EBOV nucleoprotein components share similarities in that both form high aspect ratio filaments encapsulating a single-stranded RNA genome. Making use of the self-assembly properties of TMV, we produced an EBOV mimicry containing a scrambled Ebola RNA (rendering the probe safe, nontranslatable, and nonreplicating) encapsulated inside of TMV. The stability and long shelf life of TMV, could allow the EBOV-TMV probe to be spiked into patient samples and function as an internal control, or be processed separately in parallel to ensure all steps are performed correctly. Compared to the Armored RNA technology (Asuragen)13 that encapsulates control RNA with MS2 bacteriophage coat proteins and the FilmArray assay (BioFire Defense)14 that encapsulates RNA inside the yeast Schizosaccharomyces pombe, our developed EBOV-TMV mimics the nucleoprotein structure of EBOV more closely, as the structure of TMV is more similar than that of the icosahedral bacteriophage or yeast. This structural resemblance allows for greater assurance that lysis of EBOV occurs during the RNA extraction step. The use of RT-qPCR requires specialized equipment, skilled personnel and access to laboratory facilities, all of which were apparent short-comings in West Africa during the previous Ebola outbreak. Though mobile laboratories were stationed throughout West Africa in response to the epidemic,15 there were still issues with power failures and maintaining the cold chain for samples and reagents. In a resource-limited environment, there was an evident need to develop a rapid and low-tech method for diagnostics. Loop-mediated isothermal amplification (LAMP) is a simple, and sensitive method for visual detection of amplification products under isothermal conditions.16 In a LAMP reaction, stem-loop products are produced using strand-displacement polymerase and a set of four primers that bind to six distinct

■

MATERIALS AND METHODS

Plant Growth and TMV Propagation. Nicotiana benthamiana plants were grown in an environmental chamber with 300 μmol m−2 s−1 photosynthetically active light with 12 h day/night cycles and 60% relative humidity. Infection of plants with TMV was induced through mechanical inoculation using 100 ng μL−1 purified TMV in 0.1 M potassium phosphate buffer, pH 7.0. Infected plants were propagated for 2−3 weeks and TMV was purified according to Bruckman et al.28 Design of RT-LAMP Primers. RT-LAMP primers were designed so that they overlap with the existing Ebola sequences in the previously designed pIDTblue/EBOV-TMVshort.12 The online LAMP primer design server Primer−Explorer (http://primerexplorer.jp/elamp4.0.0/ index.html) was used to generate a set of four primers: two outer primers (F3 and B3) and two inner primers (FIP and BIP) that target 6 distinct regions of the Ebola RNA-dependent RNA polymerase (Lgene). Primers were synthesized by Integrated DNA Technology (IDT). Primer sequences are shown in Table 1 Cloning of pIDTblue/EBOV-LAMP-TMVshort. A 343 bp gene fragment containing the RT-LAMP primer binding sites and scrambled sequences between the primer binding sites (EBOVLAMP) was synthesized (GeneArt, Thermo Fisher) with 5′ SalI and EagI restriction enzyme sites and 3′ HindIII restriction enzyme sites. This gene fragment was cloned into pIDTblue/TMVshort via EagI 453


Article

ACS Biomaterials Science & Engineering

Figure 1. Partial nucleotide sequence of the pIDTblue/EBOV-LAMP-TMVshort plasmid that was used to synthesize the RNA template for TMV self-assembly. The six primer binding sites for RT-LAMP are shown by blue arrows, designated LAMP F3 (FOP), LAMP F2, LAMP F1C, LAMP B1C, LAMP B2, and LAMP B3 (BOP). The LAMP forward inner primer (FIP) is a combination of LAMP F2 and F1C, whereas the LAMP backward (reverse) inner primer (BIP) comprises LAMP B1C and B2. The primers for RT-qPCR, designated in orange, are also indicated. The start of the TMV RNA sequence is indicated by the gray bar. The fragment containing the Ebola sequence was cloned into pIDTblue/TMVshort using the restriction enzyme sites EagI and HindIII.

