A novel AS1411 aptamer-based three-way junction pocket DNA

Subscriber access provided by UNIV OF DURHAM

A novel AS1411 aptamer-based three-way junction pocket DNA nanostructure loaded with doxorubicin for targeting cancer cells in vitro and in vivo Seyed Mohammad Taghdisi, Noor Mohammad Danesh, Mohammad Ramezani, Rezvan Yazdian-Robati, and Khalil Abnous Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/acs.molpharmaceut.8b00124 • Publication Date (Web): 18 Apr 2018 Downloaded from http://pubs.acs.org on April 19, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

A novel AS1411 aptamer-based three-way junction pocket DNA nanostructure loaded with doxorubicin for targeting cancer cells in vitro and in vivo Seyed Mohammad Taghdisia,b, Noor Mohammad Daneshc, Mohammad Ramezanid, Rezvan Yazdian-Robatib, Khalil Abnousd,e,* a

Targeted Drug Delivery Research Center, Pharmaceutical Technology Institute, Mashhad

University of Medical Sciences, Mashhad, Iran. b

Department of Pharmaceutical Biotechnology, School of Pharmacy, Mashhad University of

Medical Sciences, Mashhad, Iran. c

Research Institute of Sciences and New Technology, Mashhad, Iran.

d

Pharmaceutical Research Center, Pharmaceutical Technology Institute, Mashhad University of

Medical Sciences, Mashhad, Iran. e

Department of Medicinal chemistry, School of Pharmacy, Mashhad University of Medical

Sciences, Mashhad, Iran

* Corresponding author: Dr. Khalil Abnous ([email protected]), Tel.: +98 513 1801535, Fax.: +98 513 882 3251

1 ACS Paragon Plus Environment

Molecular Pharmaceutics 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Active targeting of nanostructures containing chemotherapeutic agents can improve cancer treatment. Here, a three-way junction pocket DNA nanostructure was developed for efficient doxorubicin (Dox) delivery into cancer cells. Threeway junction pocket DNA nanostructure is composed of three strands of AS1411 aptamer as both therapeutic aptamer and nucleolin targeting, the potential biomarker of prostate (PC-3 cells) and breast (4T1 cells) cancers. The properties of the Dox-loaded three-way junction pocket DNA nanostructure was characterized and verified to have several advantages, including high serum stability and pH-responsive property. Cellular uptake studies showed that Doxloaded DNA nanostructure was preferably internalized into target cancer cells (PC3 and 4T1 cells). MTT cell viability assay demonstrated that the Dox-loaded DNA nanostructure had significantly higher cytotoxicity for PC-3 and 4T1 cells compared to nontarget cells (CHO cells, Chinese hamster ovary cell). The in vivo antitumor effect showed that the Dox-loaded DNA nanostructure was more effective in prohibition of the tumor growth compared to free Dox. These findings showed that Dox-loaded three-way junction pocket DNA nanostructure could significantly reduce the cytotoxic effects of Dox against nontarget cells.


Page 2 of 33

Page 3 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Keywords: Targeted delivery; Doxorubicin; Three-way junction pocket DNA nanostructure; Tumor growth; Internalization; Cytotoxicity



Page 4 of 33

1. Introduction Prostate and breast cancers are the most frequent male and female malignancies, respectively.1,

2

They are categorized among the main leading causes of cancer

death in women and men worldwide.3, 4 Chemotherapy is one of the most common types of cancer treatment. Its incapability to specifically target cancer tissues causes severe side effects of chemotherapy and limits its efficacy.5,

6

Targeted drug delivery systems using

nanoparticles and sensing agents can overcome this drawback.7, 8 Doxorubicin (Dox), an antineoplastic drug, has been broadly applied in clinical chemotherapy of different cancers, including breast and prostate cancers. However, its short half-life and cardiotoxicity have restricted application of Dox in the clinic.2, 9 Aptamers have emerged as attractive targeting agents in development of targeted drug delivery systems for diagnostic and therapeutic applications. They are singlestranded oligonucleotide segments that are isolated by SELEX (Systematic Evolution of Ligands by Exponential enrichment).10, 11 Aptamers can tightly bind to various targets, such as small molecules, peptides and even intact cells.12,

13

Aptamers have diverse advantages over antibodies, including facile chemical modification, cost-effective synthesis, thermal stability and lack of toxicity and


Page 5 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


immunogenicity.14-16 Also compared to antibodies, aptamers are physically smaller, leading to more and faster internalization of aptamers into cancer tissues.17, 18 AS1411 aptamer is a Guanosine-rich oligonucleotide which binds to nucleolin.19, 20 Nucleolin is a multifunctional protein which is abundant in the nucleus of normal cells. Also, this protein is overexpressed in the cell membrane of tumor cells, such as prostate, lung and breast cancers.17,

21

Nucleolin is implicated in transporting

molecules from the cell surface to nucleus, cell proliferation and DNA replication.22, 23 AS1411 aptamer has shown antiproliferative activity and cytotoxic effects against cancer cells, owing to methuosis, a novel type of non-apoptotic cell death.24, 25 In the present study, a three-way junction pocket DNA nanostructure was developed for targeted delivery of Dox to tumor cells in vitro and in vivo (Fig. 1). The three-way junction pocket DNA nanostructure was composed of three strands of AS1411 aptamer. Dox as an antineoplastic agent was loaded into DNA nanostructure. Compared to previously developed DNA nanostructure-based targeted delivery systems,14,

26, 27

this delivery system is very simple and its

preparation is fast. In vitro and in vivo studies were investigated in nucleolinoverexpressing PC-3 and 4T1 tumor cells and CHO cells were applied as nontarget cells.



