A Smart, Photocontrollable Drug Release Nanosystem for

Subscriber access provided by University of Colorado Boulder

Article

A Smart, Photocontrollable Drug Release Nanosystem for Multifunctional Synergistic Cancer Therapy Yi Yi, Huijing Wang, Xue-Wei Wang, Qiaoling Liu, Mao Ye, and Weihong Tan ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.6b15414 • Publication Date (Web): 26 Jan 2017 Downloaded from http://pubs.acs.org on January 28, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

A Smart, Photocontrollable Drug Release Nanosystem for Multifunctional Synergistic Cancer Therapy

Yi Yi1, Huijing Wang1, Xuewei Wang1, Qiaoling Liu1*, Mao Ye1*, and Weihong Tan1,2

1

Molecular Science and Biomedicine Laboratory, College of Biology, State Key Laboratory for Chemo/Bio-Sensing and Chemometrics, College of Chemistry and Chemical Engineering and Collaborative Research Center of Molecular Engineering for Theranostics, Hunan University, Changsha 410082, China

2

Department of Chemistry, Department of Physiology and Functional Genomics, Center for Research at Bio/Nano Interface, Shands Cancer Center, University of Florida Genetics Institute and McKnight Brain Institute, University of Florida, Gainesville, FL 32611-7200, USA

*Authors for correspondence:

Dr. Qiaoling Liu: [email protected]

Prof. Mao Ye: [email protected]

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 32

KEY WORDS: Multimodal therapy, Drug release, Photothermal therapy, Photodynamic therapy, Gold nanorod, Aptamer

ABSTRACT: Multifunctional synergistic therapy holds promise in biomedical studies and clinical practice. However, strategies aimed at easily integrating the components of such multimodal therapies are needed. Therefore, we herein report a smart drug release nanosystem able to perform photodynamic therapy, photothermal therapy and chemotherapy in a photocontrollable manner. Doxorubicin (DOX), a chemotherapy drug, and 5, 10, 15, 20-tetrakis (1-methylpyridinium-4-yl) porphyrin (TMPyP4), a photosensitizer, were physically intercalated into a DNA assembly immobilized on gold nanorods. The drugs were efficiently delivered to target cells and released under light irradiation, resulting in a synergism that combined phototherapy and chemotherapy for cancer treatment. This smart, photocontrollable drug release nanosystem promises precisely controlled drug release for multifunctional synergistic cancer therapy.


2

Page 3 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION

As a result of cancer heterogeneity, the synergistic combination of chemotherapy and other therapies would be an optimized design for cancer treatment.1-4 Photothermal therapy (PTT) and photodynamic therapy (PDT) are light-activated therapies that destroy cells through hyperthermia or reactive oxygen species (ROS), respectively. Based on their noninvasive characteristic, both PTT and PDT have been widely utilized in multimodal therapy.5 However, the design and engineering of such efficient multifunctional system for multifunctional cancer therapy remain to be addressed.6, 7

Recently, a gold nanorod-based PTT was developed owing to the excellent photothermal conversion ability of gold nanorods (AuNRs) upon light irradiation.8-10 However, the true construction of a gold nanorod-based nanosystem with multifunctional capability is still challenged by shape change and self-assembly based aggregation associated with functionalization11-13 and complicated modification and complex construction.14

DNA is inherently biocompatible and can be assembled into various predictable nanostructures utilized to develop smart drug delivery nanosystems.15 Currently, DNA-conjugated gold nanorod multimodal therapeutic nanosystems serve as model photo-heat conversion agents for PTT.16,

17

In these nanosystems, drugs or

oligonucleotides are released from the gold nanorod as a result of light irradiation, indicating the potential application of DNA-conjugated gold nanorods in


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 32

photocontrollable multidrug delivery systems.18, 19 To endow the gold nanorod-based nanosystems with multiple functionalities in cancer treatment, one strategy would integrate the DNA assembly into a gold nanorod-based nanosystem. Especially, the integration of functional DNA, such as aptamer molecules, would afford this nanosystem with extra target recognition functionality, a key requirement for achieving synergistic effect and, ultimately, effective cancer therapy.

In this study, we constructed a multifunctional drug delivery nanosystem able to perform photodynamic therapy, photothermal therapy and chemotherapy with photo-responsive capability. DNA was self-assembled onto the surface of gold nanorods to provide the binding sites for loading Doxorubicin (DOX), a widely used anticancer drug which can preferentially bind to double-stranded GC or CG sequences,20 and TMPyP4 [5, 10, 15, 20-tetrakis (1-methylpyridinium-4-yl) porphyrin], a photosensitizer, which can intercalate into G-quadruplex.21 Under light irradiation, drugs were released and activated, thus providing a photocontrollable multifunctional nanosystem with enhanced synergistic effect for cancer therapy. Good biocompatibility, stability, and facile construction endow this DNA drug delivery assembly with promising potential for numerous cancer-related biomedical applications.

RESULTS AND DISCUSSION

Preparation of drug-loaded DNA duplex-modified AuNRs. The strategy used to construct the nanosystem was illustrated in Figure 1A. Gold nanorods (AuNRs)


4

Page 5 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


were prepared according to a seed-mediated protocol.22 The claret-red clear solution of gold nanorods was obtained after overnight incubation at 30 °C. The UV-vis absorption spectrum showed that the longitudinal plasmon resonance absorption of the AuNRs was centered at 810 nm (Figure 1B). The transmission electron microscopy (TEM) image (Figure 1B, insert) showed that the naked AuNRs have an average length and width of 68 ± 3.46 nm and 17 ± 1.88 nm (the aspect ratio is about 4:1), respectively. The photo-heat conversion efficiency of AuNRs was assessed by measuring the temperature change of AuNR solution, water and DPBS after different power of 808 nm laser irradiation, respectively. The increased temperature of AuNR solution confirmed good photothermal conversion ability, and the intact morphology of AuNRs showed equally good stability under light irradiation (see Figure S1 in the Supporting Information (SI)).