Figure 2. Characterization of EBOV-LAMP-TMVshort particle. (A) Scheme of assembly; TMV coat proteins are shown in blue, native RNA is shown in red, and EBOV-LAMP RNA template is shown in green. (B) TEM of freshly made EBOV-LAMP-TMVshort particles. (C) TEM of EBOV-LAMP-TMVshort particles 1 month at room temperature after synthesis. Scale bar = 100 nm. It should be noted that in both images, disk structures are visible in addition to assembled EBOV-LAMP-TMVshort; the disk structures can be removed to further purify the EBOV-LAMPTMVshort particles through ultracentrifugation over density gradients (not shown). (D) Leaf from an uninfected tobacco plant, shown as a control for a healthy plant. (E) Leaf from a plant infected with TMV WT showing the characteristic disease symptoms, including yellowing of the leaf and a mosaic pattern. (F) Leaf from a plant infected with EBOV-LAMP-TMVshort, showing no symptoms of disease. and HindIII to generate pIDTblue/EBOV-LAMP-TMVshort. Detailed cloning of pIDTblue/TMVshort was previously described in Lam et al.12 Sanger sequencing was used to confirm the fidelity of the sequences. Template RNA Synthesis for TMV Reassembly. The plasmid pIDTblue/EBOV-LAMP-TMVshort was linearized using BamHI and purified by precipitation with 3 M sodium acetate followed by Proteinase K treatment and phenol:chloroform extraction. Linearized plasmid was quantified on a Nanodrop2000 (Thermo Fisher). One microgram of linearized plasmid was used for in vitro transcription using the MEGAscript T7 Transcription Kit (Ambion) as per manufacturer’s protocol. Following in vitro transcription, the RNA was purified by the MEGAclear Transcription Clean-Up Kit (Ambion) and stored at −80 °C until required. Coat Protein Preparation. Ten milligrams of purified TMV was treated with 2 volumes of glacial acetic acid for 20 min on ice. The sample was then centrifuged at 20 000g at 4 °C for 20 min. The

supernatant was removed and transferred to 6−8 MWCO dialysis tubing (Spectra/Por) and dialyzed against ddH2O for 48 h at 4 °C with one water change after 24 h. Following dialysis, the coat proteins (CPs) were centrifuged at 20,000g at 4 °C for 20 min. The CPs were then resuspended in 75 mM sodium phosphate buffer (pH 7.2) overnight with gentle shaking. Absorbance at A250, A260 and A280 was measured on a Nanodrop2000 (Thermo Fisher) to determine the integrity of the CPs. The concentration of the TMV CP was determined at A260 and ε = 1.3 μL μg−1 cm−1. Self-Assembly of TMV Nanoparticles. Coat protein preparations and synthesized RNA transcripts were combined at a final concentration of 1.3 μg μL−1 and 50 ng μL−1, respectively, in 75 mM sodium phosphate buffer (pH 7.2). The assembly reaction was incubated at 30 °C for 16−20 h. Assembled EBOV-LAMP-TMVshort particles were then stored at 4 °C until further processing. Electron Microscopy. EBOV-LAMP-TMVshort particles were diluted to 0.1 mg mL−1 in water and then adsorbed to Formvar454


