A Reversible Thermal Cycling of DNA Material for Efficient Cellulose

Subscriber access provided by Kaohsiung Medical University

Article

A Reversible Thermal Cycling of DNA Material for Efficient Cellulose Hydrolysis Xing Zhu, Jingyuan Wu, Fangwei Shao, and Xiao Matthew Hu ACS Appl. Bio Mater., Just Accepted Manuscript • DOI: 10.1021/acsabm.8b00336 • Publication Date (Web): 21 Sep 2018 Downloaded from http://pubs.acs.org on September 25, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Bio Materials

A Reversible Thermal Cycling of DNA Material for Efficient Cellulose Hydrolysis Xing Zhu,† Jingyuan Wu,‡ Fangwei Shao,*, ‡ Xiao Hu*, †,§

†

Nanyang Environment & Water Research Institute, Nanyang Technological University, 1

Cleantech Loop, CleanTech One, 637141, Singapore.

‡

Division of Chemistry & Biological Chemistry, Nanyang Technological University, 21

Nanyang Link, 637371, Singapore.

§

School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang

Avenue, 639798, Singapore.

KEYWORDS: thermal cycling method, DNA material, cellulase, cellulose hydrolysis

ABSTRACT: Enzymatic catalysis on the insoluble substrates commonly suffers from low enzyme stability, catalytic activity and product recovery. Herein, a “thermal cycling method” of DNA material is proposed to tackle the challenges in enzymatic reaction, in which a thermal

ACS Paragon Plus Environment

1

ACS Applied Bio Materials 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 25

responsive self-assembled DNA material is designed for enzyme recovery. We demonstrate the remarkable advantages of this new method in cellulosic hydrolysis. The responsive DNA material has a solution to gel transition temperature at 13 °C. Therefore, the cellulase (CEL) can be on-demand switched between mobile state, enabling high reactivity, and fixed state, facilitating CEL recovery and reuse. As a result, this system showed good catalytic activity and operational stability even at extremely high cellulose concentrations (100 mg/mL). We believe that this new strategy provides a general platform not only for enzymatic reactions but also for other bio-derived reactions.

INTRODUCTION

Enzymatic catalysis of insoluble substrates has tremendous demands from a wide range of fields, such as environmental waste treatment, biofuel regeneration and industry processing, etc.1-3 However, to realize enzymes recycling, high catalytic activity and product recovery simultaneously under the heterogeneous reaction conditions is still a significant challenge.4,5 Immobilization of enzymes on or within a substrate is one of the effective ways to recycle the enzyme and to recover the product.6-9 Up to now, four methods including adsorption, encapsulation, enzyme crosslinking and covalent binding have been reported for enzyme immobilization and each have its advantages and drawbacks.10-15 Enzyme immobilized via


2

Page 3 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


adsorption tends to easily leach out from the carrier during reaction,16,17 while covalent binding or crosslinking tends to chemically modify the enzyme structure which can adversely affect its catalytic activity.18,19 Although entrapment of enzyme into a network could mitigate the leaching problem and retain its structure and activity, it often slows down the reaction and increase the difficulty to separate the product due to the diffusion barrier of reactants and products in the gel state.20,21 These drawbacks will be further aggravated especially for solid phase catalysis such as cellulose. While repeated use of cellulase (CEL) could substantially reduce the cost of cellulosic ethanol production eventually making it a viable source of renewable energy.22-24 However, one of the key challenges is that CEL system contains three different enzymes, i.e., endo-glucanase (EG, EC 3.2.1.4), cellobiohydrolase (CBH, EC 3.2.1.91), and β-glucosidase (BG, EC 3.2.1.21).25 It is difficult to find effective method to immobilize all three enzymes simultaneously to allow high activity and good reusability. Kudina et al.4 adsorbed CEL onto magnetic nanoparticles grafted with long poly(acrylic acid) brushes. There are some clear advantages of using a polymer brushes which enhanced cellulose-enzyme contact. However, the catalytic efficiency is still much lower than free CEL and the operation stability is not ideal due to the weak adsorption forces between CEL and polymer brushes. Xu et al.5 immobilized CEL on a modified graphene oxide composite via covalent binding. Though an apparent improvement on the enzymatic stability was observed in 25% IL, the loss of CEL activity over repeat usage is still too significant. While gel entrapment are readily to circumvent the leakage and maintain the cooperative activity of multiple enzymes, conventional gel entrapment of CEL is unfortunately


3


Page 4 of 25

ineffective in this case, as the gel would separate the insoluble cellulose from the enzymes. Therefore, new strategies for enzyme recycling are needed to bridge the existing gaps.