In our design, thiol group-modified DNA (hereinafter SH-capture strand) was first immobilized on the surface of AuNRs via Au-S bond. The size of the naked AuNRs was about 65 nm with zeta-potential of 40 mV, while the size of AuNRs modified with DNA duplex was about 82 nm with zeta potential of -19 mV (Figure S2), indicating the successful immobilization of DNA on AuNRs. To verify the conformation of G-quadruplex, the annealed mixture of (aptamer) AS1411 complementary DNA (cDNA sequence containing AS1411) and SH-capture strand (thiol-capture strand DNA) hybridization solution was detected by circular dichroism spectropolarimetry. As shown in the circular dichroism spectrum (Figure 1C), a negative peak at 245 nm and a positive peak at 270 nm indicated the formation of


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 32

G-quadruplex conformation. Herein, the G-quadruplex conformation provides the binding sites for TMPyP4, and the double-strand DNA (dsDNA) provides the binding sites for DOX. Thus, by a simple noncovalent binding between drugs and DNA immobilized on AuNRs, drugs could be easily loaded to the AuNRs-based nanosystem. Moreover, AS1411, the G-rich DNA aptamer, which recognizes and specifically binds to nucleolin,23,

24

can help to achieve an enhanced synergistic

therapy effect by specific recognition of overexpressed nucleolin on cancer cells.

Figure 1. Design and characterization of the nanosystem. (A) Schematic drawing illustrates the assembly process of the drug-loading nanosystem. (B) UV-vis absorption spectra of CTAB-coated gold nanorod (black line), dsDNA-functionalized gold nanorod (red line), drug-loading dsDNA-functionalized gold nanorod (blue line), and free TMPyP4 (green line). Inset: TEM image of gold nanorod (scale bar: 100 nm). (C) Circular dichroism spectrum of G-quadruplex formed by AS1411 cDNA; the concentration of DNA was 2 µM.


6

Page 7 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


To study drug loading efficiency, we used a UV-vis spectrophotometer and a fluorescence spectrophotometer to quantify the loaded drugs. To confirm the binding number between TMPyP4 and G-quadruplex, we performed a titration curve of different molar concentration of G-quadruplex from 0 µM to 2 µM in the presence of 7 µM TMPyP4.25 As shown in Figure 2A, the UV-vis absorption spectra of TMPyP4 showed an absorption band at 422 nm. With the addition of the annealed AS1411 cDNA, the absorbance of TMPyP4 was decreased, and the peak position was red-shifted to 435 nm. The hypochromicity of the Soret band showed the interaction between TMPyP4 and G-quadruplex of AS1411 cDNA. Once free TMPyP4 was fully loaded to AS1411 cDNA, no obvious change of the Soret band could be detected, even though more AS1411 cDNA had been added. Thus, we estimated the binding number of TMPyP4 per AS1411 aptamer was 3 according to the spectral shifts. To confirm the binding number between DOX and DNA duplex, we detected the fluorescence spectra of DOX (6 µM) incubated with different amount of DNA duplex from 0 µM to 1 µM.26 As shown in Figure 2B, the fluorescence intensity of DOX was decreased with the increased amount of DNA duplex. The fluorescence intensity of DOX reached the minimum point once the amount of DNA duplex reached 1 µM, indicating saturated binding between DOX and DNA duplex. Accordingly, we estimated the binding number of DOX per DNA duplex was about 6.


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 32

Figure 2. UV-vis and fluorescence absorption spectrum of TMPyP4-DNA complex and DOX-DNA complex. (A) UV-Vis absorption titration spectra of TMPyP4 with AS1411 cDNA. DNA concentration ranged from 0-2 µM. (B) Fluorescence absorption spectra of DOX solution with the addition of increased amount of dsDNA. The DNA concentration ranged from 0-1 µM.

Single modality therapy of drug-loaded nanosystems. To verify the therapeutic efficiency of the AuNR-based nanosystem, it was first tested as a single modality therapy. HeLa cells, which overexpress nucleolin on the cell surface, were chosen as the model cell in this study.21 Cells were incubated with DNA-conjugated AuNRs

(ds-NRs),

DOX-loaded,

DNA-conjugated

AuNRs

(D/ds-NRs),

TMPyP4-loaded, DNA-conjugated Au NRs (T/ds-NRs), DOX and TMPyP4-loaded, DNA-conjugated Au NRs (DT/ds-NRs), or free drugs (DOX, TMPyP4, or the combination of DOX and TMPyP4) at 37 °C for 4 h, respectively. Afterwards, cells were treated with PDT, PTT or no light irradiation (dark). After treatment, the viability of HeLa cells was tested by CCK-8 (Cell Counting Kit-8, Dojindo, Japan) assay.27, 28


8

Page 9 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. CCK-8 assay of single modality therapy against HeLa cells. HeLa cells were incubated with ds-NRs (black), D/ds-NRs (purple), T/ds-NRs (blue), DT/ds-NRs (red), free DOX (green), free TMPyP4 (yellow), and free DOX and TMPyP4 (gray) at the concentrations of 1.4 nM AuNR or 1.2 µM DOX or 0.7 µM TMPyP4 for 4 h. For PTT, cells were exposed to 808 nm near-infrared laser (2.5 W/cm2) for 6 min. For PDT, cells were irradiated under white light for 1 h.

As shown in Figure 3, no obvious change in cell viability was observed for cells treated with AuNR or AuNR-based nanosystems without light irradiation (ds-NRs: 98.2%; D/ds-NRs: 99.6%; T/ds-NRs: 89.5%, DT/ds-NRs: 96.5%), whereas a slight decrease in cell viability could be observed for cells treated with DOX alone (82.5%), indicating good biocompatibility of AuNR-based nanosystems. Under 808 nm laser irradiation (PTT), cells treated with AuNR-based nanosystems had lower viability than free drugs (ds-NRs: 69.9%; D/ds-NRs: 45.2%; T/ds-NRs: 57.4%, and DT/ds-NRs: 40.6%), indicating that photothermal effect had made a significant


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 32

contribution to cell death. Under white light irradiation (PDT), however, the free TMPyP4-treated group showed the highest cytotoxicity. That is, cell viability was 34.1 % for the free TMPyP4-treated group and 56.3% for the T/ds-NRs-treated group. We suggest that the TMPyP4 intercalated into the AuNR-based nanosystems was not fully triggered by white light irradiation, in turn indicating that the therapeutic effect of the AuNR-based nanosystem can be controlled by choosing different light source.