2. Experimental 2.1.

Chemicals

All the PEGylated oligonucleotides for preparation of three-way junction pocket DNA nanostructure were supplied from Bioneer (South Korea) (Table 1). 10K centrifugal device was provided by PALL (USA). Doxorubicin was purchased from Sigma-Aldrich (USA). 2.2.

Cell culture

Human prostate cancer cell (PC-3, C427), mouse breast cancer cell (4T1, C604) and Chinese hamster ovary cell (CHO, C111) were obtained from Pasteur Institute of Iran. Cells were grown and cultured in RPMI 1640 (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Sigma-Aldrich). 2.3.

Preparation of the three-way junction pocket DNA nanostructure and control complex

The three-way junction pocket DNA nanostructure was prepared in two steps. Firstly, 100 µL Apt1 (100 µM) was incubated with 100 µL Apt2 (100 µM) for 1 h at room temperature. Secondly, 100 µL Apt3 (100 µM) was added to the above solution and incubated for 1 h at room temperature. For in vivo assay after the reaction, the resultant DNA nanostructure was centrifuged and concentrated using a 10K centrifugal device. The prepared DNA nanostructure was analyzed with 6 ACS Paragon Plus Environment

Page 6 of 33

Page 7 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


agarose gel electrophoresis (2.5%, running time 25 min) and dynamic light scattering (DLS) (Malvern, UK). The control complex was prepared like three-way junction pocket DNA nanostructure but sequence of AS1411 was replaced with a control sequence. 2.4.

Serum stability of the DNA nanostructure

The stability of three-way junction pocket DNA nanostructure in serum was investigated by agarose gel electrophoresis (2.5%). 15 µM DNA nanostructure (final concentration) was added to human serum for 6 h. Thereafter, phenolchloroform was utilized to extract DNA nanostructures, and then this DNA nanostructure was run on a 2.5% agarose gel electrophoresis for 50 min. 2.5.

Preparation of Dox-load DNA nanostructure

The Dox-load DNA nanostructure was prepared through incubation of different concentrations of DNA nanostructure (0-4 µM) with a fix concentration of Dox (5 µM) and fluorescence spectra of Dox were recorded (λEx= 480 nm) by a Synergy H4 microplate reader (BioTeK, USA). 2.6.

Dox release study

In vitro Dox release study was performed using centrifugal devices. Dox-loaded DNA nanostructure was added to citrate-phosphate buffer (pH 7.4 or 5.5). At each predetermined time interval, the Dox-loaded DNA nanostructure was separated 7 ACS Paragon Plus Environment


from the buffer using 10K centrifugal device. The fluorescence intensity of the solution at the bottom of centrifugal device was analyzed (λEx= 480 nm and λEm= 600 nm) to specify the concentration of dissociated Dox. 2.7.

Evaluation of cellular uptake

4T1, PC-3 and CHO cells were seeded into 12-well plates at a density of 2×105 cells/well. Afterwards, the cells were incubated with 5 µM Dox and Dox-loaded three-way junction pocket DNA nanostructure (5 µM Dox). After 3 h, the cells were washed and trypsinized for 7 min and suspended in phosphate buffer saline (PBS). Then, the mean fluorescence intensity of Dox in the cells was measured by flow cytometry (BD Accuri C6 flow cytometer, BD Biosciences, USA). The data were investigated by FlowJo 7.6.1 software. Also, fluorescence microscopy was applied to study the cancer cell uptake of Doxloaded DNA nanostructure. The PC-3 and CHO cells (1×105 cells) were incubated in RPMI medium in 6-well plates with collagen coated cover slips (0.1% collagen in acetic acid). After 20 h incubation, the culture medium was replaced with fresh RPMI. The cells were treated with Dox-loaded three-way junction pocket DNA nanostructure (5 µM Dox) for 3 h at 37°C, followed by washing the cells with PBS three times. Next, 4% paraformaldehyde was applied to fix the cells for 15 min. After that, cells were imaged using a fluorescence microscope (CETI, UK).


Page 8 of 33

Page 9 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.8.