Herein, a novel enzyme reusing method namely “thermal cycling method” is proposed. A material prepared via self-assembly of well-defined DNA chains is used as a carrier for CEL recovery. The process of hydrolysing cellulose using DNA/CEL is shown in Scheme 1. At elevated temperature 55 °C, the DNA material is in a solution state, releasing the CEL into nearly free mobile state for the effective hydrolysis of the suspended cellulose. In this case, the pristine CEL retains most of its native activity and has little or no hindrance in accessing the fibrous solid reactant. After hydrolysis, the reaction mixture was cooled to 4 °C, as which the DNA is transformed to hydrogel state. The gel locks in the enzymes to ensure storage and operational stability while still allows the glucose product to be extracted.

Scheme 1. Schematic illustration of the cellulose (filter paper) hydrolysis reaction performed by the “thermal cycling method”.


4

Page 5 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RESULTS AND DISCUSSION

The DNA structures and the self-assembly process are illustrated in Figure S1. This thermally responsive DNA material serves as an excellent model system to demonstrate the concept of “thermal cycling method”. Compared with other thermally responsive synthetic polymer materials, the DNA material has many unique features including excellent compatibility with the biocatalysts,26 and near zero shrinkage or phase separation during the solution-gel transition.27-29 It is an ideal system for such investigation as the material structure and properties, e.g.,


5


Page 6 of 25

crosslinking structures, transition temperature, rheological properties, can be precisely controlled.30,31

To provide further insight into the thermally responsive behavior of CEL loaded DNA materials, we studied their temperature dependence of G’ and G’/G” ratio. As shown in Figure S1a, the storage modulus G’ decreased significantly with increasing temperature from 4 °C to 25 °C, and recovers during cooling cycle from 25 °C back to 4 °C with only a small extent of hysteresis. This phenomenon indicates that the CEL loaded DNA material responds to heat reversibly. The G’/G” ratio is also given in Figure S1a (inset), showing that the G’/G” ratio decreases with increasing temperature. The temperature at which G’/G” ratio equals to 1.0 is 13 °C and taken as the solution-gel transition temperature. Direct visualization of solution-gel transition is given in Figure S1b and S1c where the DNA material was coloured with a specific dye GelRed.32 This observed distinct solution and gel states at high and low temperatures provides the possibilities for CEL recycling via our new strategy. In addition, Figure S1d presents the SEM image of the DNA hydrogel, which can also prove that the DNA hydrogel was successfully formed via self-assembly.

Because the CEL in DNA material was in a mobile state during hydrolysis reaction, the catalytic efficiency of the CEL can be maintained at as high as 80% of that of the free enzyme (Figure S2). Separately, the specific activities of free CEL and the DNA/CEL were quantitatively compared via a cellulase assaying method, which were 125 FPU/g and 106 FPU/g at 55 °C,


6

Page 7 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


respectively. Upon releasing from DNA material under elevated temperature, the locked CEL could recover to near full activity. While most CEL in previous reports can only treat cellulose at low concentrations (typically around 10 mg/mL),