Multimodal therapy of drug-loaded nanosystems. To test the efficiency of the multimodal therapy provided by the AuNR-based nanosystem, PTT and PDT photostimulation was performed on HeLa cells. After incubation with D/ds-NRs, T/ds-NRs, or DT/ds-NRs separately, cells were irradiated under 808 nm laser and white light followed by cell viability detection. As shown in Figure 4A, cells treated with DT/ds-NRs showed the lowest viability (6.5%) as compared with the viability of cells treated with D/ds-NRs or T/ds-NRs, indicating the achievement of multifunctional effect. The dose-survival relationship between DT/ds-NRs and HeLa cells demonstrated that the IC50 value was about 0.8 nM (Figure 4B). In contrast, low dark cytotoxicity of DT/ds-NRs on HeLa cells indicated good biocompatibility of DT/ds-NRs in the absence of light irradiation (Figure S3). We speculate that the hyperthermia induced by AuNRs under 808 nm laser irradiation and the generation of reactive oxygen species (ROS) produced by photosensitizer under light irradiation (Figure S4) lead to the synergistic cytotoxicity.

External light stimulation made a significant contribution to the overall


10

Page 11 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


therapeutic efficiency of DT/ds-NRs. As shown in Figure 4C, cell viability was 40.6% for 808 nm laser irradiation (PTT) and 47.7% for white light irradiation (PDT), but an impressive 6.5% for white light and 808 nm laser irradiation together (PTT and PDT). These results indicated that tunable, photoresponsive efficiency of the gold NRs-based nanosystem could be achieved by selecting a certain light source. Confocal images of HeLa cells stained by PI (propidium iodide) dye also verified the increased amount of dead cells after light irradiation (Figure S5), indicating the excellent cancer cell killing ability of the AuNR-based nanosystem under combined light irradiation.

Next, cell death induced by DT/ds-NRs with different light irradiation was investigated by Annexin V-FITC/propidium idodide (PI) double staining. After treatment, HeLa cells were stained PI and Annexin V-FITC and then analyzed by flow cytometry. As shown in Figure 4D, HeLa cells treated with PTT and PDT irradiated together exhibited higher apoptosis (about 77.5% of apoptotic cells) compared with those cells treated without irradiation (15.4%), or with PDT(54.4%) and PTT (62.8%) alone (Figure S6). These results demonstrate that treatment using DT/ds-NRs with combined PTT and PDT enhances therapeutic efficacy by inducing cell apoptosis.

For chemotherapy, multidrug resistance (MDR) is the main barrier to effective treatment.29-31 Therefore, we herein further investigated the efficacy of the multimodal therapy nanosystem on multidrug-resistant MCF-7 cells. Cells were incubated with DT/ds-NRs or the mixture of free drugs (DOX and TMPyP4) at 37 °C for 4 h,


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 32

respectively. Then cells were treated without light irradiation (dark) or under combined PTT and PDT treatment, followed by CCK-8 test. Results showed that the DT/ds-NRs nanosystem could lead to obvious cell death by nearly 2-fold over that of the free drug mixture under light irradiation (Figure S7). These results suggested that this smart nanosystem can overcome MDR by gold nanorod-assisted drug delivery and light-irradiated drug release, as well as PDT and PTT induced cell death.

Figure 4. CCK-8 assay of DT/ds-NRs against HeLa cells. (A) Cytotoxicity of different drug-loaded nanosystems or free drugs under combined PTT and PDT therapy (black bar: ds-NRs; grey bar: D/ds-NRs; blue bar: T/ds-NRs; purple bar: free DOX; green bar: free TMPyP4; yellow bar: free DOX and TMPyP4; red bar: DT/ds-NRs). (B) Dose-survival relationship between DT/ds-NRs and HeLa cells


12

Page 13 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


under combined PTT and PDT treatment. (C) Cytotoxicity of DT/ds-NRs against HeLa cells without light irradiation (black bar); or PTT (yellow bar); PDT (green bar); combined PTT and PDT (red bar). Statistical analysis was performed with the two-tailed paired Student’s t test, **p < 0.005, ***p < 0.001. (D) Annexin V-FITC/PI double staining flow cytometric analysis of HeLa cells under synergistic PTT and PDT treatment. For PTT and PDT combined therapy, cells were exposed to 808 nm near-infrared laser (2.5 W/cm2) for 6 min, followed by white light irradiation for 1 h.

Photocontrollable drug release. This nanosystem, which is operated through externally controlled stimuli-responsive drug release, shows promise for minimizing side effects and improving drug utilization efficiency.32-35 For the stimuli-responsive nanosystem, it is important to maintain good intracellular stability in the absence of external stimulation and release the drugs in a controlled way.36 To analyze the stability of the nanosystem, we treated HeLa cells with DT/ds-NRs at 37 °C under 5% CO2 atmosphere for 2 h, 4 h and 6 h, respectively. Then, cells were incubated with LysoTracker® Green DND-26, a commercial lysosome binding dye, for 15 min and observed the results under the confocal microscope. As shown in Figure 5A, the red fluorescence signal from DOX proved that the DT/ds-NR nanosystem had been internalized by cells. The overlay images of DOX (red fluorescence signal) and LysoTracker® Green DND-26 (green fluorescence signal) indicated that the nanosystem was mainly distributed in the cytoplasm. It is noteworthy that the nanosystem was still resident in lysosome after 6 h of incubation without drug release, indicating good stability of the nanosystem after internalization.


