Accumulation of Phenylpropanoids by White, Blue, and Red Light

Jul 9, 2015 - This increase was coincident with a noticeable increase in expression levels of BrF3H, BrF3′H, BrFLS, and BrDFR. Red light led to the ...
0 downloads 0 Views 1MB Size
Download PDF
Article pubs.acs.org/JAFC

Accumulation of Phenylpropanoids by White, Blue, and Red Light Irradiation and Their Organ-Specific Distribution in Chinese Cabbage (Brassica rapa ssp. pekinensis) Yeon Jeong Kim,† Yeon Bok Kim,§ Xiaohua Li,† Su Ryun Choi,‡ Suhyoung Park,⊗ Jong Seok Park,‡ Yong Pyo Lim,‡ and Sang Un Park*,† †

Department of Crop Science, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon 305-754, Korea Department of Herbal Crop Research, National Institute of Horticultural and Herbal Science (NIHHS), Rural Development Administration (RDA), Bisanro 92, Eumseong, Chungbuk 369-873, Republic of Korea ‡ Department of Horticulture, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon 305-764, Korea ⊗ Department of Horticultural Crop Research, National Institute of Horticultural and Herbal Science (NIHHS), Rural Development Administration (RDA), 475 Imok-dong, Jangan-gu, Suwon 440-706, Korea §

ABSTRACT: This study investigated optimum light conditions for enhancing phenylpropanoid biosynthesis and the distribution of phenylpropanoids in organs of Chinese cabbage (Brassica rapa ssp. pekinensis). Blue light caused a high accumulation of most phenolic compounds, including p-hydroxybenzoic acid, ferulic acid, quercetin, and kaempferol, at 12 days after irradiation (DAI). This increase was coincident with a noticeable increase in expression levels of BrF3H, BrF3′H, BrFLS, and BrDFR. Red light led to the highest ferulic acid content at 12 DAI and to elevated expression of the corresponding genes during the early stages of irradiation. White light induced the highest accumulation of kaempferol and increased expression of BrPAL and BrDFR at 9 DAI. The phenylpropanoid content analysis in different organs revealed organ-specific accumulation of phydroxybenzoic acid, quercetin, and kaempferol. These results demonstrate that blue light is effective at increasing phenylpropanoid biosynthesis in Chinese cabbage, with leaves and flowers representing the most suitable organs for the production of specific phenylpropanoids. KEYWORDS: Brassica rapa ssp. pekinensis, Chinese cabbage, phenylpropanoid, light conditions, organ-specific distribution

■

INTRODUCTION Plant phenolic compounds are secondary metabolites found in the edible parts of higher plants, including fruits, vegetables, cereals, and legumes.1 These compounds have potent antioxidant activity and contribute to the protection of plants against stresses such as pathogen attack, excess light, excess ultraviolet radiation, wounding, high and low temperature, and nutrient-deficient environments.2,3 Previous studies have shown that dietary phenolic compounds in plant foods might be beneficial to human health, possibly having anti-inflammatory, liver-protecting, hypoglycemic, antiviral, and anticancer properties.4,5 A number of phenolic compounds have been reported in plant foods and, accordingly, the nutritional value of those plant foods is being re-evaluated. Recent relevant studies have focused on identifying genetic and environmental factors that lead to the accumulation of phenolic compounds in plants, in order to respond to the need for improving plant nutritional quality. Light quality, irrigation, temperature variation, and fertilization have been examined as influential environmental factors.6 In particular, irradiation by different wavelengths of light with light-emitting diodes (LEDs) has been widely applied to various crops, such as lettuce,7 chrysanthemum,8 and buckwheat.9,10 Use of LEDs, which facilitate the application of different wavelengths and light intensities, has allowed us to easily analyze the effects of light on the accumulation of phenolic compounds in controlled environments. In previous studies of irradiation by white, blue, © XXXX American Chemical Society

and red lights, individually and in combination, different effects were observed on different crop species with respect to the accumulation of specific phenolic compounds. For example, blue light irradiation was effective in increasing polyphenol contents in lettuce7 and in inducing production of rutin and cyanidin 3-O-rutinoside in buckwheat,10 whereas in chrysanthemum, blue light had lower efficiency than red light in enhancing polyphenol contents.8 In studies of irradiation by different light combinations, whereas supplemental red light irradiation led to an increase in phenolic concentrations in baby leaf lettuce,11 irradiation by red, green, and blue light in combination was more effective for rutin accumulation in buckwheat sprouts than either all blue, or red, blue, and far-red combinations.9 These results reveal that light irradiation using LEDs is an effective method for inducing the production of phenolic compounds, although its effects varied among crop species. Building upon these previous studies, we evaluated shortterm irradiation by white, blue, and red LED lights for its effectiveness in increasing the nutritional quality of seedlings of Chinese cabbage (Brassica rapa L. ssp. pekinensis). We also Received: April 26, 2015 Revised: July 7, 2015 Accepted: July 9, 2015