4,5

our strategy was able to substantially

increase the cellulose reactant concentration to even 100 mg/mL which is 10 times higher. As a result, with the same quantity of CEL, the total amount of glucose produced at high concentration after a 72 hour batch reaction is 57.3 mg/mL, 735% higher than the equivalent reaction carried out at lower cellulose concentration (Figure 1). The result clearly demonstrates that the DNA/CEL has the capability to produce significantly higher amount of glucose per unit time per unit concentration of CEL catalyst. Improving the cellulose concentration is significant to the industrial cellulosic ethanol production. That’s because after the hydrolyzation of cellulose into glucose, the glucose solution would be used as the carbon source for yeast fermentation. In the yeast fermentation process, the optimum concentration of glucose is around 100 mg/mL,33 which means our strategy can produce high concentration glucose to meet this standard. In addition, this strategy is not limited by the texture of cellulose substrates. The DNA/CEL can also treat other highly concentrated cellulose reactants such as microcrystalline cellulose and showed efficient production of glucose (51.0 mg/mL) (Figure S3 and S4).


7


Page 8 of 25

Figure 1. The effect of substrate concentration on the hydrolysis of filter paper. Reaction mixtures containing 10 mg/mL CEL at a fixed DNA Y-unit concentration of 1 mM and linker concentration of 1.5 mM prepared at pH=4.8, incubated at 55 °C.

Figure 2a - 2c are digital camera images of the hydrolysis reaction captured at different reaction time. The initial insoluble cellulose in the form of non-woven fabric shreds (Figure 2a) was converted into a cloudy liquid (Figure 2b) with fine cellulose suspension after only 2 hours. At this stage, the large crystalline region of the bulk cellulose was broken down smaller fibril particles. These fibrils were then further hydrolysed into soluble cellobiose and eventually glucose after 48 hours giving a clear solution (Figure 2c).


8

Page 9 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Digital camera images of the hydrolysis reaction system at (a) 0 h (b) 2h and (c) 48 h. The catalytic reaction was performed under optimum conditions (10 mg/mL CEL, 1 mM DNA Y-unit concentration, 1.5 mM DNA linker concentration, 250 rpm, 55 °C and citric acid buffer (pH 4.8)).

Another very important issue of enzymatic reactions is how to effectively separate products and recover the enzymes. In this study, the porous scaffold of DNA hydrogel was suitable to entrap the enzyme and simultaneously to allow ease of out-diffusion of the glucose product.34 Here we proposed three possible ways for CEL/glucose separation (Figure S5). The first method is direct water extraction by which the glucose is extracted out of the DNA hydrogel while CEL remains entrapped in the network (Figure S5a). The second method takes the advantage of a unique mechano-responsive behaviour of the DNA hydrogel. Due to the high water content of DNA material, water can be released from hydrogel upon applying sheer force. A centrifugal force causes a partial but uniform collapse of the hydrogel releasing the glucose containing water as a supernatant (Figure S5b). Hence a centrifugal assisted extraction process would significantly reduce the amount of water required to recover glucose. Furthermore, DNA gel is known to collapse in the presence of certain organic solvents such as ethanol (Figure S5c). We envisage that it might be possible to develop a solvent-aided separation or a combined separation method in future.


9


Page 10 of 25

Quantitative analysis showed that more than 85 % of the glucose is extracted after extraction with 60 volumes of buffer, while there is virtually no CEL loss. Via centrifugal assisted extraction, 75% of glucose is recovered upon replacing the glucose solution in hydrogel with equal volume of fresh buffer. This is not surprising because of the large molecular weight difference between glucose (180 g/mol) and the CEL (>20,000 g/mol). It should be mentioned that it is also advantageous to keep the enzymes locked in a gel network to ensure its storage and operational stability. This strategy allows the glucose extraction while keeping the enzymes fixed in the DNA network.

Figure 3 shows the comparative storage stability of enzyme in DNA material and free enzyme. The activity of free CEL decreased significantly after storage for 10 day at 4°C and only 60% of its initial activity remained after 35 days, while CEL in DNA material retains nearly 90% of its original activity after 35 days.

Figure 3. Effect of storage time on activities of free and DNA/CEL. The enzymes were stored at 4 °C. Relative activities were calculated by using the 0 day activity of free and DNA/ CEL as


10

Page 11 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


100%, respectively. CEL assays were performed in 0.2 mL sodium critic buffer (100 mM, pH = 4.8 with 12.5 mM MgCl2) under 55 °C.