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 32

To determine if DOX could be released in response to 808 nm laser irradiation, HeLa cells were incubated with DT/ds-NRs at 37 °C for 4 h and then treated with or without 808 nm laser irradiation. After that, cells were stained by Hoechst 33258, a commercial nuclear dye, for 5 min and observed under confocal microscopy. As shown in Figure 5B, the merged image of the red fluorescence signal (DOX) and the blue fluorescence (Hoechst 33258) at the nucleus indicated the colocalization of DOX and Hoechst 33258, demonstrating that DOX had internalized the cell nucleus after 808 nm laser irradiation. In contrast, DOX remained in cell cytoplasm without 808 nm laser irradiation. This result shows good photocontrollable drug-release capability of the nanosystem.

Figure 5. Confocal images of DT/ds-NRs in HeLa cells. (A) Confocal images of HeLa cells incubated with DT/ds-NRs for 2 h, 4 h, and 6 h, respectively, and stained with LysoTracker® Green DND-26 and DOX. (B) Colocalization images of HeLa cells incubated with DT/ds-NRs and Hoechst 33258 with or without 808 nm laser


14

Page 15 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


irradiation (2.5 W/cm2, 6 min). TMPyP4 does not exhibit detectable fluorescence signals in these channels. The scale bar represents 30 µm.

Enhanced therapeutic effect mediated by aptamer-guided multimodal therapy. Herein, aptamer AS1411, which can specifically bind to cancer cells overexpressing nucleolin,37-39 was used to enhance the therapeutic efficacy of the DT/ds-NRs nanosystem. To confirm the specific binding to cancer cells, a random DNA sequence (random cDNA) was used as control (See Table S1 in SI). To study the targeting capability of the nanosystem, the specific binding affinity between the AS1411 aptamer-modified nanosystem (DT/ds-NRs) and HeLa cells was analyzed by flow cytometry. After 4 h of incubation at 37 °C with either aptamer AS1411 or random DNA-modified nanosystem, cells were harvested and analyzed.

As shown in Figure 6A, a higher fluorescence intensity of the AS1411 aptamermodified nanosystem was observed in HeLa cells compared to the random cDNAmodified nanosystem by about 3-fold higher binding, indicating a stronger binding capability of the AS1411 aptamer-modified nanosystem and HeLa cells. This stronger binding capability was a key contributor to therapeutic efficiency, as shown in Figure 6B. The AS1411 aptamer-modified nanosystem demonstrated much higher cytotoxicity (cell viability: 7.7%) to HeLa cells than did the random cDNA-modified nanosystem (cell viability: 48.6%).


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 32

Figure 6. (A) Flow cytometry assay of the specific binding ability between AS1411 aptamer- or random cDNA-modified nanosystem and HeLa cells (black line: control; green line: random DNA-modified nanosystem; red line: AS1411 aptamer-modified nanosystem). (B) CCK-8 assay of the cytotoxicity between the AS1411 aptamer- or random DNA-modified nanosystem and HeLa cells under PTT and PDT treatment.

This DNA assembly is designed to realize benefits in simultaneous drug loading and delivery without the development of side effects usually caused by nonspecific spread of drug, which take fully use of the advantages of functional nucleic acids. Drugs can be activated and released from the DNA assembly by external light irradiation, thus achieving a controllable drug release strategy. Meanwhile, a true synergism was promoted by hyperthermia produced by AuNRs activated by means of a photosensitizer and chemotherapeutic effects derived from our model DOX drug that inhibited cell growth toward efficient cancer treatment.

CONCLUSION

In this study, we developed a smart gold nanorod-based multifunctional


16

Page 17 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nanosystem for cancer therapy. Functional DNA conjugated to the surface of gold nanorods can deliver DOX and TMPyP4 into cancer cells efficiently, followed by smart photocontrollable drug release. This integrated multimodal therapy was demonstrated to have synergistic effect able to overcome multiple drug resistance of cancer cells.

MATERIALS AND METHODS

Materials. Hexadecyltrimethyl ammonium bromide (CTAB) and L-ascorbic acid (AA) were purchased from Sigma. Hydrogen tetrachloroaurate trihydrate (HAuCl4), silver nitrate (AgNO3) and doxorubicin (DOX) were purchased from Sinopharm Chemical Reagent Co. Ltd. Other chemicals were of analytical grade and used without further purification. RPMI-1640 medium, penicillin-streptomycin solution and fetal bovine serum were obtained from Life Technologies (USA). TMPyP4 [5, 10, 15, 20-tetrakis (1-methylpyridinium-4-yl) porphyrin] was purchased from Frontier Scientific. The cell counting kit-8 (CCK-8) was purchased from Dojindo (Japan). Ultrapure Milli-Q water (Millipore) was used throughout the experiments. All DNA sequences used in this project were purchased from Sanggon Biotech.

Gold Nanorod Synthesis and Characterization. AuNRs with aspect ratio of ~3.5 were synthesized according to the seed-mediated protocol with CTAB as a template.40, 41 Typically, 0.25 mL of HAuCl4 (0.01 M) was added to 9.75 mL of CTAB solution (0.1 M). Then, 0.6 mL of freshly prepared, ice-cold NaBH4 (0.01 M) was added to the mixture, followed by vigorous stirring for 2 min. The color of the


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 32

solution turned to brownish-yellow during the stirring. The seed solution was kept in a water bath at 25 °C for 2 h. The growth solution was prepared by gently mixing 5 mL of HAuCl4 (0.01 M) with 1 mL of AgNO3 (0.01 M) in 100 mL of CTAB solution (0.1 M). Then, 2 mL of HCl (1 M) and 0.8 mL of AA (0.1 M) were added to the growth solution. Finally, 0.25 mL of the seed solution was added to the growth solution, followed by vigorous stirring for about 10 s. The mixed solution was left to stand overnight. The size of the AuNR was characterized by a JEOL JEM-2100F transmission electron microscope. UV-vis absorption spectrum of the AuNR was monitored by a UV spectrophotometer (UV-2450, Shimadzu).