In vitro cytotoxicity

Escalating-dose study of Dox indicated that IC50 of Dox for 4T1, CHO and PC-3 cells were 2.2, 3 and 1.8 µM, respectively. In vitro cytotoxicity was investigated by measuring the activity of mitochondrial dehydrogenase enzyme using MTT assay. CHO, PC-3 and 4T1 cells were seeded in 96-well plates (5 × 103 cells/well). After incubation for 20 h, the cells were incubated with Dox (based on the results of escalating-dose study), three-way junction pocket DNA nanostructure, Dox-loaded control complex and Dox-loaded three-way junction pocket DNA nanostructure (with the same concentration of Dox) for 3 h at 37°C. Thereafter, the culture medium was replaced with fresh RPMI and the cells were incubated for 72 h at 37°C. Then, 10 µL MTT solution (5 mg/mL) was added to each well for 4 h. After that, the solution was removed and subsequently 100 µL DMSO was added to each well. The plates were shaken for 5 min, followed by absorbance measurement (545 nm) with the microplate reader. 2.9.

Animal models

The animal experiment was performed in compliance with the guidelines of Institutional Ethics and Research Advisory committees of Mashhad University of Medical Sciences. BALB/c mice, 4-6 weeks old, were obtained from Pasteur Institute of Iran. For the tumor models, subcutaneous tumors were established by



injection of 3 × 105 4T1 cells into the right flanks of mice. The size of tumor was measured using calipers. When the tumor volume reached nearly 40 mm3, the mice were randomly divided into 3 groups: Dox (equal to 1.2 mg/kg Dox per mouse), Dox-loaded DNA nanostructure (equal to 1.2 mg/kg Dox per mouse), DNA nanostructure and PBS, all injected via the tail vein. The tumor growth was monitored for 20 days. 2.10. Statistics For all experiments, data were shown as mean ± SD, n=4 which indicated the number of repeats. Student’s t-test was used for analysis of data. P < 0.05 was considered statistically significant.


Page 10 of 33

Page 11 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3. Results 3.1.

DNA nanostructure characterization

Agarose gel electrophoresis was applied to verify the formation of DNA nanostructure. As shown in Fig. 2(a), when Apt2 was incubated with Apt1, the mobility of the band of Apt1 was retarded and only one band was appeared (lane 2), confirming the hybridization of them to each other. Also, a new band with slower mobility was appeared (lane 3) when Apt3 was added to the mixture of Apt1 and Apt2, indicating the successful formation of DNA nanostructure. Stability analysis exhibited that the band of DNA nanostructure was sharp after 6 h treatment with serum (Fig. 2 (b)), verifying the stability of the DNA nanostructure in serum. 10.3 ± 1.3 nm was the particle size for DNA nanostructure as obtained by DLS. 3.2.

Dox loading in the DNA nanostructure

The formation of Dox-loaded DNA nanostructure was investigated by fluorometric analysis. Fluorescence intensity of Dox is quenched following its intercalation with DNA.28,

29

Fig. 3 displays the quenching profile of Dox fluorescence spectra

following the addition of different concentrations of DNA nanostructure (0- 4 µM) to a fix concentration of Dox (5 µM). Results confirmed that the maximum



quenching of Dox happened at 1:2.5 mole ratio of DNA nanostructure to Dox and this ratio was used for the next experiments. 3.3.

pH-triggered Dox release from Dox-loaded DNA nanostructure

The in vitro release profile of Dox from Dox-loaded DNA nanostructure was evaluated at different pHs. In pH 7.4, the release of Dox was less than 32% after 72 h, while pH 5.5 (simulating the pH of lysosome and cancer cell environment) significantly increased Dox release over 70% (Fig. 4). 3.4.

Internalization assay

The fluorescence FL2 histograms of CHO, 4T1 and PC-3 cells after treatments with 5 µM Dox and Dox-loaded DNA nanostructure (5 µM Dox) have been shown in Fig. 5. FL2 log intensity for 4T1 cells after treatments with Dox and Dox-loaded DNA nanostructure were 999 ± 105 and 934 ± 79, respectively. FL2 log intensity for PC-3 cells after treatments with Dox and Dox-loaded DNA nanostructure were 1184 ± 96 and 1112 ± 121, respectively. FL2 log intensity for CHO cells after treatments with Dox and Dox-loaded DNA nanostructure were 739 ± 34 and 351 ± 42, respectively. The fluorescence microscopy images of PC-3 and CHO cells treated with Doxloaded DNA nanostructure have been shown in Fig. 6. As shown in Fig. 6, slight fluorescence was found in the CHO cells (nontarget) treated with Dox-loaded 12 ACS Paragon Plus Environment

Page 12 of 33

Page 13 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


DNA nanostructure, while PC-3 cells (target cells) treated with Dox-loaded DNA nanostructure exhibited strong fluorescence. 3.5.