A

DOI: 10.1021/acs.jafc.5b02086 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry analyzed the expression of genes involved in the biosynthetic pathways of phenolic compounds during different light irradiations and investigated the distribution of the compounds in the various organs of adult plants. Chinese cabbage is an important source of beneficial nutrients, such as carotenoids, fibers, vitamins, minerals, glucosinolates (GSLs), and phenolics, and it is widely consumed in East Asia and, in particular, in Korea, where both the adult and sprouting plant parts are an important ingredient of kimchi and salad. Our results in this study provide useful information for improving the nutritional quality of Chinese cabbage as well as for improving horticultural practice.

■

Table 1. qRT-PCR Primers Used in This Study

MATERIALS AND METHODS

Plant Materials. Chinese cabbage (B. rapa ssp. pekinensis var. ‘Bulam No. 3’) was grown under field conditions at the experimental farm of the National Institute of Horticultural and Herbal Science, Rural Development Administration (Suwon, Korea). Different organs (flowers, stems, leaves, and roots) were separately harvested from at least than five 85-day-old field-grown plants. For white, blue, and red LED light irradiation, germinated seeds were sown onto vermiculate and cultivated in a growth chamber at 25 °C under a 16 h photoperiod with different LED light irradiation (380 nm for white, 470 nm for blue, and 660 nm for red) over a 12-day period. Whole seedlings were harvested at 6, 9, and 12 days after irradiation (DAI). All samples were immediately frozen in liquid nitrogen and then stored at −80 °C and/ or freeze-dried for RNA isolation and/or high-performance liquid chromatography−ultraviolet (HPLC-UV) analysis. Whole cultivations and irradiations were repeated three times, and the samples from each set of cultures were used for biological repeats. Identification of Phenylpropanoid Biosynthesis-Related Genes in Chinese Cabbage. Phenylpropanoid biosynthetic genes of Arabidopsis thaliana were searched and downloaded from The Arabidopsis Information Resource (TAIR) database.12 The collected genes were subjected to a TBLASTX search against the genome of the B. rapa line Chiifu-401,13 which was downloaded from the Brassica database (BRAD) to identify their homologues in the B. rapa genome. Only resultant sequences with e values 85% were considered as potentially orthologous, and among these we selected for further use only the ones that had the highest identities with each phenylpropanoid biosynthetic gene of Arabidopsis. A total of 11 Chinese cabbage phenylpropanoid biosynthetic genes were selected, and gene-specific primers for the 11 genes were designed with GenScript Real-Time PCR (TaqMan) Primer Design (https://www. genscript.com/ssl-bin/app/primer) software and used for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. The accession numbers of the genes and primer sets used in this study are listed in Table 1. Total RNA Extraction and Quantitative Real Time-PCR. Total RNA was isolated by an Easy BLUE Total RNA Kit (iNtRON, Seongnam, Korea). The quantity of RNA was measured on a NanoVue Plus spectrophotometer (GE Healthcare Life Sciences), and its quality was confirmed by running 1 μg of the RNA on 1.2% formaldehyde RNA agarose gel. Then, 1 μg of total RNA was reversetranscribed by a ReverTra Ace-α Kit (Toyobo) and oligo (dT)20 primers, according to the manufacturer’s protocol. The cDNA was diluted 20-fold for qRT-PCR. qRT-PCR was performed in a 20-μL reaction volume containing 0.5 μM primers and 2× Real-Time PCR Smart mix (SolGent; Daejeon, Korea). The qRT-PCR program was as follows: initial denaturation at 95 °C for 15 min followed by 40 cycles of denaturation at 95 °C for 20 s, annealing at 55 °C for 40 s, and extension at 72 °C for 20 s. The qRT-PCR results were obtained as the mean of three replicates. BrEF-1-α (GO479260) was used as a reference gene because it was previously determined to be the most suitable reference gene among several Chinese cabbage genes.14 Extraction and Analysis of Phenylpropanoids in Chinese Cabbage. HPLC-UV analysis of the phenylpropanoids was carried out according to previously described methods with some

primer

sequence (5′ → 3′)

size (bp)

BrPAL-RT (F) BrPAL-RT (R) BrC4H-RT (F) BrC4H-RT (R) Br4CL1-RT (F) Br4CL1-RT (R) Br4CL2-RT (F) Br4CL2-RT (R) Br4CL3-RT (F) Br4CL3-RT (R) BrCHS-RT (F) BrCHS-RT (R) BrCHI-RT (F) BrCHI-RT (R) BrF3H-RT (F) BrF3H-RT (R) BrF3′H-RT (F) BrF3′H-RT (R) BrFLS-RT (F) BrFLS-RT (R) BrDFR-RT (F) BrDFR-RT (R) BrEF-1-α (F) BrEF-1-α (R)