Article

ACS Biomaterials Science & Engineering carbon-coated 400 mesh copper grids (Electron Microscopy Sciences) for 5 min, then washed with 20 μL ddH2O. Grids were then placed on a 20 μL drop of 2% (w/v) uranyl acetate for 5 min. Excess uranyl acetate was removed by blotting on filter paper before being imaged on a Zeiss Libra 200 transmission electron microscope at 200 kV. Size Exclusion Chromatography (SEC). EBOV-LAMPTMVshort particles were analyzed by SEC using a Superose6 column on an Ä KTA Explorer chromatography system (GE Healthcare). Samples (150 μL, 1 mg mL−1) were analyzed at a flow rate of 0.5 mL min−1 in 0.01 M potassium phosphate buffer, pH 7.0. RNA Extraction and Quantitative Reverse Transcription PCR. RNA was extracted from EBOV-LAMP-TMVshort nanoparticles using TRI-Reagent (Sigma-Aldrich) as per manufacturer’s protocol. For onestep RT-qPCR, the SuperScript III Platinum One-Step Quantitative RT-PCR System with ROX (Thermo Fisher) was used. Synthetic RNAs for limit of detection assays were generated by in vitro RNA transcription of the pIDTblue/EBOV-LAMP-TMVshort plasmid using the T7Megascript kit (Ambion) and purified using the MegaClear kit (Ambion). Synthetic RNA was quantified using a Nanodrop2000 (Thermo Fisher). Copy numbers per μL were calculated based on concentration and molecular weight of the synthetic RNA. Two microliters of RNA were used in a reaction containing a final concentration of 1× Reaction Mix with ROX, 300 nM of forward primer, 300 nM of reverse primer, 100 nM of probe, and 0.4 μL of SuperScript III RT/Platinum Taq Mix. Reaction conditions were as follows: 50 °C for 15 min (for cDNA synthesis), 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 30 s. RT-qPCR was performed on a StepOnePlus Real Time PCR system (Thermo Fisher). All samples were run in quadruplicate. Quantification cycle (Cq) values were calculated for each reaction and data were analyzed with the StepOne Plus software. RT-LAMP Assay Optimization. T7-transcribed RNA was used as the template for TMV self-assembly for all optimization reactions. The RT-LAMP reaction initially contained 1× ThermoPol reaction buffer (New England Biolabs), 1.2 μM each of FIP and BIP primers, 0.4 μM each of F3 and B3 primers, 6.4U Bst2.0 WarmStart polymerase (New England Biolabs), 6U WarmStart RTx reverse transcriptase (New England Biolabs), 1.4 mM dNTPs (Genscript), 120 μM hydroxynapthol blue (HNB) (Sigma-Aldrich), 8 mM MgSO4, 1 M betaine (Sigma-Aldrich), and 1 μL of RNA. The reaction was incubated at 65 °C for 1 h in a thermocycler. For reaction optimization, the final MgSO4 content was tested from 4 to 10 mM, and final dNTP concentration from 0.6 to 1.4 mM. Temperatures of 58, 60, 62, 65, 68, and 70 °C were tested to determine the range of temperatures that are viable as well as the optimal reaction temperature. Quantitative Evaluation of RT-LAMP Reaction Color Change. RT-LAMP reactions were photographed on a Canon Powershot SD1400 digital camera in a light box before and after incubation. ImageJ29 was used to determine the degree of color change by measuring the red, green, and blue (RGB) values of the reaction using the “RGB measure” plugin.

Figure 3. Optimization of MgSO4 concentration for RT-LAMP assay. (A) Visual examination of the RT-LAMP reaction shows a discernible color change within the 6−7 mM MgSO4 range. (B) Quantification of the color change plotted as difference in RBG value (as determined using ImageJ software) vs MgSO4 concentration ranging from 4 to 10 mM. Quantitative data indicate that 7 mM of MgSO4 generated the largest shift in color values. Error bars represent standard deviation; n = 3. Statistically significant differences (one-way ANOVA and Tukey’s HSD, p < 0.05) in the red values are indicated by different lettering, with A being statistical significant from B, but A or B are indifferent from AB. There were no statistically significant differences in changes in green and blue values.

■

RESULTS AND DISCUSSION Synthesis and Characterization of the EBOV-LAMPTMVshort Particle. EBOV-LAMP-TMVshort particles were synthesized through self-assembly of template RNA and TMV coat proteins. The template RNA was designed to contain the binding sites for the RT-LAMP reaction and RT-qPCR, along with the TMV origin of assembly (OAS), enabling RNAtemplated assembly of the EBOV-LAMP-TMVshort particles (Figure 1). The length of the RNA template specifies the length of the resulting TMV rod. Although native TMV measures 300 × 18 nm and contains 6395 nucleotides (nt), the EBOVLAMP-TMVshort contains 1509 nt of RNA, therefore resulting in particles with dimensions of 60 × 18 nm (Figure 2A). Post self-assembly of EBOV-LAMP-TMVshort, transmission electron microscopy (TEM) was used to visualize the particles and confirm their structural integrity (Figure 2B). As expected,