Preparation of DNA Duplex-modified AuNRs. The modification of gold nanorods was conducted according to a reported protocol with a few modifications.22, 42, 43

Single-stranded DNA with 5’ thiol: 5’ HS- TTTTTTTTTTTTCGTCGTCGTCGT

CGTCGT (SH-capture strand) was immobilized onto the AuNRs surface by following steps. To remove excess CTAB, AuNRs were centrifuged and washed 3 times with distilled water, and then the AuNRs were incubated with SH-capture strand (NR/DNA ratio is 1:300) in 0.5 mM CTAB for 16 h. Then thiolated-PEG was added to replace the absorbed CTAB and incubated with the AuNRs for another 16 h. Finally, the thiolated DNA-modified AuNRs were salt-aged by slowly adding 5 M NaCl/0.01 M phosphate buffer (pH 7.4) into the mixture to give a final 0.5 M concentration of Na+. The mixture was left to stand at room temperature for at least 12 h. The excess of unbound DNA was removed by centrifugation and washed 3 times with 0.01 M PBS (pH 7.4); the resultant AuNRs were dispersed in 0.01 M PBS (pH 7.4) for further use.


18

Page 19 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The SH-capture strand DNA-modified AuNRs were then partially hybridized with complementary DNA strand: cDNA, 5’-GGTGGTGGTGGTTGTGGTGGTGGTGG TTTTTTTACGACGACGACGACGAG (AS1411-cDNA; the underlined sequence represents aptamer AS1411; bold sequence represents the hybridization part with SH-capture strand) in 0.01 M PBS containing 0.1 M Na+, 0.1 M K+, and 4 mM Mg2+, pH 7.4. The AS1411-cDNA strand was first heated at 95 °C for 5 min and gradually annealed to room temperature in 0.01 M PBS containing 0.1 M Na+, 0.1 M K+, and 4 mM Mg2+, pH 7.4, to form G-quadruplex. Then, the annealed AS1411-cDNA strand was added to the SH-capture strand DNA-modified AuNRs and incubated in a water bath at 30 °C for 6 h to hybridize. Nonspecific DNA binding was removed by 10000 rpm centrifuge and washed 3 times with 0.01 M PBS. The size and zeta potential of naked AuNRs and DNA duplex-modified AuNRs were assessed by dynamic light scattering (Nano-ZS90, Malvern).

Synthesis of Drug-loaded DNA Duplex-Modified AuNRs. For drug loading, DOX and/or TMPyP4 were subsequently added into the DNA duplex-modified AuNRs solution. After 2 h of incubation at room temperature, the mixture was washed 3 times with 0.01 M PBS containing 0.1 M Na+, 0.1 M K+, and 4 mM Mg2+, pH 7.4, followed by centrifugation (10000 rpm, 10 min) to remove the excess unbinding drugs. The amount of unbound drugs in the supernatant was calculated from the emission intensity of DOX at 595 nm (λ ex= 480 nm) and TMPyP4 at 715 nm (λ ex= 432 nm),21 respectively.


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 32

Circular Dichroism Tests. Annealed double-stranded DNA (SH-capture strand and AS1411-cDNA) and DNA duplex-modified AuNRs were tested using a MOS-500 circular dichroism spectropolarimeter (Biologic, France) from 200 nm to 500 nm to verify the formation of G-quadruplex.25

UV-vis Absorption Titration and Fluorescence Measurement. TMPyP4 was diluted to 7 µM. Then different molar concentrations (0, 0.1 µM, 0.3 µM, 0.5 µM, 1.5 µM, and 2 µM) of annealed AS1411 cDNA were added to the TMPyP4 solution in 0.01 M PBS. To study the interaction between TMPyP4 and the G-quadruplex of AS1411 cDNA, the UV absorption titration of AS1411 cDNA versus TMPyP4 was tested by a UV-24500 spectrophotometer. DOX was diluted to 12 µM, and then different molar concentrations (0, 0.01 µM, 0.05 µM, 0.1 µM，0.3 µM，0.5 µM， 0.8 µM, and 1 µM) of annealed DNA duplex (SH-capture strand and AS1411 cDNA) were added to the DOX solution. To study the interaction between DOX and DNA duplex, the fluorescent spectrum of DNA duplex and DOX was tested by a fluorescence spectrophotometer (Fluoromax-4, HORIBA).

Cell Line and Cell Culture. HeLa cells and multidrug-resistant MCF-7 cells were maintained in RPMI-1640 cell medium (Life Technologies, USA) supplemented with 10% bovine serum (FBS, Gibco) and 1% penicillin-streptomycin (Life Technologies, USA) at 37 °C under 5% CO2 atmosphere.

Flow Cytometric Analysis. To evaluate the binding ability between cells and the AS1411 aptamer-modified nanosystem (DT/ds-NRs), cells were treated with


20

Page 21 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


DT/ds-NRs or random cDNA-modified nanosystem (RDT/ds-NRs) in RPMI-1640 cell medium supplemented with 10% bovine serum and 1% penicillin-streptomycin at 37 °C. After incubation for 4 h, cells were washed with DPBS (Gibco) 3 times. Then, cells were treated with 0.025% trypsin-EDTA (Gibco), centrifuged at 800 rpm for 3 min to remove trypsin, and then dispersed in RPMI-1640 for flow cytometry analysis. Cytotoxicity Assay. Cells were seeded into a 96-well plate at a density of 1×104 cells per well and cultured for 12 h. Then the cells were treated with ds-NRs (DNA-conjugated AuNRs), D/ds-NRs (DOX-loaded, DNA-conjugated AuNRs), T/ds-NRs