One of the main aims of our strategy is to make the CEL catalysts easily reusable. Therefore, the operational stability of the DNA/ enzymes was also investigated. Figure 4a and 4b indicate high reusability of CEL at both low and high cellulose concentrations using the DNA/CEL. Figure 4a shows the operational stability of DNA/CEL under 10 mg/mL cellulose. In the first batch, the DNA/CEL can convert more than 78% of cellulose into glucose via 48 hours hydrolysis. And then after the glucose/CEL separation, the DNA/CEL was used to perform the second cycle. We found that the enzyme still remains high activity and near 70% of cellulose can be converted into the desired products. While in the third cycle, there was still 78% of its initial activity remained and only 2.5% of CEL leaked (Figure S6). More surprisingly, similar results also obtained under high concentration of cellulose (100 mg/mL) in Figure 4b. These data showed unprecedented operational stability of CEL substantially better than the best reported in literature,4, 5 even though the cellulose concentration is 10 times higher in our study.


11


Page 12 of 25

Figure 4. (a) Operational stability of the DNA/CEL during hydrolysis of 10 mg/mL filter paper. One reaction cycle corresponded to 48 h. (b) Operational stability of the DNA/CEL during hydrolysis of 100 mg/mL filter paper. One reaction cycle corresponded to 72 h. All of the catalytic reaction was performed under optimum conditions (10 mg/mL CEL, 1 mM DNA Y-unit concentration, 1.5 mM DNA linker concentration, 250 rpm, 55 °C and citric acid buffer (pH 4.8)).

So far we showed a thermal induced cyclic gel-solution transition which can achieve effective CEL catalysis, storage and product recovery. Here we summarize the key criteria to be integrally considered. (1) The carrier material should be biocompatible to ensure the bio-reactivity. (2) The solution-gel transition should be tuned to occur under mild conditions with no adverse effect on the enzymes or microorganisms. (3) A thermally responsive material with UCST is preferred


12

Page 13 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


because the loss of bio-activity (of the enzyme) is irreversible above an optimum temperature. Thus a gel state at lower temperature facilitates ease of separation and storage. (4) Volume change and phase separation should be minimized during the solution-gel transition in order to keep most of the biomolecules in the network during the solution-gel transition. (5) The material in the gel state should be sufficiently robust to allow ease of handling during recovery and storage, while the viscosity of the material in the solution state should be kept low to allow minimum interference with the bio-reaction.

In this work, the DNA material satisfies all these criteria. It serves as an excellent model system to demonstrate the new strategy. The insight and understanding obtained from this study can be used as a guide to design other bio-derived or even artificially synthesized carrier systems. In addition, other stimuli responsive systems such as photo-responsive and electro-responsive materials may also be considered.

CONCLUSION

In conclusion, a new protocol to recycle enzymes via a self-assembly thermal responsive DNA material was studied. The thermal cycling method enables CEL to catalyse cellulose hydrolysis with high-efficiency while allowing ease of glucose extraction and CEL recovery. This strategy also ensures CEL to maintain high catalytic activity and operational stability at very high reactant concentration up to 100 mg/mL producing substantially higher amount of glucose. Such high reactant concentration is unattainable using other reported immobilization methods. We


13


Page 14 of 25

believe that this strategy is universal and not limited to enzymes only but provides a platform for other bio-synthesis processes. MATERIALS AND METHODS All reagents were obtained from commercial sources and used without further purification unless otherwise stated. Cellulase from Trichoderma reesei (CEL, EC 3.2.1.4, with 50% w/w extra βglucosidase inside), filter paper and microcrystalline cellulose were provided by Sigma-Aldrich Chemical Co. GelRed was obtained from ANR Technologies Co.

The sequence of the DNA strands (5’→3’) were as follows:

Y1: CGAACTACTGGACCGATATGTACTTACGTACCTGAG;

Y2: CGAACTACCTCAGGTACGTAAGATCATCTACAGCCT;

Y3: CGAACTACAGGCTGTAGATGATTACATATCGGTCCA;

L1: GTAGTTCGTACGCATGAAGACTACATTCACCGTAAG;

L2: GTAGTTCGCTTACGGTGAATGTAGTCTTCATGCGTA.