Figure 4. Optimization of dNTPs for RT-LAMP assay. (A) dNTPs concentrations ranging from 0.6 to 1.4 mM were tested with the 1.0− 1.4 mM range showing a visibly detectable change. (B) Quantification of the color change plotted as difference in RBG value (as determined using ImageJ software) vs dNTP concentration ranging from 0.6 to 1.4 mM. Quantitative data indicate that 1.4 mM of dNTPs generated the largest shift in color values. Error bars represent standard deviation; n = 3. Statistically significant differences (one-way ANOVA and Tukey’s HSD, p < 0.05) in the red values are indicated by different lettering, with A being statistical significant from B, C being different from D and E and DE, but DE being insignificant from D or E, etc. 455


Article


(Figure 2E), whereas the plants infected with the EBOVLAMP-TMVshort particle were still healthy with no apparent mottling or mosaic symptoms (Figure 2F). The lack of disease symptoms from infection with EBOV-LAMP-TMVshort is due to the lack of replication machinery within the particle per design. The RNA encoding the TMV nucleoprotein, viral proteins and the RNA-dependent RNA polymerase are not present; only the OAS to promote self-assembly is included in the particle. Together, these results demonstrate that the EBOV-LAMP-TMVshort particle is stable, but nonhazardous, and it does not require special handling. Optimization of RT-LAMP Conditions. Hydroxy napthol blue (HNB) is a metal ion indicator, traditionally used in titrations, and has previously been applied to LAMP.19 The basis of the colorimetric change using HNB in LAMP from violet to sky blue is from the depletion of free magnesium ions as the reaction progresses. Therefore, the first condition optimized was the magnesium concentration required to yield the greatest color change from violet to sky blue. The levels of MgSO4 were tested ranged from 4 to 10 mM final MgSO4. Initial amounts of 4 and 5 mM MgSO4 were already a light blue shade, suggesting that those amounts of MgSO4 are inadequate for colorimetric detection (Figure 3A). Visual inspection of the reaction showed a clear color change with 6 and 7 mM MgSO4. To quantify the extent of the color change, we determined the red, green, and blue (RGB) content through measurement using ImageJ software and digital images. The color shift from violet to sky blue in the RT-LAMP reaction is characterized by a decrease in red with an increase in green and/or blue. The differences in the red, green, blue channels was most apparent with 7 mM of MgSO4 (Figure 3B), therefore, 7 mM MgSO4 was used for all subsequent reactions. Next, the optimal concentration of dNTPs was tested. Over the course of a reaction, dNTPs will chelate the magnesium ions, as well as be consumed for formation of the loop products. 0.6, 0.8, 1.0, 1.2, and 1.4 mM dNTPs were assayed. 1.0, 1.2, and 1.4 mM dNTPs were sufficient for the RT-LAMP reaction to induce a visually detectable color change (Figure 4A). 0.6 and 0.8 mM of dNTPs were insufficient for the reaction to either proceed or reach the threshold for a substantial color change. Although a weak color change is detectable by the naked eye, RGB quantification detected only a decrease in red, and no increase in green and blue is apparent at these levels. Quantification of the RGB color change indicates that 1.4 mM dNTPs yielded the greatest decrease in red and increase in green and blue (Figure 4B). As a result, 1.4 mM dNTPs was determined as the optimal dNTP concentration. Lastly, the optimal reaction temperatures, as well as the range of temperatures in which the reaction will proceed, were tested. In resource-limited settings where Ebola occurs, the assay should not be dependent on strict temperatures to proceed, but rather progress at a range of temperatures. 58, 60, 62, 65, 68, and 70 °C were evaluated, and after 1 h, color change was detected at 60, 62, 65, and 68 °C (Figure 5A). The most striking change was detected at both 62 and 65 °C. When the color change was quantitated, 65 °C showed the greatest decrease in red and increase in green and blue (Figure 5B). When comparing all the differences in RGB content, at 65 °C, there is a significant and the greatest difference, and at each subsequent temperature assayed, there is less of a difference in color change as the temperature moves farther from 65 °C.