(TMPyP4-loaded,

DNA-conjugated

AuNRs),

DT/ds-NRs

(DOX/TMPyP4-loaded, DNA-conjugated AuNRs), free DOX, free TMPyP4, and mixture of free DOX and TMPyP4 of a specific concentration at 37 °C, 5% CO2 for 4 h, respectively (the concentration of AuNR among the ds-NRs, D/ds-NRs, T/ds-NRs, DT/ds-NRs was about 1.4 nM). The amount of free drugs was used equivalently according to the nanosystem loaded amount (DOX: 1.2 µM, TMPyP4: 0.7 µM). After removing cell medium, cells were washed with DPBS twice and incubated with 100 µL RPMI-1640 cell culture medium. For PTT, cells were exposed to 808 nm near-infrared laser (2.5 W/cm2) for 6 min. For PDT, cells were irradiated with white light for 1 h. For PTT and PDT combined therapy, cells were exposed to 808 nm near-infrared laser (2.5 W/cm2) for 6 min, followed by white light irradiation for 1 h. After different light irradiation treatments, the supernatant was removed and replaced by fresh cell culture medium. Then, the cells were further cultured for 24 h. Cytotoxicity was determined by performing the [2-(2-4-nitro phenyl methoxy-)


21


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 32

3-(4-nitro phenyl)-5-(2, 4-disulfonic acid benzene)-2 h-tetrazolium monosodium salt] (CCK-8) assay. Briefly, 10 µL of CCK-8 and 90 µL of RPMI-1640 cell medium were added per well and incubated for about 2 h. Then, the absorbance at 450 nm of formazan was recorded by using a microplate reader (BioTek).

Apoptosis Detection by Annexin V Assay. HeLa cells were seeded at a density of 1×106 per millimeter in cell culture vessels and allowed to grow for 16 h. After removal of the cell medium, cells were treated with a specific concentration of DT/ds-NRs for 4 h, followed by PTT, PDT, combined PTT and PDT treatment, respectively. After that, cells were harvested and washed with DPBS 3 times. The supernatants were discarded, and cells were re-suspended in 1×annexin V binding solution. To 100 µL cell suspension, 5 µL of annexin V-FITC and 5 µL of propidium iodide (PI) were added and incubated for 15 min at room temperature. Then, 400 µL of 1×annexin V-FITC binding solution were added to each sample and gently mixed. The samples were kept on ice and were analyzed on a BD FACSVerse™ flow cytometer in 1 h.

Confocal Laser Scanning Microscopy Imaging. Cells were seeded into optical cell culture vessels and allowed to further grow for 12 h. Then, cells were incubated with DT/ds-NRs for different time at room temperature. After that, cells were washed 3 times with 1×DPBS (Gibco) and incubated with 10 µL of Lysosome Tracker for 15 min at room temperature. Fluorescence imaging was performed by confocal microscopy (FV1000-X81, Olympus). For DT/ds-NRs-induced apoptosis, cells were


22

Page 23 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


incubated with DT/ds-NRs at 37 °C for 4 h. Then, cells were treated with PTT, PDT, combined PTT and PDT therapy, respectively. The cell medium was removed and replaced by RPMI-1640. Then, 5 µL of PI were added and incubated at room temperature for 15 min. After that, cells were washed 3 times with 1×DPBS (Gibco), and fluorescence imaging was performed on an Olympus confocal microscope.

ASSOCIATED CONTENT

Supporting Information

Size distribution and zeta potential analysis of the gold nanorods, photo-heat conversion analysis, ROS detection, microscopic and flow cytometric assay, cytotoxicity assay of the nanosystem on multidrug-resistant MCF-7 cells. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]

*E-mail: [email protected]

Author Contributions

Y.Y. and Q.L.L. conceived the project and designed the experiments. H.J.W. performed the cytotoxicity assay. X.W.W. participated in synthesis of gold NRs. Y.Y. carried out the main experiments and collected the data. Y.Y. and Q.L.L. wrote the


23


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 32

manuscript. M.Y. and W.H.T. performed a critical review of the manuscript. All authors contributed to the final manuscript.

Notes

The authors declare no competing financial interest.

ACKNOWLEGEMENT

This work was supported by grants from the National Natural Science Foundation of China (21502050, 81171950, 81272220, 81402304 and 81672760), the National Basic Research Program of China (2013CB932702), the Interdisciplinary Research Program of Hunan University and the Program for New Century Excellent Talents in University (NCET-13-0195).

REFERENCES

(1) Hao, Y.; Wang, L.; Zhao, Y.; Meng, D.; Li, D.; Li, H.; Zhang, B.; Shi, J.; Zhang, H.; Zhang, Z.; Zhang, Y. Targeted Imaging and Chemo-Phototherapy of Brain Cancer by a Multifunctional Drug Delivery System. Macromol. Biosci. 2015, 15, 1571-1585. (2) Wang, L.; Shi, J.; Jia, X.; Liu, R.; Wang, H.; Wang, Z.; Li, L.; Zhang, J.; Zhang, C.; Zhang, Z. NIR-/pH-Responsive Drug Delivery of Functionalized Single-Walled Carbon Nanotubes for Potential Application in Cancer Chemo-Photothermal Therapy. Pharm. Res. 2013, 30, 2757-2771.


24

Page 25 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(3) Wang, J.; You, M.; Zhu, G.; Shukoor, M. I.; Chen, Z.; Zhao, Z.; Altman, M. B.; Yuan, Q.; Zhu, Z.; Chen, Y.; Huang, C. Z.; Tan, W. Photosensitizer-Gold Nanorod Composite for Targeted Multimodal Therapy. Small 2013, 9, 3678-3684. (4) Hao, Y.; Zhang, B.; Zheng, C.; Ji, R.; Ren, X.; Guo, F.; Sun, S.; Shi, J.; Zhang, H.; Zhang, Z.; Wang, L.; Zhang, Y. The Tumor-Targeting Core-Shell Structured DTX-Loaded PLGA@Au Nanoparticles for Chemo-Photothermal Therapy and X-Ray Imaging. J. Controlled Release 2015, 220, 545-555. (5) Zhao, Z. X.; Huang, Y. Z.; Shi, S. G.; Tang, S. H.; Li, D. H.; Chen, X. L. Cancer Therapy