In vitro antitumor effect

To assess the antitumor effect in vitro, the cytotoxicity of Dox-loaded DNA nanostructure was examined on CHO, 4T1 and PC-3 cells (Fig. 7). 4T1 cell viability after treatments with Dox, DNA nanostructure, Dox-loaded control complex and Dox-loaded DNA nanostructure were 47.4 ± 1.8%, 80.3 ± 1.6%, 82.9 ± 6% and 25.6 ± 2%, respectively. CHO cell viability after treatments with Dox, DNA nanostructure, Dox-loaded control complex and Dox-loaded DNA nanostructure were 51 ± 4.2%, 95.6 ± 7.9%, 84.8 ± 4.2% and 79.6 ± 3.8%, respectively. PC-3 cell viability after treatments with Dox, DNA nanostructure, Dox-loaded control complex and Dox-loaded DNA nanostructure were 46.8 ± 2.7%, 85.7 ± 9%, 80.1 ± 3.5% and 33.2 ± 1.5%, respectively. 3.6.

In vivo antitumor effect

The in vivo therapeutic efficacy of Dox-loaded DNA nanostructure in mice bearing subcutaneous 4T1 tumors was investigated. The tumor volumes for Dox, PBS, DNA nanostructure and Dox-loaded DNA nanostructure treatments were 845 ± 50 mm3, 1049 ± 120 mm3, 907 ± 103 mm3 and 424 ± 39 mm3, respectively (Fig. 8).



Page 14 of 33

4. Discussion Presence of AS1411 aptamer, as a therapeutic aptamer and targeting agent, in the building blocks of DNA nanostructure, appropriate Dox loading, excellent serum stability and simple and rapid preparation of the developed Dox-loaded three-way junction pocket DNA nanostructure are some of the advantages of the designed targeting platform. It has been proved that the modification of aptamers especially at their 3’-ends can increase stability of aptamers to endogenous serum nucleases.30 So, the 3’-end of all three strands of AS1411 aptamer were capped using PEG as a nontoxic and non-immunogenic polymer. Also, PEG could enhance the size of DNA nanostructure, leading to increase the half-life of DNA nanostructure by preventing exclusion from renal filtration. Moreover, the PEGylation could improve the function of the designed delivery system by decrease of its degradation by metabolic

enzymes,

escape

of

PEGylated

DNA

nanostructure

from

reticuloendothelial system and reduction of adsorption of other biomaterials on the surface of the DNA nanostructure.31-33 Dox is loaded in the DNA nanostructure via its intercalation with AS1411 aptamer and dsDNA areas in the DNA nanostructure. Interaction of Dox with DNA nanostructure was investigated by recording the quenching profile of Dox fluorescence following incubation with DNA nanostructure. In the presence of 2 14 ACS Paragon Plus Environment

Page 15 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


µM DNA nanostructure, fluorescence intensity of Dox (5 µM) was about 15% (Fig. 3), verifying the formation of Dox-loaded three-way junction pocket DNA nanostructure. The drug loading of the designed targeted delivery platform (1:2.5 mole ratio of DNA nanostructure to Dox) was much more than the payload that was already reported for anthracycline chemotherapy agents using aptamers and DNA nanostructures for delivery, like sgc8 aptamer-Daunorubicin delivery system (1.3:1 mole ratio of aptamer to daunorubicin),34 Polyvalent aptamer-Epirubicin delivery platform (1:2 mole ratio of polyvalent aptamer to epirubicin)27 and PSMA aptamer-Dox conjugate (1.2:1 mole ratio of aptamer to Dox).35 As shown in Fig. 4, when Dox-loaded DNA nanostructure was incubated in pH 5.5, a much faster and more Dox release was achieved through the protonation of the –NH2 group of Dox in acidic condition which reduced the interaction between Dox and DNA nanostructure. So, the presented targeted delivery system could release Dox under the mild acidic microenvironment of cancer cells as a pHresponsive targeting platform. In tumor cells, the release of Dox from the Doxloaded three-way junction pocket DNA nanostructure should be much more than this amount, due to the presence of nuclease enzymes in tumor cells which could facilitate the release of Dox from the DNA nanostructure by destruction of DNAbased vector.



Flow cytometry assay was used to monitor the internalization of Dox-loaded DNA nanostructure into target cells. As shown in Fig. 5, obvious fluorescence signals were observed for 4T1 and PC-3 cells (target cells) treated with Dox-loaded DNA nanostructure, whereas a low detectable fluorescence was found for CHO cells (nontarget) treated with Dox-loaded DNA nanostructure (p < 0.05), indicating that the designed targeted delivery system was efficiently internalized into the cells (4T1 and PC-3), which overexpressed nucleolin as the target of AS1411 aptamer, via ligand-receptor mechanism. Moreover, the Dox-loaded DNA nanostructure could be internalized into target cells as well as free Dox. The same conclusion was also obtained from fluorescence microscopy analysis (Fig. 6), in which bright green cells were detected in the Dox-loaded DNA nanostructure-treated PC-3 cells. Cytotoxicity was analyzed using cell viability test and cytotoxicity of Dox-loaded DNA nanostructure was compared with free Dox in different cell lines. As shown in Fig. 7, CHO cells treated with Dox-loaded DNA nanostructure displayed significantly higher cell viability compared to the CHO cells treated with free Dox (p < 0.05), indicating the reduced toxicity of Dox-loaded DNA nanostructure for cells which do not overexpress nucleolin. Also, PC-3 and 4T1 cells treated with Dox-loaded DNA nanostructure showed significantly lower cell viability in comparison with CHO cells treated Dox-loaded DNA nanostructure (p < 0.05), 16 ACS Paragon Plus Environment