Figure 5. Optimization of temperature for the RT-LAMP assay. (A) Temperature range of 58−70 °C was tested, and a color change was visible in the 60−68 °C temperature range with the change from violet to sky blue being more discernible at 62 and 65 °C. (B) Quantification of the color change plotted as difference in RBG value (as determined using ImageJ software) vs temperature in °C. Data indicate the most significant change at 65 °C. Error bars represent standard deviation; n = 4. Statistically significant differences (one-way ANOVA and Tukey’s HSD, p < 0.01) are indicated by different lettering with A being statistically significant from BC and C, but not significant different from AB, etc.

the EBOV-LAMP-TMVshort particles measured around 60 nm in length. An important feature for use of this probe in lowresource conditions is for the particle to be stable for extended periods without special handling and/or storage. To assess the stability of the EBOV-LAMP-TMVshort, particles were kept at room temperature for one month and then analyzed by UV−vis and size exclusion chromatography, and reimaged using TEM. After one month of storage, there was no evidence of particle degradation (Figures 2C, Figure S1), demonstrating the stability of the probe. We expect the shelf life of the probe to be significantly longer than months, but several years. In fact, it has been shown that TMV nucleoprotein complexes are extremely stable and preparations of TMV have been reported to be stable for at least 50 years in nonsterile extracts stored at room temperature.30 Furthermore, studies on the thermostability of TMV indicate that purified virus is stable at temperatures of up to 75 °C,31 well above temperatures that the particle would be exposed to in West Africa. While we have not performed detailed thermostability studies on the proposed EBOV-LAMP-TMVshort control, based on the inherent stability of the TMV nucleoprotein complex, we hypothesize that also the shorter EBOV-LAMP-TMVshort assembly will have matched or comparable thermostability profiles. Next, to confirm the safety of the probe, Nicotiana benthamiana (tobacco) plants were treated with the EBOVLAMP-TMVshort particle to demonstrate that the particle is noninfectious toward its host species and therefore does not pose an agricultural risk. Plants were mechanically infected with EBOV-LAMP-TMVshort; wild-type TMV was used also used as a positive control. After 2 weeks, only the plants that were infected with wild-type TMV showed symptoms of infection 456


Article


Figure 6. Limit of detection of RT-Lamp vs RT-qPCR. (A, B) Limit of detection for RT-qPCR was 1 × 102 copies. (C) RT-LAMP showed a distinct color change for all concentrations tested and was able to detect as low as 1 × 101 copies. (D) Quantification of color change was assessed on the basis of changes in RGB values. Error bars represent standard deviation; n = 3. Statistically significant differences (one-way ANOVA and Tukey’s HSD, p < 0.05) are indicated by different lettering, with A being statistical significant from CD, BD, and D, but insignificant compared to AB and ABC, etc.

Taken together, these data suggest that the RT-LAMP assay functions best at temperatures in the range of 62−68 °C. Limit of Detection with RT-LAMP versus RT-qPCR. RTqPCR is the standard assay for detection of EBOV and diagnosis of the disease. For the RT-LAMP method to be applicable to detection of EBOV, sensitivity must be matched to the high-tech RT-qPCR assay. To assess the sensitivity of the assay, we used 10-fold serial dilutions of EBOV-LAMPTMVshort RNA (1 × 109 to 1 × 101 copies) to determine the detection limit of both RT-qPCR and RT-LAMP. The limit of detection is defined as the minimum concentration where at least 95% of the replicates resulted in a positive amplification. First, in RT-qPCR, Ebola sequences could be detected from 1 × 109 (mean Cq = 8.98) to 1 × 102 copies (mean Cq = 34.12). No amplification was detected in all replicates of 101 copies or in the no template control (Figure 6A). When the log copy numbers were plotted against mean Cq, the efficiency was 83.9% and the correlation coefficient, R2, was 0.99 (Figure 6B). Second, in RT-LAMP reactions using the optimized reaction conditions (7 mM MgSO4 with 1.4 mM dNTPs) and the same serial dilutions of EBOV-LAMP-TMVshort RNA, there was a visible color change for all concentrations of RNA (Figure 6C). 1 × 109 copies showed a greater color change than 1 × 101 copies, and analysis of the RGB content indicated that there was a trending decrease in the differences in values as the

Figure 7. (A) RT-LAMP of human plasma spiked-in samples. The positive control (+) was 1 × 109 copies of EBOV-LAMP-TMVshort RNA template and the negative control (−) had no RNA added. (B) RT-qPCR of the same samples.