All of the DNA strands were synthesized by a DNA synthesizer (Mermade 4 from BioAutomation) and then HPLC (LC-20A from Shimadzu) purified. The purified Y1, Y2, Y3, L1 and L2 were mixed with molar ratio Y-scaffold/linker = 1:1.5 in 100 mM citric acid buffer


14

Page 15 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(pH=4.8 with 12.5 mM MgCl2), and then the mixture was heated to 95°C for 5 min and cooled to 4 ℃ in 2 hours to form the designed DNA structure.

Rheological Tests: Rheological tests were carried out on Discovery hybrid rheometer (DHR-3 from TA Instruments) equipped with a temperature controller. Temperature-ramp tests were performed at a fixed frequency and strain of 1 Hz and 1%, respectively.

Cellulase Assay: The activity of free CEL and DNA/CEL were determined according to the method from the Commission on Biotechnology of the International Union of Pure and Applied Chemistry (IUPAC).35 One unit of filter paper CEL (FPU) was defined as the amount of CEL which produced 2.0 mg glucose from filter paper within 60 minutes. The experiment to detect the activity of free CEL was carried out in a reaction mixture containing 2 mg CEL and 10.0 mg filter paper in 0.2 mL sodium critic buffer (100 mM, pH = 4.8 with 12.5 mM MgCl2). The mixture was incubated at 55 °C for 60 min. The experiment to detect the activity of DNA/CEL was carried out in a reaction mixture containing 2 mg CEL, 1.0 mM DNA Y unit, 1.5 mM DNA linker and 10.0 mg filter paper in 0.2 mL sodium critic buffer (100 mM, pH = 4.8 with 12.5 mM MgCl2). The mixture was incubated at 55 °C for 60 min. The amount of glucose produced was determined by using a biosensor (SBA-40D from Biology Institute of Shandong Academy of Sciences) to detect the concentration of glucose in the solution.

Catalytic reaction performed by the DNA/ CEL: Firstly, the designed DNA nanostructure was heated to 55 °C and then certain amount of CEL were added and dissolved into the DNA


15


Page 16 of 25

solution. Secondly, a certain amount of cellulose (filter paper or microcrystalline cellulose) was added into the DNA solution. The mixture was then stirred at 250 rpm and 55 °C for 48 to 72 h. After the hydrolysis reaction, the unreacted insoluble cellulose was removed by using a centrifuge. The supernatant was then translated into gel state by decreasing the temperature to 4 °C. After washing the DNA material with buffer at 4 °C, the locked CEL can be “released” again at 55 °C for another cycle of hydrolysis.

Detection of Enzyme and Glucose released from the DNA material: Bradford’s method was used to detect the ratio of enzymes released from the DNA material. Full details about this procedure were described elsewhere.36 CEL solutions were used as a standard to construct the calibration curve in our work. After immersing the CEL loaded DNA material into a fixed amount of 100 mM citric acid buffer (pH=4.8 with 12.5 mM MgCl2) at 4 °C for 30 mins, the buffer was collected to determine the released amount of enzymes. The washing buffer was measured by monitoring its absorbance at 595 nm using an UV−vis spectrophotometer. The concentration of enzymes in the buffer solution was obtained from a calibration curve. The ratio of enzyme released, Mcr/Mc, could then be calculated. Here, Mc is the amount of initially added enzymes. Mcr is the amount of enzymes in the washing buffer.

The conversion rate of cellulose can be determined by using the SBA-40D biosensor to detect the concentration of glucose in the DNA solution. The amount of glucose converted Mg can be obtained directly from the DNA solution sample. After immersing the CEL loaded DNA material


16

Page 17 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


with a fixed amount of 100 mM citric acid buffer (pH=4.8 with 12.5 mM MgCl2) at 4 °C for 30 mins, all of the washing buffer were collected to determine the amount of glucose released Mgr from the DNA material. The ratio of glucose released, Mgr/Mg, could then be calculated.