Improvement

with

Mesoporous

Silica

Nanoparticles

Combining

Photodynamic and Photothermal Therapy. Nanotechnology 2014, 25, 285701-285709. (6) Mou, J.; Lin, T.; Huang, F.; Chen, H.; Shi, J. Black Titania-Based Theranostic Nanoplatform for Single NIR Laser Induced Dual-Modal Imaging-Guided PTT/PDT. Biomaterials 2016, 84, 13-24. (7) Huang, L.; Tao, K.; Liu, J.; Qi, C.; Xu, L.; Chang, P.; Gao, J.; Shuai, X.; Wang, G.; Wang, Z.; Wang, L. Design and Fabrication of Multifunctional Sericin Nanoparticles for Tumor Targeting and pH-Responsive Subcellular Delivery of Cancer Chemotherapy Drugs. ACS Appl. Mater. Interfaces 2016, 8, 6577-6585. (8) Abadeer, N. S.; Murphy, C. J. Recent Progress in Cancer Thermal Therapy Using Gold Nanoparticles. J. Phys. Chem. C 2016, 120, 4691-4716. (9) Chen, W. H.; Yang, C. X.; Qiu, W. X.; Luo, G. F.; Jia, H. Z.; Lei, Q.; Wang, X. Y.; Liu, G.; Zhuo, R. X.; Zhang, X. Z. Multifunctional Theranostic Nanoplatform for


25


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 32

Cancer Combined Therapy Based on Gold Nanorods. Adv. Healthcare Mater. 2015, 4, 2247-2259. (10) Chen, H.; Di, Y.; Chen, D.; Madrid, K.; Zhang, M.; Tian, C.; Tang, L.; Gu, Y. Combined Chemo- and Photo-Thermal Therapy Delivered by Multifunctional Theranostic Gold Nanorod-Loaded Microcapsules. Nanoscale 2015, 7, 8884-8897. (11)

Jana,

N.

R.

Shape

Effect

in

Nanoparticle

Self-Assembly.

Angew. Chem., Int. Ed. Engl. 2004, 43, 1536-1540. (12) Sonnichsen, C.; Alivisatos, A. P. Gold Nanorods as Novel Nonbleaching Plasmon-Based Orientation Sensors for Polarized Single-Particle Microscopy. Nano Lett. 2005, 5, 301-304. (13) Burda, C.; Chen, X.; Narayanan, R.; El-Sayed, M. A. Chemistry and Properties of Nanocrystals of Different Shapes. Chem. Rev. 2005, 105, 1025-1102. (14) Shanmugam, V.; Chien, Y. H.; Cheng, Y. S.; Liu, T. Y.; Huang, C. C.; Su, C. H.; Chen, Y. S.; Kumar, U.; Hsu, H. F.; Yeh, C. S. Oligonucleotides-Assembled Au Nanorod-Assisted Cancer Photothermal Ablation and Combination Chemotherapy with Targeted Dual-Drug Delivery of Doxorubicin and Cisplatin Prodrug. ACS Appl. Mater. Interfaces 2014, 6, 4382-4393. (15) Yang, D.; Hartman, M. R.; Derrien, T. L.; Hamada, S.; An, D.; Yancey, K. G.; Cheng, R.; Ma, M.; Luo, D. DNA Materials: Bridging Nanotechnology and Biotechnology. Acc. Chem. Res. 2014, 47, 1902-1911.


26

Page 27 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(16) Wijaya, A.; Schaffer, S. B.; Pallares, I. G.; Hamad-Schifferli, K. Selective Release of Multiple DNA Oligonucleotides from Gold Nanorods. ACS Nano 2009, 3, 80-86. (17) Xiao, Z.; Ji, C.; Shi, J.; Pridgen, E. M.; Frieder, J.; Wu, J.; Farokhzad, O. C. DNA Self-Assembly of Targeted Near-Infrared-Responsive Gold Nanoparticles for Cancer Thermo-Chemotherapy. Angew. Chem., Int. Ed. Engl. 2012, 51, 11853-11857. (18) Abeylath, S. C.; Ganta, S.; Iyer, A. K.; Amiji, M. Combinatorial-Designed Multifunctional Polymeric Nanosystems for Tumor-Targeted Therapeutic Delivery. Acc. Chem. Res. 2011, 44, 1009-1017. (19) Yang, G.; Lv, R.; He, F.; Qu, F.; Gai, S.; Du, S.; Wei, Z.; Yang, P. A Core/Shell/Satellite Anticancer Platform for 808 NIR Light-Driven Multimodal Imaging and Combined Chemo-/Photothermal Therapy. Nanoscale 2015, 7, 13747-13758. (20) Bagalkot, V.; Farokhzad, O. C.; Langer, R.; Jon, S. An Aptamer–Doxorubicin Physical

Conjugate

as

a

Novel

Targeted

Drug-Delivery

Platform.

Angew. Chem., Int. Ed. Engl. 2006, 118, 8149-8152. (21) Shiao, Y. S.; Chiu, H. H.; Wu, P. H.; Huang, Y. F. Aptamer-Functionalized Gold Nanoparticles as Photoresponsive Nanoplatform for Co-Drug Delivery. ACS Appl. Mater. Interfaces 2014, 6, 21832-21841. (22) Liu, J.; Lu, Y. Preparation of Aptamer-Linked Gold Nanoparticle Purple Aggregates for Colorimetric Sensing of Analytes. Nat. Protoc. 2006, 1, 246-252.


27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 32

(23) Zhang, J.; Chen, R.; Fang, X.; Chen, F.; Wang, Y.; Chen, M. Nucleolin Targeting AS1411 Aptamer Modified pH-Sensitive Micelles for Enhanced Delivery and Antitumor Efficacy of Paclitaxel. Nano Res. 2015, 8, 201-218. (24) Soundararajan, S.; Chen, W.; Spicer, E. K.; Courtenay-Luck, N.; Fernandes, D. J. The Nucleolin Targeting Aptamer AS1411 Destabilizes Bcl-2 Messenger RNA in Human Breast Cancer Cells. Cancer Res. 2008, 68, 2358-2365. (25) Yuan, Q.; Wu, Y.; Wang, J.; Lu, D.; Zhao, Z.; Liu, T.; Zhang, X.; Tan, W. Targeted Bioimaging and Photodynamic Aptamer-Guided

G-quadruplex

DNA

Therapy Nanoplatform Using an Carrier

and

Near-Infrared

Light.