457



■

amount of RNA decreased (Figure 6D). RT-LAMP was able to detect at least 1 × 101 copies, which is more 10 times more sensitive than RT-qPCR. Validation of EBOV-LAMP-TMVshort Probe. The EBOV-LAMP-TMVshort probe was spiked into 1 mL of human blood plasma to simulate laboratory samples that would be tested. Samples were spiked with 10-fold serial dilutions of 1 × 108 to 1 × 103 EBOV-LAMP-TMV particles (1 × 108 particles is equivalent to 1.3 ng of particles). 1 × 108 was chosen as the initial benchmark since 1 × 108 RNA copies/mL blood serum is the viral load threshold in patients with fatal outcomes.11 RNA was extracted from the spiked-in plasma samples and RT-LAMP and RT-qPCR assays were performed. Using RT-LAMP, a positive reaction resulted from RNA extracted from plasma spiked with 1 × 108 down to 103 particles (Figure 7A). There was little color change detected in the negative control. However, plasma spiked with 1 × 108 to 1 × 105 copies of particles showed positive results with RTqPCR. 1 × 104 and 1 × 103 copies could not be reliably detected by RT-qPCR. (Figure 7B). This demonstrates that our designed particle can function as a positive control or an internal control for Ebola diagnostics using both RT-LAMP and RT-qPCR.

Article

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsbiomaterials.6b00769. Figure S1, stability of EBOV-LAMP-TMVshort over time (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. ORCID

Patricia Lam: 0000-0002-7673-0371 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was funded a National Science Foundation grant (RAPID Grant 1509232) to N.F.S. and R.A.K. We thank the Swagelok Center for Surface Analysis of Materials (SCSAM) for assistance with microscopy and the Case Farm for providing plants for scale-up nanomanufacturing of nanoparticles.

■

■

CONCLUSIONS The recent Ebola epidemic illustrated the need for inexpensive tools enabling rapid and accurate diagnosis of the disease. With no cure available, detection and monitoring is the first step to prevent spreading of the disease. The RT-LAMP assay has many advantages over the traditional RT-qPCR assay for Ebola diagnostics: RT-LAMP is relatively quick to perform, with results available in 45−60 min versus RT-qPCR which can take up to 2 h. The results are easy to interpret, because it is a visual colorimetric read-out. For quantification, it may be possible to link a color-analyzer to the assay, e.g., a smart phone app. RTLAMP does not rely on expensive equipment or access to a high-tech laboratory. The assay can be performed in a single tube with an incubation temperature range from 62 to 68 °C, whereas RT-qPCR requires precise temperature cycling. In this study, we developed an RT-LAMP assay for the detection of Ebola. We defined the optimal reaction conditions enabling detection of 101 copies of Ebola per sample. We demonstrated the stability of the EBOV-LAMP-TMVshort probe and its application as a positive control for diagnostics using RTLAMP. Data indicate that the synthesized particle is stable for over a month when stored in aqueous buffer and at room temperature and, based on the established thermostability of TMV,30,31 the engineered control samples are expected withstand the temperature conditions in West Africa. Nevertheless, if deemed necessary, the TMV-based EBOV control could be protected by storing and shipping the samples in a simple polystyrene cooler. It should be noted that the probe was bioengineered to be noninfectious and nonhazardous to plants and mammals; EBOV-LAMP-TMVshort does not encode for EBOV or TMV proteins. This study lays a foundation for application of RT-LAMP for in-field evaluation and Ebola diagnostics in low-resource settings such as those found in West Africa, the epicenter of the last Ebola outbreak. The developed assay and most importantly, the developed internal standard EBOV-LAMP-TMVshort, may be used in future outbreaks.