Glucose/CEL separation by using the mechanical method: After the hydrolysis reaction, the CEL loaded DNA material was moved into a centrifugal filter tube (MWCO 10 kDa). The tube was centrifuged at 4 °C for 20 min (14000 r/min), and then the released buffer (Vr) can be collected. The releasing amount of glucose and CEL were detected, respectively. Meanwhile, the centrifuged gel was heated to 55 °C followed by adding a certain amount of fresh buffer (Vr) into the solvent. The DNA solution was cooled to 4 °C again and then the tube was centrifuged for another cycle. After 5 cycles of centrifugation, the total amount of released glucose and CEL were calculated to detect the efficiency of the separation.

Glucose/CEL separation by using the solvent-aided method: After the hydrolysis reaction, a certain amount of cooled ethanol was added at 4 °C. The DNA material was then slowly collapsed into a denser state releasing some amount of buffer.

Supporting Information The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsabm.XXXXXX.


17


Page 18 of 25

Structure, rheology and morphology characterizations for CEL loaded DNA material in Figure S1, catalytic efficiencies of CEL loaded DNA material in Figure S2-S4, and three possible ways for CEL/glucose separation in Figure S5 (PDF) AUTHOR INFORMATION Corresponding Author E-mail: [email protected] (X. H.)

E-mail: [email protected] (F. S.)

Notes The authors declare no competing financial interest. ACKNOWLEDGMENT: This work was supported by grant from Economy Development Board (NEWRI-ECMC-RCFS) and partially supported by a grant from the Ministry of Education Academic Research Fund Tier 1 (M4011554). REFERENCES

(1) Lynd, L. R., The Grand Challenge of Cellulosic Biofuels. Nat Biotechnol. 2017, 35, 912915.

(2) Ravindran, R.; Jaiswal, A. K., Exploitation of Food Industry Waste for High-Value Products. Trends Biotechnol. 2016, 34 (1), 58-69.


18

Page 19 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(3) Xie, S.; Sun, Q.; Pu, Y.; Lin, F.; Sun, S.; Wang, X.; Ragauskas, A. J.; Yuan, J. S., Advanced Chemical Design for Efficient Lignin Bioconversion. ACS. Sustain. Chem. Eng. 2017, 5, 2215-2223.

(4) Kudina, O.; Zakharchenko, A.; Trotsenko, O.; Tokarev, A.; Ionov, L.; Stoychev, G.; Puretskiy, N.; Pryor, S. W.; Voronov, A.; Minko, S., Highly Efficient Phase Boundary Biocatalysis with Enzymogel Nanoparticles. Angew Chem Int Ed. 2014, 53, 483-487.

(5) Xu, J.; Sheng, Z.; Wang, X.; Liu, X.; Xia, J.; Xiong, P.; He, B., Enhancement in Ionic Liquid Tolerance of Cellulase Immobilized on PEGylated Graphene Oxide Nanosheets: Application in Saccharification of Lignocellulose. Bioresour Technol. 2016, 200, 1060-1064.

(6) Feng, D.; Liu, T. F.; Su, J.; Bosch, M.; Wei, Z.; Wan, W.; Yuan, D.; Chen, Y.-P.; Wang, X.; Wang, K.; Lian, X.; Gu, Z.-Y.; Park, J.; Zou, X.; Zhou, H.-C., Stable Metal-organic Frameworks Containing Single-molecule Traps for Enzyme Encapsulation. Nat Commun. 2015, 6, 5979-5986.

(7) Küchler, A.; Yoshimoto, M.; Luginbühl, S.; Mavelli, F.; Walde, P., Enzymatic Reactions in Confined Environments. Nat Nanotechnol. 2016, 11, 409-420.

(8) Sun, Q.; Fu, C.-W.; Aguila, B.; Perman, J.; Wang, S.; Huang, H.-Y.; Xiao, F.-S.; Ma, S., Pore Environment Control and Enhanced Performance of Enzymes Infiltrated in Covalent Organic Frameworks. J. Am. Chem. Soc. 2018, 140, 984-992.