Page 16 of 33

Page 17 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


verifying the importance of the internalization of Dox-loaded DNA nanostructure into cells via AS1411 aptamer-nucleolin mechanism. The antitumor efficacy of Dox-loaded DNA nanostructure was examined in 4T1 tumor-bearing mice. As indicated in Fig. 8, the tumor growth trend of Dox-loaded DNA nanostructure treatment was significantly slower than that of free Dox group, confirming the higher internalization of Dox-loaded DNA nanostructure into tumor cells compared to free Dox and the good function of the developed targeted delivery system.



5. Conclusion In summary, a novel Dox-loaded three-way junction pocket DNA nanostructure containing three strands of AS1411 aptamer was developed for treatment of 4T1 and PC-3 cells (target cells). The Dox-loaded DNA nanostructure inherited features of simplicity, cancer targeting, pH responsive platform and high serum stability. The presented Dox-loaded DNA nanostructure was efficiently internalized into target cells and reduced tumor cell viability, while it was not internalized into CHO cells (nontarget). Furthermore, the tumor growth was remarkably prohibited when the tumor-allograft mice were treated with Doxloaded DNA nanostructure. Conflict of interest There is no conflict of interest about this article. Acknowledgment Financial support of this study was provided by Mashhad University of Medical Sciences.


Page 18 of 33

Page 19 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


References 1. Yeh, C. Y.; Hsiao, J. K.; Wang, Y. P.; Lan, C. H.; Wu, H. C. Peptide-conjugated nanoparticles for targeted imaging and therapy of prostate cancer. Biomaterials 2016, 99, 1-15. 2. Niu, X.; Zhang, Z.; Zhong, Y. Hydrogel loaded with self-assembled dextran sulfatedoxorubicin complexes as a delivery system for chemotherapy. Mater. Sci. Eng., C 2017, 77, 888-894. 3. Lokerse, W. J. M.; Bolkestein, M.; Dalm, S. U.; Eggermont, A. M. M.; de Jong, M.; Grüll, H.; Koning, G. A. Comparing the therapeutic potential of thermosensitive liposomes and hyperthermia in two distinct subtypes of breast cancer. J. Controlled Release 2017, 258, 34-42. 4. Zhang, N.; Li, S.; Hua, H.; Liu, D.; Song, L.; Sun, P.; Huang, W.; Tang, Y.; Zhao, Y. Low density lipoprotein receptor targeted doxorubicin/DNA-Gold Nanorods as a chemo- and thermo-dual therapy for prostate cancer. Int. J. Pharm. 2016, 513, (1-2), 376-386. 5. Deshmukh, A.; Kumar, S.; Arfuso, F.; Newsholme, P.; Dharmarajan, A. Secreted Frizzled-related protein 4 (sFRP4) chemo-sensitizes cancer stem cells derived from human breast, prostate, and ovary tumor cell lines. Scientific Reports 2017, 7, (1). 6. Ramzy, L.; Nasr, M.; Metwally, A. A.; Awad, G. A. S. Cancer nanotheranostics: A review of the role of conjugated ligands for overexpressed receptors. Eur. J. Pharm. Sci. 2017, 104, 273-292. 7. Pushpalatha, R.; Selvamuthukumar, S.; Kilimozhi, D. Nanocarrier mediated combination drug delivery for chemotherapy – A review. J. Drug Delivery Sci. Technol. 2017, 39, 362-371. 8. Sasikumar, A.; Kamalasanan, K. Nanomedicine for prostate cancer using nanoemulsion: A review. J. Controlled Release 2017, 260, 111-123. 9. Zhao, K.; Li, D.; Xu, W.; Ding, J.; Jiang, W.; Li, M.; Wang, C.; Chen, X. Targeted hydroxyethyl starch prodrug for inhibiting the growth and metastasis of prostate cancer. Biomaterials 2017, 116, 82-94. 10. Si, Z.; Xie, B.; Chen, Z.; Tang, C.; Li, T.; Yang, M. Electrochemical aptasensor for the cancer biomarker CEA based on aptamer induced current due to formation of molybdophosphate. Microchim. Acta 2017, 1-7. 11. Lee, A. Y.; Ha, N. R.; Jung, I. P.; Kim, S. H.; Kim, A. R.; Yoon, M. Y. Development of a ssDNA aptamer for detection of residual benzylpenicillin. Anal. Biochem. 2017, 531, 1-7. 12. Wang, Y.; Gan, N.; Zhou, Y.; Li, T.; Hu, F.; Cao, Y.; Chen, Y. Novel label-free and high-throughput microchip electrophoresis platform for multiplex antibiotic residues detection based on aptamer probes and target catalyzed hairpin assembly for signal amplification. Biosens. Bioelectron. 2017, 97, 100-106. 13. Xiang, J.; Pi, X.; Chen, X.; Xiang, L.; Yang, M.; Ren, H.; Shen, X.; Qi, N.; Deng, C. Integrated signal probe based aptasensor for dual-analyte detection. Biosens. Bioelectron. 2017, 96, 268-274. 14. Taghdisi, S. M.; Danesh, N. M.; Ramezani, M.; Lavaee, P.; Jalalian, S. H.; Robati, R. Y.; Abnous, K. Double targeting and aptamer-assisted controlled release delivery of epirubicin to cancer cells by aptamers-based dendrimer in vitro and in vivo. Eur. J. Pharm. Biopharm. 2016, 102, 152-158. 15. Chand, R.; Han, D.; Neethirajan, S.; Kim, Y.-S. Detection of protein kinase using an aptamer on a microchip integrated electrolyte-insulator-semiconductor sensor. Sens. Actuators, B 2017, 248, 973-979.