REFERENCES

(1) WHO.Ebola virus disease outbreak; http://who.int/csr/disease/ ebola/en/ (accessed Jun 9, 2016). (2) Kiley, M. P.; Bowen, E. T.; Eddy, G. A.; Isaäcson, M.; Johnson, K. M.; McCormick, J. B.; Murphy, F. A.; Pattyn, S. R.; Peters, D.; Prozesky, O. W.; et al. Filoviridae: a taxonomic home for Marburg and Ebola viruses? Intervirology 1982, 18 (1−2), 24−32. (3) Feldmann, H.; Nichol, S. T.; Klenk, H.-D.; Peters, C. J.; Sanchez, A. Characterization of filoviruses based on dfferences in structure and antigenicity of the virion glycoprotein. Virology 1994, 199 (2), 469− 473. (4) Simpson, D. I. Viral haemorrhagic fevers of man. Bull. World Health Organ. 1978, 56 (6), 819−832. (5) Feldmann, H.; Jones, S.; Klenk, H.-D.; Schnittler, H.-J. Ebola virus: from discovery to vaccine. Nat. Rev. Immunol. 2003, 3 (8), 677− 685. (6) Sissoko, D.; Laouenan, C.; Folkesson, E.; M’Lebing, A.-B.; Beavogui, A.-H.; Baize, S.; Camara, A.-M.; Maes, P.; Shepherd, S.; Danel, C.; et al. Experimental treatment with Favipiravir for Ebola virus disease (the JIKI Trial): a historically controlled, single-arm proof-of-concept trial in guinea. PLOS Med. 2016, 13 (3), e1001967. (7) Picazo, E.; Giordanetto, F. Small molecule inhibitors of Ebola virus infection. Drug Discovery Today 2015, 20 (2), 277−286. (8) Thi, E. P.; Mire, C. E.; Lee, A. C. H.; Geisbert, J. B.; Zhou, J. Z.; Agans, K. N.; Snead, N. M.; Deer, D. J.; Barnard, T. R.; Fenton, K. A.; et al. Lipid nanoparticle siRNA treatment of Ebola-virus-Makonainfected nonhuman primates. Nature 2015, 521 (7552), 362−365. (9) Qiu, X.; Wong, G.; Audet, J.; Bello, A.; Fernando, L.; Alimonti, J. B.; Fausther-Bovendo, H.; Wei, H.; Aviles, J.; Hiatt, E.; et al. Reversion of advanced Ebola virus disease in nonhuman primates with ZMapp. Nature 2014, 514 (7520), 47−53. (10) Broadhurst, M. J.; Kelly, J. D.; Miller, A.; Semper, A.; Bailey, D.; Groppelli, E.; Simpson, A.; Brooks, T.; Hula, S.; Nyoni, W.; et al. ReEBOV Antigen Rapid Test kit for point-of-care and laboratorybased testing for Ebola virus disease: a field validation study. Lancet 2015, 386 (9996), 867−874. (11) Towner, J. S.; Rollin, P. E.; Bausch, D. G.; Sanchez, A.; Crary, S. M.; Vincent, M.; Lee, W. F.; Spiropoulou, C. F.; Ksiazek, T. G.; Lukwiya, M.; et al. Rapid diagnosis of Ebola hemorrhagic fever by reverse transcription-PCR in an outbreak setting and assessment of patient viral load as a predictor of outcome. J. Virol. 2004, 78 (8), 4330−4341. 458