19


Page 20 of 25

(9) Kandambeth, S.; Venkatesh, V.; Shinde, D. B.; Kumari, S.; Halder, A.; Verma, S.; Banerjee, R., Self-templated Chemically Stable Hollow Spherical Covalent Organic Framework. Nat Commun. 2015, 6, 6786-6795.

(10) Zhao, F.; Li, H.; Jiang, Y.; Wang, X.; Mu, X., Co-immobilization of Multi-enzyme on Control-reduced Graphene Oxide by Non-covalent Bonds: an Artificial Biocatalytic System for the One-pot Production of Gluconic Acid from Starch. Green Chem. 2014, 16, 2558-2565.

(11) Sun, J.; Du, K.; Song, X.; Gao, Q.; Wu, H.; Ma, J.; Ji, P.; Feng, W., Specific Immobilization of D-amino Acid Oxidase on Hematin-functionalized Support Mimicking MultiEnzyme Catalysis. Green Chem, 2015, 17, 4465-4472.

(12) Patel, S. K. S.; Choi, S. H.; Kang, Y. C.; Lee, J.-K., Eco-Friendly Composite of Fe3O4Reduced Graphene Oxide Particles for Efficient Enzyme Immobilization. ACS Appl Mater Inter. 2017, 9, 2213-2222.

(13) Luckarift, H. R.; Spain, J. C.; Naik, R. R.; Stone, M. O., Enzyme Immobilization in a Biomimetic Silica Support. Nat Biotechnol. 2004, 22, 211-213.

(14) Badieyan, S.; Wang, Q.; Zou, X.; Li, Y.; Herron, M.; Abbott, N. L.; Chen, Z.; Marsh, E. N. G., Engineered Surface-Immobilized Enzyme that Retains High Levels of Catalytic Activity in Air. J. Am. Chem. Soc. 2017, 139 (8), 2872-2875.


20

Page 21 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(15) Palla, K. S.; Hurlburt, T. J.; Buyanin, A. M.; Somorjai, G. A.; Francis, M. B., SiteSelective Oxidative Coupling Reactions for the Attachment of Enzymes to Glass Surfaces through DNA-Directed Immobilization. J. Am. Chem. Soc. 2017, 139 (5), 1967-1974.

(16) Jesionowski, T.; Zdarta, J.; Krajewska, B., Enzyme Immobilization by Adsorption: a Review. Adsorption. 2014, 20, 801-821.

(17) Zhou, Z.; Hartmann, M., Progress in Enzyme Immobilization in Ordered Mesoporous Materials and Related Applications. Chem Soc Rev. 2013, 42, 3894-3912.

(18) Lian, X.; Fang, Y.; Joseph, E.; Wang, Q.; Li, J.; Banerjee, S.; Lollar, C.; Wang, X.; Zhou, H.-C., Enzyme-MOF (Metal-Organic Framework) Composites. Chem Soc Rev. 2017, 46, 33863401.

(19) Rodrigues, R. C.; Ortiz, C.; Berenguer-Murcia, A.; Torres, R.; Fernandez-Lafuente, R., Modifying Enzyme Activity and Selectivity by Immobilization. Chem Soc Rev. 2013, 42, 62906307.

(20) Cui, J.; Feng, Y.; Lin, T.; Tan, Z.; Zhong, C.; Jia, S., Mesoporous Metal–Organic Framework with Well-Defined Cruciate Flower-Like Morphology for Enzyme Immobilization. ACS Appl Mater Inter. 2017, 9, 10587-10594.


21


Page 22 of 25

(21) Li, P.; Moon, S.-Y.; Guelta, M. A.; Harvey, S. P.; Hupp, J. T.; Farha, O. K., Encapsulation of a Nerve Agent Detoxifying Enzyme by a Mesoporous Zirconium Metal–Organic Framework Engenders Thermal and Long-Term Stability. J. Am. Chem. Soc. 2016, 138, 8052-8055.