16. Shan, S.; He, Z.; Mao, S.; Jie, M.; Yi, L.; Lin, J. M. Quantitative determination of VEGF165 in cell culture medium by aptamer sandwich based chemiluminescence assay. Talanta 2017, 171, 197-203. 17. Abnous, K.; Danesh, N. M.; Ramezani, M.; Yazdian-Robati, R.; Alibolandi, M.; Taghdisi, S. M. A novel chemotherapy drug-free delivery system composed of three therapeutic aptamers for the treatment of prostate and breast cancers in vitro and in vivo. Nanomedicine: Nanotechnology, Biology, and Medicine 2017, 13, (6), 1933-1940. 18. Poolsup, S.; Kim, C. Y. Therapeutic applications of synthetic nucleic acid aptamers. Curr. Opin. Biotechnol. 2017, 48, 180-186. 19. Luo, Z.; Yan, Z.; Jin, K.; Pang, Q.; Jiang, T.; Lu, H.; Liu, X.; Pang, Z.; Yu, L.; Jiang, X. Precise glioblastoma targeting by AS1411 aptamer-functionalized poly (L-γglutamylglutamine)–paclitaxel nanoconjugates. J. Colloid Interface Sci. 2017, 490, 783-796. 20. Zhang, R.; Wang, S. B.; Wu, W. G.; Kankala, R. K.; Chen, A. Z.; Liu, Y. G.; Fan, J. Q. Co-delivery of doxorubicin and AS1411 aptamer by poly(ethylene glycol)-poly(β-amino esters) polymeric micelles for targeted cancer therapy. J. Nanopart. Res. 2017, 19, (6). 21. Dam, D. H. M.; Lee, J. H.; Sisco, P. N.; Co, D. T.; Zhang, M.; Wasielewski, M. R.; Odom, T. W. Direct observation of nanoparticle-cancer cell nucleus interactions. ACS Nano 2012, 6, (4), 3318-3326. 22. He, L.; Zeng, L.; Mai, X.; Shi, C.; Luo, L.; Chen, T. Nucleolin-targeted selenium nanocomposites with enhanced theranostic efficacy to antagonize glioblastoma. J. Mater. Chem. B 2017, 5, (16), 3024-3034. 23. Taghavi, S.; Nia, A. H.; Abnous, K.; Ramezani, M. Polyethylenimine-functionalized carbon nanotubes tagged with AS1411 aptamer for combination gene and drug delivery into human gastric cancer cells. Int. J. Pharm. 2017, 516, (1-2), 301-312. 24. Bates, P. J.; Reyes-Reyes, E. M.; Malik, M. T.; Murphy, E. M.; O'Toole, M. G.; Trent, J. O. G-quadruplex oligonucleotide AS1411 as a cancer-targeting agent: Uses and mechanisms. Biochim. Biophys. Acta 2017, 1861, (5), 1414-1428. 25. Cho, Y.; Lee, Y. B.; Lee, J. H.; Lee, D. H.; Cho, E. J.; Yu, S. J.; Kim, Y. J.; Kim, J. I.; Im, J. H.; Oh, E. J.; Yoon, J. H. Modified AS1411 Aptamer Suppresses Hepatocellular Carcinoma by Up-Regulating Galectin-14. PLoS ONE 2016, 11, (8). 26. Abnous, K.; Danesh, N. M.; Ramezani, M.; Lavaee, P.; Jalalian, S. H.; Yazdian-Robati, R.; Emrani, A. S.; Hassanabad, K. Y.; Taghdisi, S. M. A novel aptamer-based DNA diamond nanostructure for in vivo targeted delivery of epirubicin to cancer cells. RSC Adv. 2017, 7, (25), 15181-15188. 27. Yazdian-Robati, R.; Ramezani, M.; Jalalian, S. H.; Abnous, K.; Taghdisi, S. M. Targeted Delivery of Epirubicin to Cancer Cells by Polyvalent Aptamer System in vitro and in vivo. Pharm. Res. 2016, 33, (9), 2289-2297. 28. Mohan, P.; Rapoport, N. Doxorubicin as a molecular nanotheranostic agent: Effect of doxorubicin encapsulation in micelles or nanoemulsions on the ultrasound-mediated intracellular delivery and nuclear trafficking. Mol. Pharmaceutics 2010, 7, (6), 1959-1973. 29. Zhu, G.; Zheng, J.; Song, E.; Donovan, M.; Zhang, K.; Liu, C.; Tan, W. Self-assembled, aptamer-tethered DNA nanotrains for targeted transport of molecular drugs in cancer theranostics. Proceedings of the National Academy of Sciences of the United States of America 2013, 110, (20), 7998-8003. 30. Keefe, A. D.; Pai, S.; Ellington, A. Aptamers as therapeutics. Nat. Rev. Drug Discovery 2010, 9, (7), 537-550. 20 ACS Paragon Plus Environment

Page 20 of 33

Page 21 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


31. Veronese, F. M.; Pasut, G. PEGylation, successful approach to drug delivery. Drug Discovery Today 2005, 10, (21), 1451-1458. 32. Alibolandi, M.; Sadeghi, F.; Abnous, K.; Atyabi, F.; Ramezani, M.; Hadizadeh, F. The chemotherapeutic potential of doxorubicin-loaded PEG-b-PLGA nanopolymersomes in mouse breast cancer model. Eur. J. Pharm. Biopharm. 2015, 94, 521-531. 33. Dreaden, E. C.; Austin, L. A.; MacKey, M. A.; El-Sayed, M. A. Size matters: Gold nanoparticles in targeted cancer drug delivery. Therapeutic Delivery 2012, 3, (4), 457-478. 34. Taghdisi, S. M.; Abnous, K.; Mosaffa, F.; Behravan, J. Targeted delivery of daunorubicin to T-cell acute lymphoblastic leukemia by aptamer. J. Drug Targeting 2010, 18, (4), 277-281. 35. Bagalkot, V.; Farokhzad, O. C.; Langer, R.; Jon, S. An aptamer-doxorubicin physical conjugate as a novel targeted drug-delivery platform. Angew. Chem. Int. Ed. 2006, 45, (48), 8149-8152.



Page 22 of 33

As1411 aptamer PEG

CS

DOX

Fig. 1. Schematic description of Dox-loaded three-way junction pocket DNA nanostructure. The DNA nanostructure was composed of three strands of AS1411 aptamer modified with PEG.


Page 23 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1

2 3

a)

1

2

b)

Fig. 2. (a) Agarose gel electrophoresis of DNA nanostructure to confirm the formation of DNA nanostructure. Lane 1: Apt1, lane 2: Apt1 + Apt2, lane 3: Apt1 + Apt2 + Apt3 (DNA nanostructure). (b) Serum stability of DNA nanostructure. Lane 1: DNA nanostructure and lane 2: DNA nanostructure after incubation with serum for 6 h.



3500

Fluorescence Intensity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 33

2800

2100

1400

700

0 510

560

610

660

Wavelength (nm)

Fig. 3. Fluorescence spectra of Dox (5 µM) after treatment with increasing concentrations of DNA nanostructure (from top to bottom 0, 0.3, 0.5, 1, 2, 4 µM). Results indicated that the maximum quenching of Dox happened at 1:2.5 mole ratio of DNA nanostructure to Dox.


Page 25 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 4. Profile of Dox release from Dox-loaded DNA nanostructure in citrate-phosphate buffer at 37°C in pH 7.4 (bottom) and in pH 5.5 (top). Dox-loaded DNA nanostructure showed a much faster and more Dox release in pH 5.5.



a)

b)


Page 26 of 33

Page 27 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


c)

a)

Fig. 5. (a) Flow cytometry histogram of 4T1 cells after incubation with Dox-loaded DNA nanostructure (blue), Dox (red) and nontreated cells (green). (b) Flow cytometry histogram of PC-3 cells after incubation with Dox-loaded DNA nanostructure (blue), Dox (red) and nontreated cells (green). (c) Flow cytometry histogram of CHO cells after incubation with Doxloaded DNA nanostructure (blue), Dox (red) and nontreated cells (green).


Molecular Pharmaceutics 1 2 3 4 5 6 7 8 9 10 11 12 13 a) 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32b) 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Simple cells

Dox-loaded DNA nanostructure

Page 28 of 33

Merge

Fig. 6. (a) Fluorescent image of CHO cells after treatment with Dox-loaded DNA nanostructure and the image merged to show non-internalization of the DNA nanostructure (b) Fluorescent image of PC-3 cells after treatment with Dox-loaded DNA nanostructure and the image merged to show internalization of the DNA nanostructure.


Page 29 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 7. Effects of Dox-loaded DNA nanostructure, Dox and DNA nanostructure on nontarget (CHO) and target (PC-3 and 4T1) cells viability. Cells were treated with Dox-loaded DNA nanostructure, Dox, Dox-loaded control complex and DNA nanostructure for 3 h. Then after 72 h, viability of the cells was analyzed using MTT assay.



Fig. 8. In vivo antitumor efficacy of Dox-loaded DNA nanostructure against mice bearing 4T1 cells after intravenous administration of PBS, Dox, DNA nanostructure and Dox-loaded DNA nanostructure via the tail vein during 20 days. The tumor growth trend of Dox-loaded DNA nanostructure treatment was significantly slower than other treatments.


Page 30 of 33

Page 31 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Oligonucleotide sequences used in this study. The underlined sequences are AS1411 aptamers. Complementary strands have been shown with the same color.

Oligonucleotide Aptamer1 (Apt 1)

Sequence (from 5' to 3') 5-TATGGTGAAGGGAAAGGTGGTGGTGGTTGTGGTGGTGGTGGAAACACCAAACCCAAPEG2000-3

Aptamer2 (Apt 2)

5-TTGGGTTTGGTGAAAGGTGGTGGTGGTTGTGGTGGTGGTGGAAACCTCCTTTCCTTPEG2000-3

Aptamer3 (Apt 3)

5-AAGGAAAGGAGGAAAGGTGGTGGTGGTTGTGGTGGTGGTGGAAACCCTTCACCATAPEG2000-3

Control sequence 1

5-TATGGTGAAGGGAAACTTCCTGGTGGATGTCCTAGTGGTTCAAACACCAAACCCAAPEG2000-3

Control sequence 2

5-TTGGGTTTGGTGAAACTTCCTGGTGGATGTCCTAGTGGTTCAAACCTCCTTTCCTTPEG2000-3

Control sequence 3

5-AAGGAAAGGAGGAAACTTCCTGGTGGATGTCCTAGTGGTTCAAACCCTTCACCATAPEG2000-3



Fig. 1. Schematic description of Dox-loaded three-way junction pocket DNA nanostructure. The DNA nanostructure was composed of three strands of AS1411 aptamer modified with PEG. Fig. 2. (a) Agarose gel electrophoresis of DNA nanostructure to confirm the formation of DNA nanostructure. Lane 1: Apt1, lane 2: Apt1 + Apt2, lane 3: Apt1 + Apt2 + Apt3 (DNA nanostructure). (b) Serum stability of DNA nanostructure. Lane 1: DNA nanostructure and lane 2: DNA nanostructure after incubation with serum for 6 h. Fig. 3. Fluorescence spectra of Dox (5 µM) after treatment with increasing concentrations of DNA nanostructure (from top to bottom 0, 0.3, 0.5, 1, 2, 4 µM). Results indicated that the maximum quenching of Dox happened at 1:2.5 mole ratio of DNA nanostructure to Dox. Fig. 4. Profile of Dox release from Dox-loaded DNA nanostructure in citrate-phosphate buffer at 37°C in pH 7.4 (bottom) and in pH 5.5 (top). Dox-loaded DNA nanostructure showed a much faster and more Dox release in pH 5.5. Fig. 5. (a) Flow cytometry histogram of 4T1 cells after incubation with Dox-loaded DNA nanostructure (blue), Dox (red) and nontreated cells (green). (b) Flow cytometry histogram of PC-3 cells after incubation with Dox-loaded DNA nanostructure (blue), Dox (red) and nontreated cells (green). (c) Flow cytometry histogram of CHO cells after incubation with Doxloaded DNA nanostructure (blue), Dox (red) and nontreated cells (green). Fig. 6. (a) Fluorescent image of CHO cells after treatment with Dox-loaded DNA nanostructure and the image merged to show non-internalization of the DNA nanostructure (b) Fluorescent image of PC-3 cells after treatment with Dox-loaded DNA nanostructure and the image merged to show internalization of the DNA nanostructure. Fig. 7. Effects of Dox-loaded DNA nanostructure, Dox and DNA nanostructure on nontarget (CHO) and target (PC-3 and 4T1) cells viability. Cells were treated with Dox-loaded DNA nanostructure, Dox, Dox-loaded control complex and DNA nanostructure for 3 h. Then after 72 h, viability of the cells was analyzed using MTT assay. Fig. 8. In vivo antitumor efficacy of Dox-loaded DNA nanostructure against mice bearing 4T1 cells after intravenous administration of PBS, Dox, DNA nanostructure and Dox-loaded DNA nanostructure via the tail vein during 20 days. The tumor growth trend of Dox-loaded DNA nanostructure treatment was significantly slower than other treatments. Table 1. Oligonucleotide sequences used in this study. The underlined sequences are AS1411 aptamers. Complementary strands have been shown with the same color.


Page 32 of 33

Page 33 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


PBS

ACS Paragon Plus Environment

A novel AS1411 aptamer-based three-way junction pocket DNA

Recommend Documents