Article

ACS Biomaterials Science & Engineering (12) Lam, P.; Gulati, N. M.; Stewart, P. L.; Keri, R. A.; Steinmetz, N. F. Bioengineering of tobacco mosaic virus to create a non-infectious positive control for Ebola diagnostic assays. Sci. Rep. 2016, 6, 23803. (13) Pasloske, B. L.; Walkerpeach, C. R.; Obermoeller, R. D.; Winkler, M.; DuBois, D. B. Armored RNA technology for production of ribonuclease-resistant viral RNA controls and standards. J. Clin. Microbiol. 1998, 36 (12), 3590−3594. (14) Southern, T. R.; Racsa, L. D.; Albariño, C. G.; Fey, P. D.; Hinrichs, S. H.; Murphy, C. N.; Herrera, V. L.; Sambol, A. R.; Hill, C. E.; Ryan, E. L.; et al. Comparison of FilmArray® and qRT-PCR for the detection of Zaire ebolavirus from contrived and clinical specimens. J. Clin. Microbiol. 2015, 53 (9), 2956−2960. (15) Wölfel, R.; Stoecker, K.; Fleischmann, E.; Gramsamer, B.; Wagner, M.; Molkenthin, P.; Di Caro, A.; Günther, S.; Ibrahim, S.; Genzel, G.; et al. Mobile diagnostics in outbreak response, not only for Ebola: a blueprint for a modular and robust field laboratory. Euro Surveill. 2015, 20 (44), 30055. (16) Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28 (12), e63. (17) Mori, Y.; Nagamine, K.; Tomita, N.; Notomi, T. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophys. Res. Commun. 2001, 289 (1), 150−154. (18) Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 2008, 3 (5), 877−882. (19) Goto, M.; Honda, E.; Ogura, A.; Nomoto, A.; Hanaki, K.-I. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques 2009, 46 (3), 167−172. (20) Tanner, N. A.; Zhang, Y.; Evans, T. C. Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes. BioTechniques 2015, 58 (2), 59−68. (21) Kaneko, H.; Kawana, T.; Fukushima, E.; Suzutani, T. Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances. J. Biochem. Biophys. Methods 2007, 70 (3), 499− 501. (22) Jeong, J.; Cho, S.-Y.; Lee, W.-H.; Lee, K.-J.; Ju, H.-J. Development of a rapid detection method for potato virus X by reverse transcription loop-mediated isothermal a mplification. Plant Pathol. J. 2015, 31 (3), 219−225. (23) Liu, Y.; Wang, Z.; Qian, Y.; Mu, J.; Shen, L.; Wang, F.; Yang, J. Rapid detection of tobacco mosaic virus using the reverse transcription loop-mediated isothermal amplification method. Arch. Virol. 2010, 155, 1681−1685. (24) Niessen, L. Current state and future perspectives of loopmediated isothermal amplification (LAMP)-based diagnosis of filamentous fungi and yeasts. Appl. Microbiol. Biotechnol. 2015, 99 (2), 553−574. (25) Thai, H. T. C.; Le, M. Q.; Vuong, C. D.; Parida, M.; Minekawa, H.; Notomi, T.; Hasebe, F.; Morita, K. Development and evaluation of a novel loop-mediated isothermal amplification method for rapid detection of severe acute respiratory syndrome c oronavirus. J. Clin. Microbiol. 2004, 42 (5), 1956−1961. (26) Wang, X.; Li, X.; Hu, S.; Qu, H.; Zhang, Y.; Ni, H.; Wang, X. Rapid detection of active human cytomegalovirus infection in pregnancy using loop-mediated isothermal amplification. Mol. Med. Rep. 2015, 12 (2), 2269−2274. (27) Nunes, M. R. T.; Vianez, J. L.; Nunes, K. N. B.; da Silva, S. P.; Lima, C. P. S.; Guzman, H.; Martins, L. C.; Carvalho, V. L.; Tesh, R. B.; Vasconcelos, P. F. C. Analysis of a reverse transcription loopmediated isothermal amplification (RT-LAMP) for yellow fever diagnostic. J. Virol. Methods 2015, 226, 40−51. (28) Bruckman, M. A.; Steinmetz, N. F. Chemical modification of the inner and outer surfaces of Tobacco Mosaic Virus (TMV). Methods Mol. Biol. 2014, 1108, 173−185. (29) Abramoff, M. D.; Magalhaes, P. J.; Ram, S. J. Image processing with ImageJ. Biophotronics Int. 2004, 11 (7), 36−42.

(30) Silber, G.; Burk, L. G. Infectivity of tobacco mosaic virus stored for fifty years in extracted, “unpreserved” plant juice. Nature 1965, 206 (4985), 740−741. (31) Lauffer, M. A.; Price, W. C. Thermal denaturation of Tobacco mosaic virus. J. Biol. Chem. 1940, 133 (1), 1−15.

459


A Bioengineered Positive Control for Rapid Detection of the Ebola

Recommend Documents