Angew. Chem., Int. Ed. Engl. 2013, 52, 13965-13969. (26) Qiu, L.; Chen, T.; Ocsoy, I.; Yasun, E.; Wu, C.; Zhu, G.; You, M.; Han, D.; Jiang, J.; Yu, R.; Tan, W. A Cell-Targeted, Size-Photocontrollable, Nuclear-Uptake Nanodrug Delivery System for Drug-Resistant Cancer Therapy. Nano Lett. 2015, 15, 457-463. (27) Zhuang, Y.; Deng, H.; Su, Y.; He, L.; Wang, R.; Tong, G.; He, D.; Zhu, X. Aptamer-Functionalized and Backbone Redox-Responsive Hyperbranched Polymer for Targeted Drug Delivery in Cancer Therapy. Biomacromolecules 2016, 17, 2050-2062. (28) Gai, S.; Li, C.; Yang, P.; Lin, J. Recent Progress in Rare Earth Micro/Nanocrystals: Soft Chemical Synthesis, Luminescent Properties, and Biomedical Applications. Chem. Rev. 2014, 114, 2343-2389. (29) Feng, Q.; Zhang, Y.; Zhang, W.; Shan, X.; Yuan, Y.; Zhang, H.; Hou, L.; Zhang, Z. Tumor-Targeted and Multi-Stimuli Responsive Drug Delivery System for


28

Page 29 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Near-Infrared Light Induced Chemo-Phototherapy and Photoacoustic Tomography. Acta Biomater. 2016, 38, 129-142. (30) Larson, N.; Gormley, A.; Frazier, N.; Ghandehari, H. Synergistic Enhancement of Cancer Therapy Using a Combination of Heat Shock Protein Targeted HPMA Copolymer-Drug

Conjugates

and

Gold

Nanorod

Induced

Hyperthermia.

J. Controlled Release 2013, 170, 41-50. (31) Lammers, T.; Kiessling, F.; Hennink, W. E.; Storm, G. Drug Targeting to Tumors: Principles, Pitfalls and (Pre-) Clinical Progress. J. Controlled Release 2012, 161, 175-187. (32) Lai, W. F.; Shum, H. C. A Stimuli-Responsive Nanoparticulate System Using Poly(ethylenimine)-Graft-Polysorbate for Controlled Protein Release. Nanoscale 2016, 8, 517-528. (33) Ma, C.; Shi, Y.; Pena, D. A.; Peng, L.; Yu, G. Thermally Responsive Hydrogel Blends:

A General

Drug

Carrier

Model

for

Controlled

Drug

Release.

Angew. Chem., Int. Ed. Engl. 2015, 54, 7376-7380. (34) Cao, N.; Li, M.; Zhao, Y.; Qiu, L.; Zou, X.; Zhang, Y.; Sun, L. Fabrication of SnO2/Porous Silica/Polyethyleneimine Nanoparticles for pH-Responsive Drug Delivery. Mater. Sci. Eng., C 2016, 59, 319-323. (35) Wang, C.; Lv, P.; Wei, W.; Tao, S.; Hu, T.; Yang, J.; Meng, C. A Smart Multifunctional Nanocomposite for Intracellular Targeted Drug Delivery and Self-Release. Nanotechnology 2011, 22, 415101-415108.


29


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 32

(36) Chien, Y. H.; Chou, Y. L.; Wang, S. W.; Hung, S. T.; Liau, M. C.; Chao, Y. J.; Su, C. H.; Yeh, C. S. Near-Infrared Light Photocontrolled Targeting, Bioimaging, and Chemotherapy with Caged Upconversion Nanoparticles in Vitro and in Vivo. ACS Nano 2013, 7, 8516-8528. (37) Shieh, Y. A.; Yang, S. J.; Wei, M. F.; Shieh, M. J. Aptamer-Based Tumor-Targeted Drug Delivery for Photodynamic Therapy. ACS Nano 2010, 4, 1433-1442. (38) Kim, J. K.; Choi, K. J.; Lee, M.; Jo, M. H.; Kim, S. Molecular Imaging of a Cancer-Targeting

Theragnostics

Probe

Using

a

Nucleolin

Aptamer-

and

MicroRNA-221 Molecular Beacon-Conjugated Nanoparticle. Biomaterials 2012, 33, 207-217. (39) Ai, J.; Xu, Y.; Lou, B.; Li, D.; Wang, E. Multifunctional AS1411-Functionalized Fluorescent Gold Nanoparticles for Targeted Cancer Cell Imaging and Efficient Photodynamic Therapy. Talanta 2014, 118, 54-60. (40) Keul, H. A.; Moller, M.; Bockstaller, M. R. Structural Evolution of Gold Nanorods During Controlled Secondary Growth. Langmuir 2007, 23, 10307-10315. (41) Murphy, C. J.; Sau, T. K.; Gole, A. M.; Orendorff, C. J.; Gao, J.; Gou, L.; Hunyadi, S. E.; Li, T. Anisotropic Metal Nanoparticles: Synthesis, Assembly, and Optical Applications. J. Phys. Chem. B 2005, 109, 13857-13870. (42) Xu, L.; Kuang, H.; Xu, C.; Ma, W.; Wang, L.; Kotov, N. A. Regiospecific Plasmonic

Assemblies

for

in

Situ

Raman

Spectroscopy

in

Live

Cells.

J. Am. Chem. Soc. 2012, 134, 1699-1709.


30

Page 31 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(43) Joshi, P. P.; Yoon, S. J.; Hardin, W. G.; Emelianov, S.; Sokolov, K. V. Conjugation of Antibodies to Gold Nanorods Through Fc Portion: Synthesis and Molecular Specific Imaging. Bioconjugate Chem. 2013, 24, 878-888.


31


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 32

Table of Contents


32

A Smart, Photocontrollable Drug Release Nanosystem for

Recommend Documents