AAGCCGGAGTTCACCGATCA ACGAGCTCCCGTCGAGAATG ATCCTGGTCAACGCCTGGTG GTCCAACACCAAACGGCACA CCCAATCACCTCCCTCTCCAC GCGACATGGACGTCGGAGTAA ATGTCCACACGAGAAGAGACGGTC TGATCAAGCAAGGCTTTGCG GGCCAAGAACCCAACTGTTA ACCCAAGGCTCATTGACAAC AGGAAACGCCACATGCACCT AGGGACTTCGACCACCACGA TCTCCGTCCCGTCACTCTCC AACGGCAGCTTCATCGTCACTT CAAGCCACACGAGACGATGG TTGAACCTCCCGTTGCTCAGA GCCGGAGAAGCTGAACATGG TAAGCCGACCCGAGTCCGTA TCCTTCCGCCGTCATTGTTC TCACGGTGTGGCTCCAAGAA GGACAAAGTTCCGGGCAGTG TCTGCTGTGCCGACATGTGA ATACCAGGCTTGAGCATACCG GCCAAAGAGGCCATCAGACAA

100 145 133 150 179 114 133 110 117 141 140 117

modification.15 Samples were freeze-dried and ground into a fine powder. A total of 100 mg of sample was transferred to 6 mL of 62.5% methanol containing 2 g/L tert-butylhydroquinone as an antioxidant. To hydrolyze, 1.5 mL of 6 N HCl was then added and incubated at 90 °C for 2 h. After centrifugation at 1000g for 5 min, the supernatant was passed through a 0.22 μm PTFE syringe filter prior to HPLC. External standards were purchased from Extrasynthese (Genay, France). MeOH and HCl were purchased from Wako Pure Chemical Industries (Osaka, Japan) and Sigma-Aldrich Co., Ltd. (St. Louis, MO, USA), respectively. The extract was diluted 2-fold with MeOH prior to HPLC-UV analysis. Samples were identified using a Futecs model NS4000 HPLC apparatus (Daejeon, Korea) with an UV−vis detector and autosampler. The analysis was monitored at 280 nm and performed using a C18 column (250 × 4.6 mm, 5 μm; RStech; Daejeon, Korea). The mobile phase consisted of a mixture of (A) MeOH/water/acetic acid (5:92.5:2.5, v/v/v) and (B) MeOH/water/acetic acid (95:2.5:2.5, v/v/v), as described previously. 16 The initial mobile phase composition was 0% solvent B, followed by a linear gradient from 0 to 80% of solvent B in 48 min, then holding at 0% solvent B for an additional 10 min; the column was then maintained at 30 °C. The flow rate was set at 1.0 mL min−1, and the injection volume was 20 μL. Quantification of the different compounds was based on peak areas and calculated as the equivalents of representative standard compounds. All contents are expressed as micrograms per milligram DW and were analyzed by ANOVA and Tukey’s post hoc test using R software (ver. 3.1.0).

■

RESULTS AND DISCUSSION Expression of Phenylpropanoid Biosynthetic Genes in Chinese Cabbage Irradiated with White, Blue, and Red Lights. The biosynthetic pathways for the phenolic compounds and genes responsible for those biosyntheses analyzed in this study are illustrated in Figure 1. The transcripts of the phenylpropanoid biosynthetic genes of B. rapa ssp. pekinensis were investigated by qRT-PCR in the whole seedlings of Chinese cabbage at 6, 9, and 12 DAI with white, blue, and red LED lights (Figure 2). Under white light, the expression levels of BrDFR noticeably increased at 9 DAI, whereas those of B

DOI: 10.1021/acs.jafc.5b02086 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

BrPAL, Br4CL1, Br4CL3, BrCHS, BrCHI, BrF3H, BrF3′H, and BrFLS declined after peaking at 9 DAI. The expressions of BrC4H and Br4CL2 did not significantly change during white light irradiation. Compared to white light, blue light had a more noticeable effect on the change in the expression patterns of phenylpropanoid biosynthetic genes. The transcript levels of BrF3H, BrF3′H, BrFLS, and BrDFR dramatically increased at 12 DAI. In particular, the expressions of BrF3′H and BrFLS peaked when compared with the white and red light treatments. Red light caused the expression of many phenylpropanoid genes to increase, including Br4CL2, Br4CL3,BrCHS, BrCHI, BrF3H, and BrFLS at 6 DAI. However, red light had no effect on the expression of BrPAL, BrC4H, BrF3′H, and BrDFR during irradiation. The transcript level of Br4CL1 was noticeably up-regulated by red light at 12 DAI, unlike other genes, implying that the machinery for the transcription of Br4CL1 might be regulated differently from other genes. Our results on the expressions of phenylpropanoid biosynthetic genes showed difference with results in similar studies with different crops. For example, similar light irradiation in buckwheat resulted in gradually reduced expression of most orthologous genes after 2 days of all LED light irradiation.10 Basil leaves grown over yellow and green plastic mulches had higher phenolics content than those grown over white and blue covers.17 Along with our study, these results indicate crops have diverse responses to light irradiation in terms of phenylpropanoid biosynthesis. Accumulation of Phenylpropanoids in Chinese Cabbage Irradiated with White, Blue, and Red Lights. Previous studies have reported that abundant flavonol aglycones in Chinese cabbage pak choi (B. rapa L. ssp. chinensis L. (Hanelt.)) included quercetin, kaempferol, and isorhamnetin, as found for other species in the Brassicaceae family.18 Studies analyzing hydroxycinnamic acid derivatives in various cultivars of pak choi demonstrated that phenolic

Figure 1. Proposed phenylpropanoid biosynthetic pathway in Chinese cabbage. PAL, phenylalanine ammonia-lyase; C4H, cinnamate 4hydroxylase; 4CL, 4-coumaroyl CoA ligase; CHS, chalcone synthase; CHI, chalcone isomerase; F3H, flavanone 3-hydroxylase; F3′H, flavonoid 3′-hydroxylase; FLS, flavonol synthase; DFR, dihydroflavonol-4 reductase. The shaded boxes indicate the compounds analyzed in this study. The dashed arrow indicates the process catalyzed by unidentified enzymes in the Brassicaceae family.

Figure 2. Expression levels of phenylpropanoid biosynthetic genes in the seedlings of Chinese cabbage irradiated with white, blue, and red LED lights. Total RNA was extracted from whole seedlings sampled at 6, 9, and 12 days after irradiation and used for qRT-PCR analysis. The relative expression ratio of transcripts was shown to be calibrated with expression of BrEF-1-α. The height of each bar and the error bars indicate the mean and standard error, respectively, from three independent measurements. C

DOI: 10.1021/acs.jafc.5b02086 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Table 2. Accumulation (μg g−1) of Phenolic Compounds in the Seedlings of Chinese Cabbage Irradiated with White, Blue, and Red LED Lighta light

p-hydroxybenzoic acid

chlorogenic acid

ferulic acid

quercetin

kaempferol

white

6 days 9 days 12 days

22.1 ± 0.96 a 3.17 ± 0.13 c 9.14 ± 2.74 c

23.3 ± 0.74 a 23.84 ± 0.34 a 29.13 ± 6.38 a

4.37 ± 0.01 ab 3.35 ± 0.13 a 4.53 ± 1.4 ab

1.36 ± 0.26 ac 0±0a 0±0a

3.2 ± 0.96 ab 1.94 ± 0.23 a 7.71 ± 1.23 b

blue

6 days 9 days 12 days

26.02 ± 1.99 a 37.13 ± 0.81 b 49.06 ± 2.15 d

25.41 ± 0.33 a 26.93 ± 0.16 a 27.34 ± 2.35 a

5.51 ± 0.49 ab 5.34 ± 2.63 ab 10.6 ± 2.01 b

0±0a 0±0a 4.8 ± 0.59 b

1.7 ± 0.28 a 4.53 ± 0.01 ab 7.48 ± 0.91 b

red

6 days 9 days 12 days

4.03 ± 1.34 c 3.69 ± 1.09 c 3.48 ± 1.41 c

26.57 ± 1.2 a 27.61 ± 0.04 a 26.69 ± 0.01 a

7.11 ± 1.91 ab 6.42 ± 2.83 ab 19.52 ± 1.47 c

2.61 ± 0.87 c 2.43 ± 0.08 c 4.51 ± 0.14 b

2.57 ± 1.03 ab 4.42 ± 3.20 ab 4.25 ± 0.86 ab

a

Whole seedlings were sampled at 6, 9, and 12 days after irradiation and used for HPLC-UV analysis. The means and standard deviations were obtained from three independent experiments. Letters a−c indicate significant differences (P < 0.05).

Figure 3. Expression profiles of phenylpropanoid biosynthetic genes in different organs of adult Chinese cabbage plants. Total RNA was extracted from the flowers, leaves, stems, and roots of 85-day-old plants and used for qRT-PCR analysis. The relative expression ratio of the transcripts was shown to be calibrated with expression of BrEF-1-α. The height of each bar and the error bars indicate the mean and standard error, respectively, from three independent measurements.

under blue light irradiation compared to other light conditions. In addition, quercetin and kaempferol content increased by >4fold (up to 4.8 ± 0.59 and 7.48 ± 0.91 μg g−1, respectively). Ferulic acid content increased by roughly 2-fold (up to 10.6 ± 2.01 μg g−1) during blue light irradiation. The maximum phydroxybenzoic acid, ferulic acid, and quercetin content was obtained by blue light irradiation at 12 DAI, at which time the chlorogenic acid, benzoic acid, and quercetin contents almost reached their highest levels. This highest accumulation of phenylpropanoids by blue light irradiation coincided with the increased expression of BrF3H, BrF3′H, BrFLS, and BrDFR during irradiation. On the other hand, red light irradiation had a noticeable effect on ferulic acid accumulation. Ferulic acid content increased by about 2.7-fold to its highest level (19.52 ± 1.47 μg g−1) under red light irradiation. Quercetin and kaempferol content only slightly increased. Br4CL2, Br4CL3,

compounds, including chlorogenic acid, are also present in Chinese cabbage.19 In our HPLC-UV analysis, p-hydroxybenzoic acid, ferulic acid, chlorogenic acid, quercetin, and kaempferol were detected in the seedlings of Chinese cabbage (Table 2). The phenolics found at the highest quantities were p-hydroxybenzoic acid (up to 49.06 ± 2.15 μg g−1), followed by cholorogenic acid. The effects of light irradiation on the accumulation of phenolic compounds appeared to differ with different light conditions. White light irradiation led to the accumulation of kaempferol (up to 7.71 ± 1.23 μg g−1) and the reduction of phydroxybenzoic acid and quercetin content. Chlorogenic acid content remained unchanged during white light irradiation. Blue light led to the accumulation of all detected phenolic compounds at 6 DAI. In particular, p-hydroxybenzoic acid content was noticeably raised (up to 49.06 ± 2.15 μg g−1) D

DOI: 10.1021/acs.jafc.5b02086 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 3. Accumulation (μg g−1) of Phenolic Compounds in the Different Organs of Adult Chinese Cabbage Plantsa flower p-hydroxybenzoic acid chlorogenic acid ferulic acid quercetin kaempferol catechin

32.79 23.51 272.52 339.19 678.57 0

± ± ± ± ± ±

2.03 c 6.38 ab 2.06 d 18.87 b 3.05 c 0d

leaf 253.25 20.48 407.27 15.13 0 46.64

± ± ± ± ± ±

4.82 a 0.32 ab 15.24 a 5.74 a 0a 0.83 a

stem 0 15.79 95.12 0 0 18.23

± ± ± ± ± ±

0b 0.64 b 0.4 c 0a 0a 1.18 c

root 0 28.97 25.97 0 26.21 8.67

± ± ± ± ± ±

0b 0.63 a 0.48 b 0a 4.53 b 1.1 b

The flowers, leaves, stems, and roots were collected from more than three 85-day-old plants and used for HPLC-UV analysis. The means and standard deviations were obtained from three independent experiments. Letters a−c indicate significant differences among organs (P < 0.05).

a

BrCHS, BrCHI, BrF3H, and BrFLS were highly expressed at initial stage during red light irradiation, but this did not lead to high accumulation of quercetin and kaempferol. Under all light conditions, chlorogenic acid content remained unchanged. When combined with the gene expression results of this study, this finding indicates that blue light may induce the phenylpropanoid biosynthetic pathway, leading to an increase of many phenolic compounds in Chinese cabbage seedlings. In previous studies, blue light irradiation was effective in increasing rutin and cyanidin 3-O-rutinoside levels in buckwheat and total ployphenol content in lettuce. Many previous studies have revealed environmental factors that act as abiotic stresses inducing phenylpropanoids in plants, for example, excessive light, UV, pathogen attack, elicitation, wounding, heat and cold stress, nutrient deficiency, and heavy metal stress.2,20 It may be possible to employ the environmental factors as strategies to enhance phenylpropanoid biosynthesis in Chinese cabbage. However, they have some disadvantages, such as plant growth retardation, quality deterioration, and soil contamination, whereas the short-term LED light irradiation used in this study can be applied as a suitable method to increase phenylpropanoid content in seedlings of Chinese cabbage without negative effects on plant growth and quality and the environment. Although further studies are needed to apply this practice to Chinese cabbage grown in the field, the results in this study might be utilized as useful information to improve the nutritional quality of Chinese cabbage. Expression Profiles of Phenylpropanoid Biosynthetic Genes in Different Organs. The expression patterns of BrPAL, BrC4H, Br4CLs, BrCHS, BrCHI, BrF3H, BrF3Ls, BrFLS, BrDFR, and BrANS were analyzed in the flower, leaf, stem, and root of adult Chinese cabbage plants (Figure 3). BrPAL, BrC4H, and Br4CL1 were specifically expressed at the highest levels in the roots. The expression patterns of the three genes were fairly similar, with the highest transcript levels being recorded in the root, followed by the stem and leaf, and finally the flower. Br4CL1, Br4CL2, and Br4CL3 are the paralogous genes of 4-coumarate:coenzyme A ligase and showed different expression profiles according to the plant organs. The highest expression was detected in the root, leaf and stem, and flower, respectively. BrCHS, BrCHI, BrF3H, BrF3′H, and BrDFR displayed the highest transcription levels in the leaf and the lowest transcription levels in the root. High transcript levels of BrF3H and BrFLS were also detected in the flowers. In summary, the upstream genes of BrPAL, BrC4H, and Br4CL1 were highly expressed in the root, whereas all other genes were expressed at relatively abundant levels in the leaf or flower. Accumulation of Phenylpropanoids in Different Organs of Chinese Cabbage. The phenylpropanoid contents in different organs of adult Chinese cabbage plants were analyzed by HPLC-UV (Table 3). Along with the

phenolic compounds detected in seedlings, catechin was found in the leaves, stems, and roots, which is the flavonoid that is highly abundant in fruits and legumes.21 The highest phenolic compound content was obtained for kaempferol (up to 678.57 ± 3.05 μg g−1), whereas quercetin, ferulic acid, and phydroxybenzoic acid were also detected in great quantities. Among detected nonflavonoids, considerable levels of phydroxybenzoic acid were detected in the leaf (253.25 ± 4.82 μg g−1), whereas lower quantities were detected in the flower (32.79 ± 2.03 μg g−1). p-Hydroxybenzoic acid was not detected in the stem and root. The highest ferulic acid content was detected in the leaf (407.27 ± 15.24 μg g−1), followed by the flower (272.52 ± 2.06 μg g−1), stem (95.12 ± 0.40 μg g−1), and root (25.97 ± 0.48 μg g−1). Chlorogenic acid contents were similar among the different organs: root (28.97 ± 0.63 μg g−1), flower (23.51 ± 6.38 μg g−1), leaf (20.48 ± 0.32 μg g−1), and stem (15.79 ± 0.64 μg g−1). Interestingly, there was no significant difference in chlorogenic acid content in the different organs at the adult stages or in seedlings grown under different light conditions. High amounts of quercetin accumulated in the flower (339.19 ± 18.87 μg g−1), whereas only small amounts were detected in the leaf (15.13 ± 5.74 μg g−1). No quercetin was detected in the stem or root. Of note, high quantities of kaempferol were present in the flower (678.57 ± 3.05 μg g−1), with 25.9 times more kaempferol being present in the flower than in the root. The antioxidant effect of Brassica species may be attributed to those phenolic compounds, because phenolics, including quercetin and kaempferol, have higher antioxidant activities than vitamins and carotenoids.22 In the present study, quercetin and kaempferol specifically accumulated in the flowers of Chinese cabbage, indicating that greater nutritional benefits may be obtained from Chinese cabbage when the flowers are used. Relatively lower catechin content was detected compared to those of other flavonoids. Catechin content in the leaf (46.64 ± 0.38 μg g−1) was 2.5- and 5.4-fold higher than that in the stem (18.23 ± 1.18 μg g−1) and root (8.67 ± 3.05 μg g−1), respectively. Catechin was not detected in the flower. Many previous studies have revealed that the organ distribution of the phenylpropanoids was correlated with the expression patterns of PAL, C4H, and 4CL.23−25 However, in our results, the accumulation patterns of p-hydroxybenzoic acid and ferulic acid did not coincide with the expression patterns of BrPAL, BrC4H, Br4CL1, and Br4CL3, which are the genes responsible for their biosynthesis. It is well-known that phenylpropanoid metabolism in plants is an intricate network in which many enzymes are implicated. Multiple isoforms and paralogous genes might have redundant functions, and those synergistic regulations might complicate elucidating phenylpropanoid metabolism.26−28 In addition, the biosynthesis of nonflavonoids yet unidentified in Brassica species might also E

DOI: 10.1021/acs.jafc.5b02086 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

(9) Hossen, M. Z. Light emitting diodes increase phenolics of buckwheat (Fagopyrum esculentum) sprouts. J. Plant Interact. 2007, 2, 71−78. (10) Thwe, A. A.; Kim, Y. B.; Li, X.; Seo, J. M.; Kim, S.-J.; Suzuki, T.; Chung, S.-O.; Park, S. U. Effects of light-emitting diodes on expression of phenylpropanoid biosynthetic genes and accumulation of phenylpropanoids in Fagopyrum tataricum Sprouts. J. Agric. Food Chem. 2014, 62, 4839−4845. (11) Li, Q.; Kubota, C. Effects of supplemental light quality on growth and phytochemicals of baby leaf lettuce. Environ. Exp. Bot. 2009, 67, 59−64. (12) Garcia-Hernandez, M.; Berardini, T.; Chen, G.; Crist, D.; Doyle, A.; Huala, E.; Knee, E.; Lambrecht, M.; Miller, N.; Mueller, L.; Mundodi, S.; Reiser, L.; Rhee, S.; Scholl, R.; Tacklind, J.; Weems, D.; Wu, Y.; Xu, I.; Yoo, D.; Yoon, J.; Zhang, P. TAIR: a resource for integrated Arabidopsis data. Funct. Integr. Genomics 2002, 2, 239−253. (13) Xu, F.; Li, L.; Zhang, W.; Cheng, H.; Sun, N.; Cheng, S.; Wang, Y. Isolation, characterization, and function analysis of a flavonol synthase gene from Ginkgo biloba. Mol. Biol. Rep. 2012, 39, 2285− 2296. (14) Qi, J.; Yu, S.; Zhang, F.; Shen, X.; Zhao, X.; Yu, Y.; Zhang, D. Reference gene selection for real-time quantitative polymerase chain reaction of mrna transcript levels in Chinese cabbage (Brassica rapa L. ssp. pekinensis). Plant Mol. Biol. Rep. 2010, 28, 597−604. (15) Li, X.; Kim, J. K.; Park, S.-Y.; Zhao, S.; Kim, Y. B.; Lee, S.; Park, S. U. Comparative analysis of flavonoids and polar metabolite profiling of tanno-original and tanno-high rutin buckwheat. J. Agric. Food Chem. 2014, 62, 2701−2708. (16) Li, X.; Thwe, A. A.; Park, N. I.; Suzuki, T.; Kim, S. J.; Park, S. U. Accumulation of phenylpropanoids and correlated gene expression during the development of tartary buckwheat sprouts. J. Agric. Food Chem. 2012, 60, 5629−5635. (17) Loughrin, J. H.; Kasperbauer, M. J. Light reflected from colored mulches affects aroma and phenol content of sweet basil (Ocimum basilicum L.) leaves. J. Agric. Food Chem. 2001, 49, 1331−1335. (18) Rochfort, S. J.; Imsic, M.; Jones, R.; Trenerry, V. C.; Tomkins, B. Characterization of flavonol conjugates in immature leaves of pak choi [Brassica rapa L. ssp. chinensis L. (Hanelt.)] by HPLC-DAD and LC-MS/MS. J. Agric. Food Chem. 2006, 54, 4855−4860. (19) Harbaum, B.; Hubbermann, E. M.; Wolff, C.; Herges, R.; Zhu, Z.; Schwarz, K. Identification of flavonoids and hydroxycinnamic acids in pak choi varieties (Brassica campestris L. ssp. chinensis var. communis) by HPLC-ESI-MSn and NMR and their quantification by HPLCDAD. J. Agric. Food Chem. 2007, 55, 8251−8260. (20) Winkel-Shirley, B. Biosynthesis of flavonoids and effects of stress. Curr. Opin. Plant Biol. 2002, 5, 218−223. (21) Arts, I. C. W.; van de Putte, B.; Hollman, P. C. H. Catechin contents of foods commonly consumed in The Netherlands. 1. Fruits, vegetables, staple foods, and processed foods. J. Agric. Food Chem. 2000, 48, 1746−1751. (22) Cartea, M. E.; Francisco, M.; Soengas, P.; Velasco, P. Phenolic compounds in Brassica vegetables. Molecules 2010, 16, 251−280. (23) Xu, F.; Cai, R.; Cheng, S.; Du, H.; Wang, Y. Molecular cloning, characterization and expression of phenylalanine ammonia-lyase gene from Ginkgo biloba. Biologia 2008, 7, 939. (24) Singh, K.; Kumar, S.; Rani, A.; Gulati, A.; Ahuja, P. S. Phenylalanine ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H) and catechins (flavan-3-ols) accumulation in tea. Funct. Integr. Genomics 2009, 9, 125−134. (25) Rani, A.; Singh, K.; Sood, P.; Kumar, S.; Ahuja, P. S. pCoumarate:CoA ligase as a key gene in the yield of catechins in tea [Camellia sinensis (L.) O. Kuntze]. Funct. Integr. Genomics 2009, 9, 271−275. (26) Cochrane, F. C.; Davin, L. B.; Lewis, N. G. The Arabidopsis phenylalanine ammonia lyase gene family: kinetic characterization of the four PAL isoforms. Phytochemistry 2004, 65, 1557−1564. (27) Zhou, B.; Wang, Y.; Zhan, Y.; Li, Y.; Kawabata, S. Chalcone synthase family genes have redundant roles in anthocyanin biosyn-

affect their accumulation. Further studies can be performed to elucidate the genes corresponding to the organ-specific distribution of phenylpropanoids in Chinese cabbage. The organ-specific accumulation of quercetin, kaempferol, and catechin could be explained by the expression patterns of Br4CL3, BrF3H, and BrFLS, which were relatively high in the flower. Previous studies have revealed distinct functions and substrate specificities of the 4CL gene family for phenylpropanoid biosynthesis28−30 and the major role of FLS, which directs flux into flavonols such as quecertin and kaempferol,31,32 indicating these genes may be key regulators in flavonoid biosynthesis. Although we did not investigate expression profiles of all of the genes responsible for phenylpropanoids biosynthesis, our results revealed organ-specific distribution of phenylpropanoids and corresponding expression patterns of key biosynthetic genes in Chinese cabbage. In this study, we aimed to investigate light conditions that lead to accumulation of phenylpropanoids in Chinese cabbage and organ-specific distribution of the phenylpropanoids. The results of this study demonstrate that blue light is an effective light source to lead to enhancement of phenylpropanoid biosynthesis, and leaves and flowers are suitable organs from which to obtain specific phenylpropanoids from Chinese cabbage. Our results are expected to provide useful information for developing a strategy to enhance phenylpropanoid biosynthesis in Chinese cabbage.

■

AUTHOR INFORMATION

Corresponding Author

*(S.U.P.) Phone: +82-42-821-5730. Fax: +82-42-822-2631. Email: [email protected]. Funding

This research was supported by Golden Seed Project funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA), Ministry of Oceans and Fisheries (MOF), Rural Development Administration (RDA), and Korea Forest Service (KFS). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Cheynier, V. Polyphenols in foods are more complex than often thought. Am. J. Clin. Nutr. 2005, 81, 223−229. (2) Dixon, R. A.; Paiva, N. L. Stress-induced phenylpropanoid metabolism. Plant Cell 1995, 7, 1085−1097. (3) Bennett, R. N.; Wallsgrove, R. M. Secondary metabolites in plant defence mechanisms. New Phytol. 1994, 127, 617−633. (4) Middleton, E., Jr.; Kandaswami, C.; Theoharides, T. C. The effects of plant flavonoids on mammalian cells: implications for inflammation, heart disease, and cancer. Pharmacol. Rev. 2000, 52, 673−751. (5) Havsteen, B. H. The biochemistry and medical significance of the flavonoids. Pharmacol. Ther. 2002, 96, 67−202. (6) Borevitz, J. O.; Xia, Y.; Blount, J.; Dixon, R. A.; Lamb, C. Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 2000, 12, 2383−2393. (7) Johkan, M.; Shoji, K.; Goto, F.; Hashida, S.-n.; Yoshihara, T. Blue light-emitting diode light irradiation of seedlings improves seedling quality and growth after transplanting in red leaf lettuce. HortScience 2010, 45, 1809−1814. (8) Jeong, S. W.; Park, S.; Jin, J. S.; Seo, O. N.; Kim, G.-S.; Kim, Y.H.; Bae, H.; Lee, G.; Kim, S. T.; Lee, W. S.; Shin, S. C. Influences of four different light-emitting diode lights on flowering and polyphenol variations in the leaves of chrysanthemum (Chrysanthemum morifolium). J. Agric. Food Chem. 2012, 60, 9793−9800. F

DOI: 10.1021/acs.jafc.5b02086 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry thesis and in response to blue/UV-A light in turnip (Brassica rapa; Brassicaceae). Am. J. Bot. 2013, 100, 2458−2467. (28) Hamberger, B.; Hahlbrock, K. The 4-coumarate:CoA ligase gene family in Arabidopsis thaliana comprises one rare, sinapate-activating and three commonly occurring isoenzymes. Proc. Natl. Acad. Sci. U. S. A. 2004, 101, 2209−2214. (29) Gui, J.; Shen, J.; Li, L. Functional characterization of evolutionarily divergent 4-coumarate:coenzyme A ligases in rice. Plant Physiol. 2011, 157, 574−586. (30) Lu, S.; Zhou, Y.; Li, L.; Chiang, V. L. Distinct roles of cinnamate 4-hydroxylase genes in Populus. Plant Cell Physiol. 2006, 47, 905−914. (31) Davies, K.; Schwinn, K.; Deroles, S.; Manson, D.; Lewis, D.; Bloor, S.; Bradley, J. M. Enhancing anthocyanin production by altering competition for substrate between flavonol synthase and dihydroflavonol 4-reductase. Euphytica 2003, 131, 259−268. (32) Colliver, S.; Bovy, A.; Collins, G.; Muir, S.; Robinson, S.; de Vos, C. H. R.; Verhoeyen, M. E. Improving the nutritional content of tomatoes through reprogramming their flavonoid biosynthetic pathway. Phytochem. Rev. 2002, 1, 113−123.

G

DOI: 10.1021/acs.jafc.5b02086 J. