A Novel Pyrrole-Imidazole Polyamides Hoechst Conjugate

Subscriber access provided by University of South Dakota

Article

A Novel Pyrrole-Imidazole Polyamides Hoechst Conjugate Suppresses Epstein-Barr Virus Replication and Virus-Positive Tumor Growth Zhehong Cheng, Wei Wang, Chunlei Wu, Xiaohua Zou, Lijing Fang, Wu Su, and Pu Wang J. Med. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jmedchem.8b00496 • Publication Date (Web): 14 Jul 2018 Downloaded from http://pubs.acs.org on July 14, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

A Novel Pyrrole-Imidazole Polyamides Hoechst Conjugate Suppresses Epstein-Barr Virus Replication and Virus-Positive Tumor Growth Zhehong Cheng, †‡# Wei Wang,†# Chunlei Wu,† Xiaohua Zou,§ Lijing Fang,†* Wu Su†* and Pu Wang§* †

Guangdong Key Laboratory of Nanomedicine, Institute of Biomedicine and Biotechnology,

Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen, Guangdong 518055, China ‡

Shenzhen College of Advanced Technology, University of Chinese Academy of Sciences,

Shenzhen, Guangdong, 518055, China §

Shenzhen Laboratory of Antibody Engineering, Institute of Biomedicine and Biotechnology,

Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen, Guangdong 518055, China

ACS Paragon Plus Environment

1

Journal of Medicinal Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 44

ABSTRACT: Epstein-Barr virus (EBV) establishes latent infection and is associated with several types of lymphomas and carcinomas. EBV nuclear antigen 1 (EBNA1) is expressed in all EBV positive tumor cells. EBNA1 binds to the origin of virus plasmid replication (OriP) on EBV episome to initiate virus DNA replication and regulates virus gene expression as a transcriptional activator. In this study, we designed and synthesized a pyrrole-imidazole polyamide-Hoechst 33258 conjugate named EIP-2 (2), which specifically binds to the OriP region with high affinity, to interrupt EBNA1-OriP binding in vitro and in vivo. By eradicating EBV episome in EBVpositive cells, compound 2 selectively inhibited EBV-positive cell proliferation. Moreover, injection of 2 significantly suppressed tumor growth in mice xenograft tumor model. These findings demonstrate that compound 2 is a potential therapeutic candidate for the treatment of EBV-associated tumors.


2

Page 3 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Epstein-Barr virus (EBV) is one of the most understood viruses that account for oncogenesis. EBV latent infection is associated with the pathogenesis of Burkitt’s lymphoma, Hodgkin’s disease, non-Hodgkin’s lymphoma, nasopharyngeal carcinoma, gastric adenocarcinoma and other malignancies in immunocompromised individuals1, 2. EBV efficiently transforms resting B cells to permanently growing lymphoblastoid cell line (LCL) in vitro, strongly supporting its association with cancer pathogenesis1-3. During the latent infection, Epstein-Barr virus nuclear antigen 1 (EBNA1) plays a critical role in persisting viral genome and host cell survival4, 5. The only latent viral protein expressed in all forms of viral latency, EBNA1 activates virus replication and transcription of other viral latent genes by binding to the origin of virus plasmid replication (OriP)4, 5. OriP has two EBNA1 recognizing regions: the family repeat (FR) region and the dyad symmetry (DS) region. There are four conservative 18-bp EBNA1 binding sites on DS and the DS has been proved both essential and sufficient for replication in the presence of EBNA15, 6. All of the four binding sites on DS are required for efficiency of EBNA1 binding, and mutation of these binding sites strongly inhibits EBV episome replication7. EBNA1 knockout by transcription activator-like effector nucleases caused reduced EBNA1 expression and significant cell death of EBV-positive lymphocytes8. Disruption of EBNA1 protein expression by antisense oligonucleotides9 or RNAi10,

11

inhibited EBNA1 functions of

maintaining EBV genome. Small molecule binding to EBNA1 DNA-binding domain also eradicated EBV episomes and induced cellular apoptosis12. Thus, the binding model of EBNA1 and OriP DS sequence is a critical portion of EBV replication and a highly potential target for selectively inhibiting virus replication and coexisting cell growth. Pyrrole-Imidazole polyamides (PIPs) are a series of synthetic small molecules which bind to DNA minor groove with high affinity and specificity13, 14. The skeleton of PIPs consists of linked


3


Page 4 of 44

N-methlypyrrole (Py) and N-methlyimidazole (Im) in a hairpin structure. A face-to-face Py/Py pair selectively targets A/T or T/A base pair, and an Im/Py pair recognizes G/C base pair13, 15. Sequence specific PIPs are permeable to biological membrane16 and can interfere with the binding of proteins to target DNA sequences. Therefore, PIPs can modulate gene expression, e.g. NF-κB17, MMP-918 and TGF-β19 by inhibiting transcription factor-DNA complexes in designated promoters. By regulating gene expression, PIPs exhibit antitumor activity in vivo20,

21

. An

attempt reported by Yasuda et al. to inhibit EBNA1-OriP function by PIPs showed a visible impact on virus replication and EBNA1 function in LCLs at 40µM concentration22. However, the polyamides applied in their work showed preference to only one of the four EBNA1 binding sites. These indicated that PIPs were capable of disrupting EBNA1 functions, but improvement on the specificity and efficacy was required for the clinical application of PIPs to inhibit EBNA1 in EBV-associated cancers. In this study, we designed and synthesized a novel Py-Im polyamide-Hoechst 33258 (Ht) conjugate, called EIP-2 (2, Figure 1), targeting all four binding sites on DS region of EBNA1. In addition to enhance cellular permeability and nuclear uptake, conjugating the DNA-intercalator Hoechst 33258 on the γ-turn unit of PIP improved its specificity to DS by recognizing and binding up to 10 bps of the targeted sequence. Our study demonstrated that compound 2 recognized EBNA1 binding sites with high affinity and specificity, thus remarkably inhibited EBNA1 binding to DS both in vitro and in vivo. As a consequence, compound 2 inhibited EBVpositive cells proliferation and resulted in significant reduction of virus replication. Notably, compound 2 greatly suppressed EBV-positive tumor growth in mice xenograft models. These results suggest that compound 2 is an excellent EBNA1-OriP binding inhibitor and a promising candidate for EBV-associated cancer therapy.


4

Page 5 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RESULTS Polyamides design and synthesis. The interaction between OriP and EBNA1 is the key section for initiating DNA replication of EBV4-7. Interruption of EBNA1-DNA interaction is a typical strategy to inhibit the virus replication and thereby suppress the tumor cell growth8-12, 22. As a fluorescent cell dye for DNA, Hoechst 33258 (Ht) exhibits a strong selectivity against A/T rich DNA sequences23, 24. Previous researches have demonstrated that PIP-Ht conjugate was capable of recognizing around four more base pairs than PIP alone25-28. According to our previous study in the inhibitor of Polo-like Kinase 1, γ-turn is the most ideal point for Ht conjugating29. To design PIPs that could appropriately bind to EBNA1 binding region on OriP DS, we analyzed the four EBNA1 binding sites (Figure 1A) and noticed that sequence 5’AGCATAT-3’ appeared in all four binding sites, which was proved to be conservative5, 6. Regions around these conservative regions were also A/T-rich, therefore ideal targets for a PIPHt conjugate. Accordingly, we designed and synthesized 2 (Figure 1B), a novel Py-Im polyamide with Ht conjugated at the γ-turn position. Compound 2 was expected to bind to the illustrated location (Figure 1A). We also synthesized EIP-1 (1), the polyamide skeleton without Ht, and Untargeted PIP (a 1-pair mismatched Py-Im polyamide-Ht conjugate, 3) which was not supposed to bind to any of the four binding sites, as a negative control. Polyamides target EBNA1-binding region on OriP and block EBNA1 binding to OriP in vitro. Polyamides were designed to bind to the EBNA1-binding region on OriP so that it would displace EBNA1 from OriP. Therefore, we tested the binding affinity of polyamides with EBNA1 binding region on DS by surface plasmon resonance (SPR). As shown in Figure 1 and Figure 2A, the DNA sequences and the polyamides binding model were similar between Site 1 and 4, Site 2 and 3. Thus, Site 1 and Site 2 were chosen to perform the SPR assay. The calculated KD of binding affinity was shown in Table 1. Compound 1 and 2 had strong (KD < 10-7) binding


5


Page 6 of 44

affinity to their target sequences and had weak association to 1-bp mismatched binding sites. Both 1 and 2 bound to target sequences tightly and were difficult to be disassociated (Figure S5). The compound 3 was capable to bind to the EBNA1 binding sites, but was disassociated quickly afterward (Figure S5). These results confirmed the high specificity of 1 and 2 to binding sites. Compound 2 were more specific to Site 2 than Site 1, probably because the estimated binding region of conjugated Ht in Site 2 had more A/T bases. In accordance with our previous study in PIPs, Ht conjugation of polyamides reduced the affinity to the target sequence29. However, compound 2 exhibited stronger specificity to the target sequences than 1-bp mismatch sequences in comparison with 1. To further investigate whether polyamides binding could prevent EBNA1 interaction with DS, we performed a competitive inhibition assay. Different concentration of polyamides were injected to pass through EBNA1 binding sites. Subsequently, an EBNA1 solution was injected without polyamides disassociation (Figure 2B-D, Table 2). Pre-injection of 1 and 2 remarkably reduced RU rise during EBNA1 injection, indicating that EBNA1 binding was blocked by these two polyamides. Having stronger affinity to EBNA1 binding sites, compound 1 blocked EBNA1 binding more efficiently than 2 at 200nM. Although much higher concentration of 3 was injected, only little RU rise reduction was observed. It was proved that compound 3 was not able to block EBNA1 binding to OriP in vitro. In conclusion, compound 1 and 2 could occupy the binding position of EBNA1 on OriP and prevent EBNA1 binding in vitro with high specificity and affinity. Polyamides specifically inhibit EBV-positive lymphoblastic cell growth. Confirming that compound 1 and 2 could block EBNA1 binding to OriP in vitro, we next determined if 1 and 2 could inhibit EBV-positive lymphoblastic cell growth. The typical EBV-positive Burkitt’s


6

Page 7 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


lymphoma cell lines Raji and Daudi and EBV negative cell lines Jurkat and MOLT-4 were treated with 1 and 2 at 10µM, separately. The number of living cells was counted by a trypan blue dye assay. In EBV positive cells, the living cell amount in compound 2 treatment was significantly reduced compared with 1 and control treatment (P < 0.01) (Figure 3A, up-panel). In EBV negative cells, there was no significant difference (P > 0.05) among 1, 2 and control treatment (Figure 3A, bottom-panel). To confirm that compound 2 inhibited EBV positive cell lines selectively, an MTT assay was performed and the exact GI50 value was calculated in eight different cell lines, including EBV positive cells Raji, Daudi and B95-8, and EBV negative cells RPMI-8226, Jurkat, MOLT-4, Nalm-6 and MDA-MB-231 (Figure 3B and Table 3). The GI50 in EBV negative cells was higher than in EBV positive cells. Collectively, these data suggest that compound 2 could selectively inhibited EBV positive cells, while 1 had much weaker inhibition. Polyamides inhibit EBV DNA replication and latent protein expression. Based on experiments on cell proliferation, compound 2, which did not excel in targeting DS sequences and blocking EBNA1 binding in vitro, exhibited selective inhibition to EBV-positive cell line, but not 1. We speculated that the binding of EBNA1 to OriP in vivo was blocked by 2 and the EBV episome copy numbers were therefore decreased. EBV DNA copy numbers in Raji cells treated with polyamides were detected by real-time PCR. The copy numbers in Raji cells treated with 10µM 2 was significantly decreased (P < 0.01) after 120h, while 1 and 3 had little effect on EBV copy number. Compound 2 also reduced EBV copy numbers in two additional EBV positive cell lines (Figure 4A). In order to confirm whether 2 eradicated EBV episomes by blocking the binding of EBNA1 to OriP in vivo, a chromatin immunoprecipitation (ChIP) assay was performed. The results show that binding of OriP to EBNA1 in Raji cells had been significantly reduced (P < 0.01) with time prolongation, while the same concentration of 1 was


7


Page 8 of 44

not able to prevent the binding of EBNA1 and OriP (Figure 4B). These data suggest that compound 2 competed with EBNA1 binding to OriP, disrupted the interaction between EBNA1 and OriP and decreased EBV virus replication. The depletion of the virus finally led to cell growth inhibition. Compound 1 failing to target OriP in cells and inhibit virus replication indicated that the conjugated Ht on 2 played an important role in inhibiting EBNA1 binding and virus replication. EBNA1 binding to OriP not only induces virus replication, but activates viral latent proteins transcription5, 30. To detect whether treatment of 1 or 2 modulates latent viral protein expression, a western blotting assay was performed to determine the expression level of EBNA1 and EBNA2, another important viral protein during latent infection. In 24h, the expression level of two proteins was decreased by the increasing dosage of 2 (Figure 4C). Treatment of 1 did not reduce the expression of EBNAs. The results suggest that compound 2 probably disrupts latent protein expression by blocking EBNA1 binding to OriP. Polyamide 2 inhibit tumor growth in mice xenograft tumor model. Balb/c nude mice carrying Raji xenograft at right flank were treated with different dosages of 2 by subcutaneously injection every 3 days to determine its antitumor function in vivo. The size of the tumors was recorded before every injection (Figure 5A). Mice treated with 2 had significant smaller tumor (P < 0.01) than vehicle control, and higher dosage of treatment (10mg/kg) resulted in significantly better (P < 0.05) antitumor effect than the 5mg/kg treatment. After 8 injections, the tumors in the compound 2 treated group were significantly smaller than the vehicle control group (Figure 5C&D). It showed the favorable tumor suppression effect of 2 in animals. No significant weight loss was observed in the compound 2 treated groups at two different dosages (Figure 5B), indicating the low toxicity of 2 to animals. In addition, EBV copy numbers of the xenograft


8

Page 9 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


tumor were determined by real-time PCR (Figure 5E). As shown in figure, the virus copy number was significantly suppressed (P < 0.01) by 2, suggesting that compound 2 was able to inhibit tumor growth by preventing virus replication. DISCUSSION In this study, we designed and synthesized two polyamides that target OriP sequences in order to block EBNA1-OriP binding. Through in vitro and in vivo screening, we discovered that the Ht-conjugated polyamide 2 was capable of displacing EBNA1 from OriP and consequently disrupted virus replication and viral protein expression. As a result, EBV-positive cell proliferation and EBV-positive tumor growth in mice xenograft tumor model was significantly suppressed. Although DS and FR contribute to different functions of OriP, all of the binding sites on OriP are highly conserved22. Albeit originally designed to target DS, compound 2 is quite possible to bind to FR as well (Figure S7). One of the most important functions of FR is to activate the Cp promoter and latent membrane protein (LMP) promoters, subsequently inducing the expression of EBNAs and LMPs with EBNA1 binding31, 32. The reduced expression of EBNA1 and EBNA2 by treatment with 2 indicated that compound 2 but not compound 1 inhibited the transcription function of EBNA1, most likely by interrupting the binding of EBNA1 to FR. Along with the downregulation of replication of EBV genome, compound 2 inhibited both the replication and transcription function of EBNA1. Ht-conjugated polyamide 2 significantly inhibited EBV-positive cell proliferation and EBVpositive tumor growth while 1 did not exhibit any significant effect by contrast. Hoechst 33258 is a kind of synthetic minor groove-binding molecule containing bis-benzimidazole moiety. It strongly prefers, but is not restricted to A/T rich DNA sequences, with 5±1 bps at sites in size23, 24

. It was reported that PIP-Ht conjugate was capable of recognizing around four more base pairs


9


Page 10 of 44

than PIP alone25-28, which could improve the specificity of the polyamide towards target sequences and reduce the off-target binding. In our previous study, we synthesized a series of PIPs to target the Polo-like Kinase 1 promoter sequence29. A PIP-Hoechst conjugate in which the Ht was conjugated at the γ-turn position recognized longer sequences and was the most specific and efficient inhibitor of Polo-like Kinase 1 expression among all PIP derivatives we have synthesized. Therefore, we hypothesized that Ht-conjugated 2 exhibit a better effect on EBNA1 inhibition. According to our design, compound 2 was able to cover 6 bps pyrrole-imidazole recognizing region and 4-5 bps of A/T rich Ht-binding region in every EBNA1 binding site on DS, coming to a total of 10-11 bps. Target-specific inhibiting would certainly benefit from longer recognizing sequences. The most efficient approach for polyamides to interrupt gene expression is to bind to key DNA elements, such as promoters, to inhibit the formation of protein-DNA complexes13. Besides, it was revealed that if the polyamide binding region was just slightly upstream or downstream of the transcription start site of a target gene, the expression level of the target gene was not altered33. According to Table S1, there exist a great number of highly similar sequences of EBNA1 binding sites in human genome, but only little of them are possibly located on promoters, especially in the transcription start site. Therefore, the lack of effects on the expression level of other important genes could be expected although off-target binding of compound 2 existed. The mitotic segregation of EBV required both EBNA1 and OriP elements5. During the mitotic segregation of EBV, EBV episomes were tethered to cellular chromosomes by EBNA134-36. Therefore, it is important for the EBNA1-OriP binding inhibitor to locate the target sequences in nucleus. Early study of inhibiting gene expression by PIPs in cell lines other than T cells met


10

Page 11 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


great difficulties37. Poor nuclear uptake was presumed to be the main reason26. In accordance with Figure 4B, 1 was not capable of binding to its target sequences in vivo. Previous researches have already demonstrated that Ht conjugation on PIPs could improve its ability to penetrate cell membrane and guide the molecule to the nuclear target sequences38, 39 . In this research, cellular uptake of PIP-Hoechst was observed and it was confirmed that 2 was successfully co-localized with chromosomes, indicating its entrance in nuclei region (Figure S6). This was also confirmed in our previous study on the Polo-like Kinase 1 inhibitor29. Better cellular and nuclear uptake would certainly help 2 interrupting EBV episomes segregation. Moreover, Hoechst 33258 interacts with DNA physically and reversibly and does not cause permanent DNA damage23. In conclusion, Ht conjugation on 2 enhanced its ability to safely inhibit EBV-associated tumors by better recognizing target sequences and improved cellular and nuclear uptake. Several researches have been reported on EBV treatment by interfering EBNA1 functions. The binding structure of EBNA1 and OriP was studied and high-throughput in silico and in vitro screening was performed to select an effective inhibitor to bind to EBNA140. Hsp90 inhibitor downregulated the expression of EBNA1 and prevented EBV transformation of B lymphocytes41. siRNA knockdown of EBNA1 inhibited EBNA1 expression in EBV-positive epithelial and lymphoblastic cell lines10, 11, and it also suppressed DNA replication in a miniEBV replication model10. Roscovitine suppressed EBNA1 functions of transcription and episome persistence by inhibiting serine 393 phosphorylation42. Most of these researches focused on targeting the EBNA1 protein to inhibit EBNA1-OriP binding, but there has been little research focusing on targeting the OriP region. The attempt on inhibit EBNA1-OriP binding by PIPs22 inspired us to develop an highly specific and efficient inhibitor to prevent EBNA1-OriP binding. Compared with the polyamides already reported, compound 2 showed better efficacy in lower


11


Page 12 of 44

dosage, and specificity to all four binding sites on DS. Nude mice Xenograft tumor model demonstrated that compound 2 is safe and effective against EBV-positive tumor in vivo. EBNA1 binding to DS is necessary for DNA replication, but not sufficient5, 43, as viral DNA replication can initiate from other sites independently from EBNA1, such as Rep*44. Other important viral or host genes, including LMP145, Topoisomerase I46 and NF-κB47 were also involved in EBV-associated tumor formation. Lytic cycle of EBV, which contribute to EBV infection, was important for EBV treatment. The polyamide developed in this study would be the core of our further study on drug combination therapy targeting EBNA1-OriP binding and other factors associated with EBV-positive tumors. EXPERIMENTAL SECTION General Information. 1-methyl-1H-imidazole-2-carboxylic acid, dry DMF and dry THF were purchased from Sigma-Aldrich. Fmoc-hydrazinobenzoyl AM resin was purchased from Novabiochem. Boc-Py-OH, Boc-Im-OH, collidine (2,4,6-collidine), TFA and the HPLC grade solvents (CH3CN and MeOH) were purchased from J&K Scientific. BTC, PyBOP, cupric acetate, N,N-dimethyl-1,3-propane diamine were purchased from Aladdin. Fmoc-D-Dab(Boc)OH, and HOAt were purchased from GL Biochem. Hoechst 33258 acid was purchased from Beijing Fanbo Biochemicals Ltd. All commercial reagents were used as received. The purity of the compounds was determined to be >95% by analytical RP-HPLC. Analytical RP-HPLC was performed at 25℃ on the Shimadzu LC 20 using Inertsil ODS-SP column (4.6 x 250 mm, 5 µm, 100 Å). UV absorbance was detected using UV detector SPD-20A at 254 nm and 310 nm. The analytical RP-HPLC gradient started at 10% of B (CH3CN) and then increased to 100% of B over 30 min (A: 0.1% TFA in water). Semi-preparative RP-HPLC was performed on the ULTIMAT 3000 Instrument (DIONEX) using Thermo Scientific Hypersil GOLD column (21.2 x 250 mm, 5 µm). UV absorbance was measured using a photodiode array detector at 254


12

Page 13 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nm and 310 nm. The RP-HPLC gradient started at 10% of B (CH3CN), held at 5 min, and then increased to 100% of B over 25 min (A: 0.1% TFA in water). Mass spectra was measured on ABI Q-star Elite. Synthesis of (R)-4-(4-(4-(2-amino-4-(1-methyl-4-(1-methyl-4-(1-methyl-4-(1-methyl-1Himidazole-2-carboxamido)-1H-pyrrole-2-carboxamido)-1H-pyrrole-2-carboxamido)-1Hpyrrole-2-carboxamido)butanamido)-1-methyl-1H-pyrrole-2-carboxamido)-1-methyl-1Hpyrrole-2-carboxamido)-N-(5-((3-(dimethylamino)propyl)carbamoyl)-1-methyl-1H-pyrrol3-yl)-1-methyl-1H-imidazole-2-carboxamide (1). According to the previous methods48, 49, the synthesis of 1 was carried out using Fmoc-hydrazinobenzoyl AM NovaGel resin at a substitution level of 0.61 mmol/g. First, the resin (400 mg, 0.244 mmol, 1 eq.) was pre-swelled in DCM for 20 min in a manual solid phase peptide synthesis vessel. Then the Fmoc group was removed with 20% piperidine in DMF (2 × 5 min) and the resin was washed with DMF (4 x 3 mL) and dry DMF (3 mL). Meanwhile, Boc-Py-OH (234 mg, 0.976 mmol, 4 eq.) and BTC (95 mg, 0.322 mmol, 1.33 eq.) were dissolved in dry THF (2 mL), collidine (387 µl, 2.928 mmol, 12 eq.) was added dropwise to the THF solution. After activation for 1 min, dry DMF (1 ml) were added to the suspension followed by addition of DIEA (509 µl, 2.928 mmol, 12 eq.). When the mixture became clear, it was transferred to the deprotected resin. Coupling of the first Boc-Py-OH to the resin was taken out for 1 h to ensure sufficient reaction. The resin was washed with DMF (3 x 3 mL) and DCM (2 x 3 mL), the Boc group was then removed using a TFA/TIS/H2O mixture (95/2.5/2.5) (twice, min and 20 min, respectively). After washing with DCM (2 x 3 mL), DMF (3 x 3 mL) and dry DMF (3 ml), the resin was ready for the next coupling. This procedure including activation of the amino acid, coupling with the resin and deproction of the Boc group was repeated until a polyamide sequence (Im-Py-Py-Py-γ(Fmoc)-Py-Py-Im-Py) bound to the resin


13


Page 14 of 44

was obtained. It should be noted that the addition of HOAt (4 eq.) to the activated solution of Boc-Im-OH or Fmoc-D-Dab(Boc)-OH was needed before it was transferred to the deprotected resin. All the couplings were completed in 30 min. After the resin was washed with DMF (4 x 3 mL), N,N-dimethyl-1,3-propane diamine (311 µl, 2.44 mmol, 10 eq.) in DMF (1 mL) was added to the resin. The resulting mixture was shaken for 3 h at 90℃ before it was cooled to room temperature. Then the resin was removed by filtration through a disposable propylene filter and washed with MeOH (4 x 2 mL). The filtrate was dried under vacuum, dissolved in 10% MeCN/H2O (0.1%TFA) and purified by semi-preparative RP-HPLC. After lyophilization, compound 1 was obtained as fine white powders (yield: 29%). HPLC analysis: retention time 15.159 min, peak area 95.350%. HRMS (ESI) m/z: calcd for C55H68N21O9 [M+H]+ 1166.5509, found 1166.5509; calcd for C55H69N21O9 [M+2H]2+ 583.7793, found 583.7703 (Figure S4). Synthesis of (R)-N-(5-((3-(dimethylamino)propyl)carbamoyl)-1-methyl-1H-pyrrol-3-yl)1-methyl-4-(1-methyl-4-(1-methyl-4-(4-(1-methyl-4-(1-methyl-4-(1-methyl-4-(1-methyl-1Himidazole-2-carboxamido)-1H-pyrrole-2-carboxamido)-1H-pyrrole-2-carboxamido)-1Hpyrrole-2-carboxamido)-2-(4-(4-(5-(4-methylpiperazin-1-yl)-1H,1'H-[2,5'bibenzo[d]imidazol]-2'-yl)phenoxy)butanamido)butanamido)-1H-pyrrole-2-carboxamido)1H-pyrrole-2-carboxamido)-1H-imidazole-2-carboxamide (2). To the resin bound 1 (Im-PyPy-Py-γ(Fmoc)-Py-Py-Im-Py), 20% piperidine in DMF (3 ml) was added, and the mixture was agitated for 5 min. This operation was repeated to remove the Fmoc group. Then the resin were washed with DMF (4 x 3 ml) and dry DMF (3 ml). Meanwhile, Hoechst 33258 acid (2 eq.) and PyBOP (2 eq.) were dissolved in dry DMF (3 mL), and DIEA (6 eq.) was added to the solution. After stirring for 2 min, the solution was transferred to the deprotected resin. The mixture was agitated for 2 h before the resin was washed with DMF (4 x 3 mL). Cupric acetate (1 eq.) and N,


14

Page 15 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


N-dimethyl-1,3-propane diamine (10 eq.) in DMF (1 ml) were added to the resin. The mixture was shaken overnight at room temperature. Then the resin was removed by filtration through a disposable propylene filter and washed with MeOH (4 x 2 mL). The filtrate was dried under vacuum, dissolved in 10% MeCN/H2O (0.1%TFA) and purified by semi-preparative RP-HPLC. After lyophilization, compound 2 was obtained as yellow powders (yield: 23%). HPLC analysis: retention time 15.266 min, peak area 99.234%. HRMS (ESI) m/z: calcd for C84H96N27O11 [M+H]+ 1658.7777, found 1658.7778; calcd for C84H97N27O11 [M+2H]2+ 829.8930, found 829.8974 (Figure S4). Synthesis

of

(R)-N-(5-((5-((4-((5-((5-((5-((5-((3-(dimethylamino)propyl)carbamoyl)-1-

methyl-1H-pyrrol-3-yl)carbamoyl)-1-methyl-1H-pyrrol-3-yl)carbamoyl)-1-methyl-1Hpyrrol-3-yl)carbamoyl)-1-methyl-1H-pyrrol-3-yl)amino)-3-(4-(4-(5-(4-methylpiperazin-1yl)-1H,1'H-[2,5'-bibenzo[d]imidazol]-2'-yl)phenoxy)butanamido)-4-oxobutyl)carbamoyl)-1methyl-1H-pyrrol-3-yl)carbamoyl)-1-methyl-1H-pyrrol-3-yl)-1-methyl-4-(1-methyl-1Himidazole-2-carboxamido)-1H-imidazole-2-carboxamide (3). The resin bound polyamide sequence, Im-Im-Py-Py-γ(Fmoc)-Py-Py-Py-Py, was prepared using the identical methods with that of 1. Then subsequent methods including removing Fmoc group, coupling Hoechst 33258 acid, resin cleavage and final purification were performed according to the synthesis of 2. Compound 3 was obtained as yellow powders (yield: 21%). HPLC analysis: retention time 15.713 min, peak area 100%. HRMS (ESI) m/z: calcd for C84H96N27O11 [M+H]+ 1658.7777, found 1658.7794; calcd for C84H97N27O11 [M+2H]2+ 829.8930, found 829.9167; calcd for C84H98N27O11 [M+3H]3+ 553.5979, found 553.5996 (Figure S4). Cell line and culture. All of the used cell lines were purchased from Core Facility of Stem Cell Research, Shanghai Institute of Biological Science CAS, and were incubated in a


15


Page 16 of 44

humidified incubator with 5% CO2 at 37°C. Raji, B95-8, Daudi, MOLT-4, Jurkat, RPMI-8226 and Nalm-6 cells were cultured in RPMI Modified (Hyclone, UT, USA) with 100 U/ml penicillin, 100 µg/ml streptomycin (Hyclone, UT, USA) and 10% FBS (Corning, VA, USA). MDA-MB-231 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) high glucose (Hyclone, UT, USA) with 100 U/ml penicillin, 100 µg/ml streptomycin and 10% FBS (Biological Industrial, Israel). SPR assay. The SPR assays were performed with a ProteOn™ XPR36 instrument (Bio-Rad, CA, USA) on a ProteOn™ GLH sensor chip (Bio-Rad, CA, USA). Biotin-labeled short hairpin DNAs were purchased from Genewiz, China. The Sequences are shown in Figure 3 respectively. About 16000 RU of Streptavidin (Sangon, Shanghai, China) coated first, 200nM biotin-labeled hairpin DNAs were then immobilized of around 700-900 RU. The whole assay was carried out in HBS-EP buffer (10mM HEPES pH 7.4, 150mM NaCl, 3mM EDTA, 0.005% surfactant P20) at 25℃. Polyamides samples were first diluted in ultra-pure water to avoid aggregation, and then diluted to a various gradient of concentrations. For EBNA1 binding inhibiting assay, 100nM recombinant EBNA1 (Fitzgerald, MA, USA) were immediately injected after the injection of polyamides. Sensor grams were analyzed by ProteOn™ Manager software v3.1 to calculate association rates (ka) and dissociation rates (kd). The proper binding models (models for simultaneous ka/kd, 1:1 binding with drifting baseline or 1:1 binding with mass transfer; models for general fitting–steady state affinity) were used to get better fitting. Experiments were at least performed in triplicate. Cell proliferation and growth inhibition assay. For cell proliferation assay, 5×105 EBV positive Raji and Daudi cells and EBV negative Jurkat and MOLT-4 cells were cultured in 2ml medium with 10µM polyamides. Equal volume of fresh medium containing polyamides was


16

Page 17 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


added after 3 days. At day 3 and day 6, living cells were counted by a trypan blue dye assay. For cell growth inhibition assay, certain amounts of cell (for suspension cell, 7×103; for adherent cell, 3×103) were seeded into 96-well plate in quadruple with different concentration of polyamides. After 72h culture, ratio of living cells to control were determined by a WST assay using MTT (Sigma, USA). GI50 was calculated using sigmoidal dose-response fitting by GraphPad Prism v5.0 software. Experiments were at least performed in triplicate. Quantitative Real-time PCR assay. To quantify the EBV DNA copy numbers of cell treated with polyamides, 5×105 Raji cells were cultured with 10µM 1, 2 and 10µM 3. Cells were harvested every 24h and the whole genome DNA was extracted using a genomic DNA kit (OMEGA, GA, USA). 5×105 B95-8 cells and 1×106 Daudi cells were also cultured with 10µM 2 and DNA were extracted. DNA were subjected to real-time PCR in triplicate with a SYBR mix (TransGen, Beijing, China). EBV OriP sequence (Genbank: NC_007605.1 8927-9060, forward primer:

5’-GGTTCACTACCCTCGTGGAA-3’,

reverse

primer:

5’-TGTTACCCAAC

GGGAAGCATA-3’) was used to determine the amount of EBV copy number. The human GAPDH

gene

(Genbank:

NG_007073.2

8118-8242,

forward

primer:

5’-

ACCCAGAAGACTGTGGATGG -3’, reverse primer: 5’- TTCAGCTCAGGGATGACCTT -3’) for human source Raji, Daudi cells and 18sRNA (Genbank: NT_167214.1 110426-110540, forward

primer:

5’-GTGGAGCGATTTGTCTGGTT-3’,

reverse

primer:

5’-

AACGCCACTTGTCCCTCTAA -3’) for B95-8 cells were used to determine the cellular DNA. DNA amplifications and fluorescence detection were performed using a CFX96 Real-time System (Bio-rad, Singapore). The protocol of DNA amplifications contained an initial denaturation at 95°C for 5 min, 40 cycles of 95°C for 10s, 60°C for 30s and a melt curve to confirm the specificity of amplification. The amplification efficiency was calculated by standard


17


Page 18 of 44

curves. Relative amounts of EBV copies and cellular DNA were calculated by ∆∆Ct method. Each experiment was at least performed in triplicate. To determine the EBV copy number in mice tissue, pieces of tumor were homogenized in liquid nitrogen and then proceeded to DNA extraction using a genomic DNA kit. Total DNA was subjected to real-time PCR as described above. Experiments were at least performed in triplicate. ChIP assay. Raji cells were cultured with 10µM 1 or 2. At 24h and 48h, 8×106 cells were harvested for immunoprecipitation. Cells were fixed by 37% formaldehyde and processed with SimpleChIP® Enzymatic Chromatin IP Kit (CST, MA, USA). 2% volume of samples are aliquoted as input control. 1µg of anti-EBNA1 antibody (Santa-cruz, CA, USA) and Normal mouse IgG1 (CST, MA, USA) were added to each group of immunoprecipitation and incubated overnight. The combination was isolated by magnetic beads. Same volume of the extracted ChIP product DNA were subjected to real-time PCR in triplicate, detecting the EBV OriP sequence with a SYBR mix. The protocol of DNA amplifications contained an initial denaturation at 95°C for 5 min, 40 cycles of 95°C for 15s, 60°C for 60s and a melt curve to confirm the specificity of amplification. The amplification efficiency was calculated by standard curves. Relative amounts of precipitated DNA were calculated by ∆∆Ct method. Each experiment was at least performed in triplicate. Western blotting. Raji cells were treated with 0, 1, 2, 5, 10 or 20µM 1 or 2 for 24h. Cells were harvested and lysed using nondenaturing lysis buffer supplemented with protease inhibitor cocktail. Total proteins from the supernatant were separated by 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes (Millipore, MA, USA). Membranes were exposed to EBNA1 antibody (Santa Cruz, CA, USA), EBNA2 antibody (Millipore, MA, USA) and GAPDH antibody (TransGen, Beijing, China) at 4℃ overnight, followed with horseradish peroxidase-


18

Page 19 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


conjugated second antibody for 1h. Blots were detected by luminata classico western HRP substrate (Millipore, MA, USA). Experiments were at least performed in triplicate. Mice xenograft tumor experiment. Balb/c nude female mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Raji cells were collected by centrifuge and diluted to 1×107 in 100µl of RPMI medium without FBS. 1×107 Raji cells were subcutaneously injected in the left flank. Injection of 2 began when tumor size reached ~50mm3 (L × W × 1/2W). Compound 2 was diluted in 100µl 5% DMSO/0.9% NaCl solution and subcutaneously injected around the tumor every three days (for vehicle, n = 6; for two experimental group, n = 7). Tumor size and animal weight were measured before injection. After eight injections, mice were sacrificed and tumors were weighed and peeled for further experiment. All experiments were performed under the guideline of Institutional Ethical Committee of Animal Experimentation of Shenzhen Institutes of Advanced Technology, Chinese Academy of Science (Approval Number: SIAT-IRB-160223-YYS-SUW-A0182).

ASSOCIATED CONTENT Supporting Information Additional figures and tables illustrating HPLC analysis, HRMS spectra, SPR diagram of polyamide-DNA binding, in vivo cellular uptake of 2 and predicted binding region on FR. Molecular Formula Strings. AUTHOR INFORMATION Corresponding Author *L.F.: Email, [email protected]; Phone, (+86)755-86585204.


19


Page 20 of 44

*W.S.: Email, [email protected]; Phone, (+86)755-86585203. *P.W.: Email, [email protected]; Phone, (+86)755-86585232 Fax: (+86)755-86585222. Author Contributions #

These authors contributed equally.

Funding Sources This work was supported by the Shenzhen Sciences & Technology Innovation Council (GJHS20170314154409805,

GJHS20160331195142827,

GJHS20150417103343317,

JCYJ20150401150223649,

JCYJ20150401145529036,

JCYJ20160531171744232,

JCYJ20170818153538196 and JCYJ20170413165916608) and the National Natural Science Foundation of China (Grant Nos. 21502219, 21672254, 21778068 and 21432003). Notes The authors declare no competing financial interest. ACKNOWLEDGMENT The authors appreciate School of Pharmaceutical of Sun Yat-Sen University for technical and equipment support on SPR experiments. ABBREVIATIONS USED MeOH, methanol; CH3CN, acetonitrile; BTC, bis-(trichloromethyl)-carbonate; DIEA, N,N’diisopropylethylamine; HOAt, 1-hydroxy-7-aza-benzotriazole; PyBOP, benzotriazol-1-yloxytripyrrolidino-phosphoniumhexafluorophosphate.


20

Page 21 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES 1.

Young, L. S.; Rickinson, A. B. Epstein–Barr virus: 40 years on. Nat. Rev. Cancer 2004,

4, 757-768. 2.

Thompson, M. P.; Kurzrock, R. Epstein-Barr virus and cancer. Clin. Cancer. Res. 2004,

10, 803-821. 3.

Young, L. S.; Murray, P. G. Epstein–Barr virus and oncogenesis: from latent genes to

tumours. Oncogene 2003, 22, 5108-5121. 4.

Frappier, L. EBNA1 and host factors in Epstein–Barr virus latent DNA replication. Curr.

Opin. Virol. 2012, 2, 733-739. 5.

Frappier, L. Ebna1. In Epstein Barr Virus Volume 2: One Herpes Virus: Many Diseases;

Munz C. Ed.; Springer: Switzerland 2015; pp 3-34. 6.

Bochkarev, A.; Barwell, J. A.; Pfuetzner, R. A.; Bochkareva, E.; Frappier, L.; Edwards,

A. M. Crystal structure of the DNA-binding domain of the Epstein–Barr virus origin-binding protein, EBNA1, bound to DNA. Cell 1996, 84, 791-800. 7.

Harrison, S.; Fisenne, K.; Hearing, J. Sequence requirements of the Epstein-Barr virus

latent origin of DNA replication. J. Virol. 1994, 68, 1913-1925. 8.

Noh, K.-W.; Park, J.; Kang, M.-S. Targeted disruption of EBNA1 in EBV-infected cells

attenuated cell growth. BMB Rep. 2016, 49, 226-231.


21


9.

Page 22 of 44

Roth, G.; Curiel, T.; Lacy, J. Epstein-Barr viral nuclear antigen 1 antisense

oligodeoxynucleotide inhibits proliferation of Epstein-Barr virus-immortalized B cells. Blood 1994, 84, 582-587. 10.

Yin, Q.; Flemington, E. K. siRNAs against the Epstein Barr virus latency replication

factor, EBNA1, inhibit its function and growth of EBV-dependent tumor cells. Virology 2006, 346, 385-393. 11.

Hong, M.; Murai, Y.; Kutsuna, T.; Takahashi, H.; Nomoto, K.; Cheng, C.-M.; Ishizawa,

S.; Zhao, Q.-L.; Ogawa, R.; Harmon, B. V. Suppression of Epstein-Barr nuclear antigen 1 (EBNA1) by RNA interference inhibits proliferation of EBV-positive Burkitt’s lymphoma cells. J. Cancer Res. Clin. Oncol. 2006, 132, 1-8. 12.

Lee, E. K.; Kim, S. Y.; Noh, K.-W.; Joo, E. H.; Zhao, B.; Kieff, E.; Kang, M.-S. Small

molecule inhibition of Epstein–Barr virus nuclear antigen-1 DNA binding activity interferes with replication and persistence of the viral genome. Antiviral Res. 2014, 104, 73-83. 13.

Dervan, P. B.; Edelson, B. S. Recognition of the DNA minor groove by pyrrole-

imidazole polyamides. Curr. Opin. Struc. Biol 2003, 13, 284-299. 14.

Trauger, J. W.; Baird, E. E.; Dervan, P. B. Recognition of DNA by designed ligands at

subnanomolar concentrations. Nature 1996, 382, 559-561. 15.

White, S.; Baird, E. E.; Dervan, P. B. On the pairing rules for recognition in the minor

groove of DNA by pyrrole-imidazole polyamides. Chem. Biol. 1997, 4, 569-578.


22

Page 23 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


16.

Nishijima, S.; Shinohara, K.-i.; Bando, T.; Minoshima, M.; Kashiwazaki, G.; Sugiyama,

H. Cell permeability of Py–Im-polyamide-fluorescein conjugates: Influence of molecular size and Py/Im content. Biorg. Med. Chem. 2010, 18, 978-983. 17.

Raskatov, J. A.; Meier, J. L.; Puckett, J. W.; Yang, F.; Ramakrishnan, P.; Dervan, P. B.

Modulation of NF-κB-dependent gene transcription using programmable DNA minor groove binders. Proc. Natl. Acad. Sci. U S A 2012, 109, 1023-1028. 18.

Wang, X.; Nagase, H.; Watanabe, T.; Nobusue, H.; Suzuki, T.; Asami, Y.; Shinojima, Y.;

Kawashima, H.; Takagi, K.; Mishra, R. Inhibition of MMP‐9 transcription and suppression of tumor metastasis by pyrrole‐imidazole polyamide. Cancer Sci. 2010, 101, 759-766. 19.

Matsuda, H.; Fukuda, N.; Ueno, T.; Tahira, Y.; Ayame, H.; Zhang, W.; Bando, T.;

Sugiyama, H.; Saito, S.; Matsumoto, K. Development of gene silencing pyrrole-imidazole polyamide targeting the TGF-β1 promoter for treatment of progressive renal diseases. J. Am. Soc. Nephrol. 2006, 17, 422-432. 20.

Yang, F.; Nickols, N. G.; Li, B. C.; Marinov, G. K.; Said, J. W.; Dervan, P. B. Antitumor

activity of a pyrrole-imidazole polyamide. Proc. Natl. Acad. Sci. U S A 2013, 110, 1863-1868. 21.

Hargrove, A. E.; Martinez, T. F.; Hare, A. A.; Kurmis, A. A.; Phillips, J. W.; Sud, S.;

Pienta, K. J.; Dervan, P. B. Tumor repression of VCaP xenografts by a pyrrole-imidazole polyamide. PloS one 2015, 10, e0143161. 22.

Yasuda, A.; Noguchi, K.; Minoshima, M.; Kashiwazaki, G.; Kanda, T.; Katayama, K.;

Mitsuhashi, J.; Bando, T.; Sugiyama, H.; Sugimoto, Y. DNA ligand designed to antagonize


23


Page 24 of 44

EBNA1 represses Epstein-Barr virus-induced immortalization. Cancer Sci. 2011, 102, 22212230. 23.

Reddy, B. P.; Sondhi, S. M.; Lown, J. W. Synthetic DNA minor groove-binding drugs.

Pharmacol. Ther. 1999, 84, 1-111. 24.

Baraldi, P. G.; Bovero, A.; Fruttarolo, F.; Preti, D.; Tabrizi, M. A.; Pavani, M. G.;

Romagnoli, R. DNA minor groove binders as potential antitumor and antimicrobial agents. Med. Res. Rev. 2004, 24, 475-528. 25.

Minehan, T. G.; Gottwald, K.; Dervan, P. B. Molecular recognition of DNA by Hoechst

benzimidazoles: Exploring beyond the pyrrole-imidazole-hydroxypyrrole polyamide-pairing code. Helv. Chim. Acta 2000, 83, 2197-2213. 26.

Reddy, P. M.; Dexter, R.; Bruice, T. C. DNA sequence recognition in the minor groove

by hairpin pyrrole polyamide-Hoechst 33258 analogue conjugate. Bioorg. Med. Chem. Lett. 2004, 14, 3803-3807. 27.

Correa, B. J.; Canzio, D.; Kahane, A. L.; Reddy, P. M.; Bruice, T. C. DNA sequence

recognition by Hoechst 33258 conjugates of hairpin pyrrole/imidazole polyamides. Bioorg. Med. Chem. Lett. 2006, 16, 3745-3750. 28.

Reddy, P. M.; Jindra, P. T.; Satz, A. L.; Bruice, T. C. Sequence selective recognition in

the minor groove of dsDNA by pyrrole, imidazole-substituted bis-benzimidazole conjugates. J. Am. Chem. Soc. 2003, 125, 7843-7848. 29.

Liu, K.; Fang, L.; Sun, H.; Pan, Z.; Zhang, J.; Chen, J.; Shao, X.; Wang, W.; Tan, Y.;

Ding, Z.; Ao, L.; Wu, C.; Liu, X.; Li, H.; Wang, R.; Su, W.; Li, H. Targeting polo-like kinase 1


24

Page 25 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


by a novel pyrrole-imidazole polyamide-Hoechst conjugate suppresses tumor growth in vivo. Mol. Cancer Ther. 2018, 17, 988-1002. 30.

Lieberman, P. M. Chromatin structure of Epstein-Barr virus latent episomes. In Epstein

Barr Virus, Vol 1: One Herpes Virus: Many Diseases; Munz, C., Ed.; Springer: Switzerland, 2015; pp 71-102. 31.

Sugden, B.; Warren, N. A promoter of Epstein-Barr virus that can function during latent

infection can be transactivated by EBNA-1, a viral protein required for viral DNA replication during latent infection. J. Virol. 1989, 63, 2644-2649. 32.

Gahn, T. A.; Sugden, B. An EBNA-1-dependent enhancer acts from a distance of 10

kilobase pairs to increase expression of the Epstein-Barr virus LMP gene. J. Virol. 1995, 69, 2633-2636. 33.

Erwin, G. S.; Grieshop, M. P.; Bhimsaria, D.; Do, T. J.; Rodriguez-Martinez, J. A.;

Mehta, C.; Khanna, K.; Swanson, S. A.; Stewart, R.; Thomson, J. A.; Ramanathan, P.; Ansari, A. Z. Synthetic genome readers target clustered binding sites across diverse chromatin states. Proc Natl Acad Sci U S A 2016, 113, E7418-E7427. 34.

Kanda, T.; Otter, M.; Wahl, G. M. Coupling of mitotic chromosome tethering and

replication competence in epstein-barr virus-based plasmids. Mol. Cell. Biol. 2001, 21, 35763588. 35.

Kapoor, P.; Frappier, L. EBNA1 partitions Epstein-Barr virus plasmids in yeast cells by

attaching to human EBNA1-binding protein 2 on mitotic chromosomes. J. Virol. 2003, 77, 69466956.


25


36.

Page 26 of 44

Kapoor, P.; Lavoie, B. D.; Frappier, L. EBP2 plays a key role in Epstein-Barr virus

mitotic segregation and is regulated by aurora family kinases. Mol. Cell. Biol. 2005, 25, 49344945. 37.

Chiang, S. Y.; Burli, R. W.; Benz, C. C.; Gawron, L.; Scott, G. K.; Dervan, P. B.;

Beerman, T. A. Targeting the ets binding site of the HER2/neu promoter with pyrrole-imidazole polyamides. J. Biol. Chem. 2000, 275, 24246-24254. 38.

White, C. M.; Satz, A. L.; Bruice, T. C.; Beerman, T. A. Inhibition of transcription

factor-DNA complexes and gene expression by a microgonotropen. Proc. Natl. Acad. Sci. U S A 2001, 98, 10590-10595. 39.

Satz, A. L.; Bruice, T. C. Recognition in the minor groove of double-stranded DNA by

microgonotropens. Acc. Chem. Res. 2002, 35, 86-95. 40.

Li, N.; Thompson, S.; Schultz, D. C.; Zhu, W.; Jiang, H.; Luo, C.; Lieberman, P. M.

Discovery of selective inhibitors against EBNA1 via high throughput in silico virtual screening. PloS one 2010, 5, e10126. 41.

Sun, X.; Barlow, E. A.; Ma, S.; Hagemeier, S. R.; Duellman, S. J.; Burgess, R. R.;

Tellam, J.; Khanna, R.; Kenney, S. C. Hsp90 inhibitors block outgrowth of EBV-infected malignant cells in vitro and in vivo through an EBNA1-dependent mechanism. Proc. Natl. Acad. Sci. U S A 2010, 107, 3146-3151. 42.

Kang, M.-S.; Lee, E. K.; Soni, V.; Lewis, T. A.; Koehler, A. N.; Srinivasan, V.; Kieff, E.

Roscovitine inhibits EBNA1 serine 393 phosphorylation, nuclear localization, transcription, and episome maintenance. J. Virol. 2011, 85, 2859-2868.


26

Page 27 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


43.

Ott, E.; Norio, P.; Ritzi, M.; Schildkraut, C.; Schepers, A. The dyad symmetry element of

Epstein-Barr virus is a dominant but dispensable replication origin. PloS one 2011, 6, e18609. 44.

Kirchmaier, A. L.; Sugden, B. Rep*: a viral element that can partially replace the origin

of plasmid DNA synthesis of Epstein-Barr virus. J. Virol. 1998, 72, 4657-4666. 45.

Katano, H.; Pesnicak, L.; Cohen, J. I. Simvastatin induces apoptosis of Epstein-Barr virus

(EBV)-transformed lymphoblastoid cell lines and delays development of EBV lymphomas. Proc. Natl. Acad. Sci. U S A 2004, 101, 4960-4965. 46.

Wang, P.; Rennekamp, A. J.; Yuan, Y.; Lieberman, P. M. Topoisomerase I and RecQL1

function in Epstein-Barr virus lytic reactivation. J. Virol. 2009, 83, 8090-8098. 47.

Miyake, A.; Dewan, M. Z.; Ishida, T.; Watanabe, M.; Honda, M.; Sata, T.; Yamamoto,

N.; Umezawa, K.; Watanabe, T.; Horie, R. Induction of apoptosis in Epstein-Barr virus-infected B-lymphocytes by the NF-κB inhibitor DHMEQ. Microb. Infect. 2008, 10, 748-756. 48.

Su, W.; Gray, S. J.; Dondi, R.; Burley, G. A. Highly efficient synthesis of DNA-binding

hairpin polyamides via the use of a new triphosgene coupling strategy. Org. Lett. 2009, 11, 39103913. 49.

Fang, L.; Yao, G.; Pan, Z.; Wu, C.; Wang, H.-S.; Burley, G. A.; Su, W. Fully automated

synthesis of DNA-binding Py-Im polyamides using a triphosgene coupling strategy. Org. Lett. 2014, 17, 158-161.


27


Page 28 of 44

Figure 1. Diagram of design and structure of polyamides. (A) Schematic diagram of OriP region targeted by polyamides. EBV OriP containing family repeats (FR) and dyad symmetry (DS) is shown in the diagram. Compound 2 is expected to bind to the designated location, which is illustrated in the boxes. (B) Chemical structure and ball-stick model of polyamides. Nmethylpyrrole rings (Py) are indicated in blue and the N-methylimidazole ring (Im) in red. Hoechst groups are indicated in green. In ball-stick model, white balls refer to Py rings, and the black balls refer to Im rings. The curves with a tail refer to γ-aminobutyric acid. The fold lines with a cross refer to dimethylaminopropylamide. The gray ellipses refer to conjugated Hoechst.


28

Page 29 of 44


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


29


Page 30 of 44

Figure 2. EBNA1-binding inhibition in vitro of polyamides monitored by surface plasmon resonance (SPR). (A)Binding model of polyamides with EBNA1 binding sites. Polyamides are expected to bind to biotin-labeled hairpin DNA sequences of EBNA1 binding Site 1, 2 and their mutant sequences at indicated location. The mismatched base pairs were colored in red or blue for mutant sequences or 3, respectively. (B) The inhibiting level to EBNA1 binding of 1. A gradient concentration of 1 passed through the DNA-immobilized chip surface at 25µl/min for 4 min without any disassociation, and 100nM EBNA1 solution was injected subsequently for 3 min. The EBNA1 binding process was illustrated in the figure. (C) The inhibiting level to EBNA1 binding of 2. The assay was performed as B. (D) The inhibiting level to EBNA1 binding of 3. The assay was performed as B.


30

Page 31 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Proliferation inhibition of polyamides to EBV-positive cells. (A) Cells were seeded 5×105 originally in a 6-well plate and treated with or without 10µM 1 or 2. Medium was refreshed every 3 days. At day 3 and day 6, living cells were counted by a 0.4% trypan blue dye assay. (B) To further test the growth inhibition to different cell lines by 2, both EBV-positive and EBV-negative cells were treated by indicated concentration of 2. Survival ratio of cells were calculated via an MTT assay. All of the statistics significances were calculated by one-way ANOVA. **: P < 0.01


31


Page 32 of 44

Figure 4. Effects of polyamides on EBNA1 functions in EBV-positive cells. (A) Raji cells were treated by 10µM 1, 10µM 2 or 10µM 3. Cells were collected every day and total DNA was harvested to perform a quantitative real-time PCR of EBV copy number. Two different EBVpositive cell lines, Daudi and B95-8 were also treated with 10µM 2 to detect the effect on viral copy number. For Raji and Daudi, primers of OriP and human GAPDH gene were used to determine the amount of viral episome and the cellular DNA, respectively. For B95-8, primers of OriP and 18s rRNA gene was used. Statistics significance was calculated by one-way ANOVA. **: P < 0.01 (B) Effect of polyamides on EBNA1-OriP interaction in cells. Raji cells were treated by 10µM 1 or 10µM 2 for 0, 24 or 48h and a ChIP assay was performed with EBNA1 antibody or normal mouse IgG to detect the interaction of EBNA1 protein and OriP sequence. EBNA1-binding DNAs were immunoprecipitated and detected by quantitative real-time PCR using OriP primers. Ratio of ChIP product to 2% input sample is shown in the figure. Statistics


32

Page 33 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


significance was calculated by one-way ANOVA. **: P < 0.01 (C) Raji cells were treated with a group of concentration of 1 or 2 for 24h. Total proteins were extracted and the expression level of EBNA1 and EBNA2 was detected by western blotting. GAPDH is used as internal control.


33


Page 34 of 44

Figure 5. Compound 2 inhibits EBV-positive tumor and EBNA1 functions in vivo. 1×107 Raji cells were subcutaneously injected at the left flank of every Balb/c nude mouse. When tumor size reached about 50mm3 (1/2 × L × W2), various amounts of 2 were injected subcutaneously near the tumor every 3 days. (A) Size of the tumors were recorded every 3 days before 2 injection. (B) Mice weight were recorded before every injection. (C) After all the injection finished, mice were sacrificed and the tumors were peeled. (D) The mass of each tumor was weighed and illustrated. (E) Small pieces of tumor were homogenized for total DNA extraction. DNA was later


34

Page 35 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


processed to perform a real-time PCR to determine the relative EBV copy number. All of the statistics significances were calculated by one-way ANOVA. *: P < 0.05 **: P < 0.01


35


Site 1 KD(M)

Site 1 mutant

specificity

KD(M)

specificity

Page 36 of 44

Site 2 KD(M)

Site 2 mutant

specificity

KD(M)

specificity

1

1.50×10-9

1

2.52×10-8

0.060

4.52×10-9

1

2.06×10-8

0.219

2

2.28×10-8

1

7.47×10-7

0.030

1.29×10-8

1

1.87×10-7

0.069

3

3.35×10-7

0.068

2.63×10-7

0.049

Table 1. Polyamides binding affinity to DS. The specificity value is calculated by dividing the KD of matched polyamide-DNA pairs by KD of mismatched pairs (mutant DNA sequences or untargeted PIP). For matched pairs itself, the specificity is 1.


36

Page 37 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Relative RU rise reduction Polyamides (200nM) EBNA1 binding site 1

EBNA1 binding site 2

1

0.646

0.524

2

0.583

0.412

3

0.091

0.088

Table 2. Polyamides blocking EBNA1 binding to DS in vitro


37


Page 38 of 44

Cell line

1

2

Daudi (EBV+)

12.88 ± 1.58

4.02 ± 0.53

Raji (EBV+)

29.44 ± 3.56

8.00 ± 2.60

B95-8 (EBV+)

30.20 ± 5.42

9.42 ± 3.03

Nalm-6 (EBV-)

41.88 ± 4.77

22.18 ± 3.29

RPMI-8226(EBV-)

43.89 ± 3.24

24.50 ± 4.30

MOLT-4 (EBV-)

30.27 ± 4.01

25.00 ± 3.97

Jurkat (EBV-)

> 100

> 100

MDA-MB-231 (EBV-)

> 100

> 100

Table 3. GI50 (µM) of PIPs to different cell lines


38

Page 39 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table of Contents Graphic


39


Figure 1. Diagram of design and structure of polyamides. (A) Schematic diagram of OriP region targeted by polyamides. EBV OriP containing family repeats (FR) and dyad symmetry (DS) is shown in the diagram. Compound 2 is expected to bind to the designated location, which is illustrated in the boxes. (B) Chemical structure and ball-stick model of polyamides. N-methylpyrrole rings (Py) are indicated in blue and the Nmethylimidazole ring (Im) in red. Hoechst groups are indicated in green. In ball-stick model, white balls refer to Py rings, and the black balls refer to Im rings. The curves with a tail refer to γ-aminobutyric acid. The fold lines with a cross refer to dimethylaminopropylamide. The gray ellipses refer to conjugated Hoechst. 98x78mm (300 x 300 DPI)


Page 40 of 44

Page 41 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


EBNA1-binding inhibition in vitro of polyamides monitored by surface plasmon resonance (SPR). (A)Binding model of polyamides with EBNA1 binding sites. Polyamides are expected to bind to biotin-labeled hairpin DNA sequences of EBNA1 binding Site 1, 2 and their mutant sequences at indicated location. The mismatched base pairs were colored in red or blue for mutant sequences or 3, respectively. (B) The inhibiting level to EBNA1 binding of 1. A gradient concentration of 1 passed through the DNA-immobilized chip surface at 25µl/min for 4 min without any disassociation, and 100nM EBNA1 solution was injected subsequently for 3 min. The EBNA1 binding process was illustrated in the figure. (C) The inhibiting level to EBNA1 binding of 2. The assay was performed as B. (D) The inhibiting level to EBNA1 binding of 3. The assay was performed as B. 349x500mm (96 x 96 DPI)



Figure 3. Proliferation inhibition of polyamides to EBV-positive cells. (A) Cells were seeded 5×105 originally in a 6-well plate and treated with or without 10µM 1 or 2. Medium was refreshed every 3 days. At day 3 and day 6, living cells were counted by a 0.4% trypan blue dye assay. (B) To further test the growth inhibition to different cell lines by 2, both EBV-positive and EBV-negative cells were treated by indicated concentration of 2. Survival ratio of cells were calculated via an MTT assay. All of the statistics significances were calculated by one-way ANOVA. **: P < 0.01 329x127mm (96 x 96 DPI)


Page 42 of 44

Page 43 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Effects of polyamides on EBNA1 functions in EBV-positive cells. (A) Raji cells were treated by 10µM 1, 10µM 2 or 10µM 3. Cells were collected every day and total DNA was harvested to perform a quantitative real-time PCR of EBV copy number. Two different EBV-positive cell lines, Daudi and B95-8 were also treated with 10µM 2 to detect the effect on viral copy number. For Raji and Daudi, primers of OriP and human GAPDH gene were used to determine the amount of viral episome and the cellular DNA, respectively. For B95-8, primers of OriP and 18s rRNA gene was used. Statistics significance was calculated by one-way ANOVA. **: P < 0.01 (B) Effect of polyamides on EBNA1-OriP interaction in cells. Raji cells were treated by 10µM 1 or 10µM 2 for 0, 24 or 48h and a ChIP assay was performed with EBNA1 antibody or normal mouse IgG to detect the interaction of EBNA1 protein and OriP sequence. EBNA1-binding DNAs were immunoprecipitated and detected by quantitative real-time PCR using OriP primers. Ratio of ChIP product to 2% input sample is shown in the figure. Statistics significance was calculated by one-way ANOVA. **: P < 0.01 (C) Raji cells were treated with a group of concentration of 1 or 2 for 24h. Total proteins were extracted and the expression level of EBNA1 and EBNA2 was detected by western blotting. GAPDH is used as internal control. 356x226mm (96 x 96 DPI)



Figure 5. Compound 2 inhibits EBV-positive tumor and EBNA1 functions in vivo. 1×107 Raji cells were subcutaneously injected at the left flank of every Balb/c nude mouse. When tumor size reached about 50mm3 (1/2 × L × W2), various amounts of 2 were injected subcutaneously near the tumor every 3 days. (A) Size of the tumors were recorded every 3 days before 2 injection. (B) Mice weight were recorded before every injection. (C) After all the injection finished, mice were sacrificed and the tumors were peeled. (D) The mass of each tumor was weighed and illustrated. (E) Small pieces of tumor were homogenized for total DNA extraction. DNA was later processed to perform a real-time PCR to determine the relative EBV copy number. All of the statistics significances were calculated by one-way ANOVA. *: P < 0.05 **: P < 0.01 301x334mm (96 x 96 DPI)


Page 44 of 44

A Novel Pyrrole-Imidazole Polyamides Hoechst Conjugate

Recommend Documents