(22) Tuck, C. O.; Pérez, E.; Horváth, I. T.; Sheldon, R. A.; Poliakoff, M., Valorization of Biomass: Deriving More Value from Waste. Science. 2012, 337, 695-699.

(23) Sheridan, C., Big Oil Turns on Biofuels. Nat Biotechnol. 2013, 31, 870-873.

(24) Fairley, P., Introduction: Next Generation Biofuels. Nature. 2011, 474, S2-S5.

(25) Guo, H.; Zou, S.; Liu, B.; Su, R.; Huang, R.; Qi, W.; Zhang, M.; He, Z., Reducing βGlucosidase Supplementation During Cellulase Recovery using Engineered Strain for Successive Lignocellulose Bioconversion. Bioresour Technol. 2015, 187, 362-368.

(26) Lilienthal, S.; Shpilt, Z.; Wang, F.; Orbach, R.; Willner, I., Programmed DNAzymeTriggered Dissolution of DNA-Based Hydrogels: Means for Controlled Release of Biocatalysts and for the Activation of Enzyme Cascades. ACS Appl Mater Inter. 2015, 7, 8923-8931.

(27) Xing, Y.; Cheng, E.; Yang, Y.; Chen, P.; Zhang, T.; Sun, Y.; Yang, Z.; Liu, D., SelfAssembled DNA Hydrogels with Designable Thermal and Enzymatic Responsiveness. Adv Mater. 2011, 23, 1117-1121.

(28) Cheng, E.; Xing, Y.; Chen, P.; Yang, Y.; Sun, Y.; Zhou, D.; Xu, L.; Fan, Q.; Liu, D., A pH-Triggered, Fast-Responding DNA Hydrogel. Angew Chem. 2009, 121, 7796-7799.


22

Page 23 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(29) Ren, J.; Hu, Y.; Lu, C.-H.; Guo, W.; Aleman-Garcia, M. A.; Ricci, F.; Willner, I., pHResponsive and Switchable Triplex-based DNA hydrogels. Chem Sci. 2015, 6, 4190-4195.

(30) Um, S. H.; Lee, J. B.; Park, N.; Kwon, S. Y.; Umbach, C. C.; Luo, D., Enzyme-catalysed Assembly of DNA Hydrogel. Nat Mater. 2006, 5, 797-801.

(31) Lee, J. B.; Peng, S.; Yang, D.; Roh, Y. H.; Funabashi, H.; Park, N.; Rice, E. J.; Chen, L.; Long, R.; Wu, M.; Luo, D., A Mechanical Metamaterial Made from a DNA Hydrogel. Nat Nanotechnol. 2012, 7, 816-820.

(32) Black, K. C. L.; Ibricevic, A.; Gunsten, S. P.; Flores, J. A.; Gustafson, T. P.; Raymond, J. E.; Samarajeewa, S.; Shrestha, R.; Felder, S. E.; Cai, T.; Shen, Y.; Löbs, A.-K.; Zhegalova, N.; Sultan, D. H.; Berezin, M.; Wooley, K. L.; Liu, Y.; Brody, S. L., In Vivo Fate Tracking of Degradable Nanoparticles for Lung Gene Transfer Using PET and Ĉerenkov Imaging. Biomaterials. 2016, 98, 53-63.

(33) Yan, L.; Shuzo, T., Ethanol Fermentation from Biomass Resources: Current State and Prospects. Appl Microbiol Biotechnol. 2006, 69, 627–642.

(34) Van Nguyen, K.; Minteer, S. D., Investigating DNA Hydrogels as a New Biomaterial for Enzyme Immobilization in Biobatteries. Chem Commun, 2015, 51, 13071-13073.

(35) Ghose, T.K., Measurement of Cellulase Activities. Pure Appl. Chem. 1987, 59, 257-268.


23


Page 24 of 25

(36) Bradford, M.M., A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-dye Binding. Anal. Biochem. 1976, 72, 248−254.


24

Page 25 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC Graphic


25

A Reversible Thermal Cycling of DNA Material for Efficient Cellulose

Recommend Documents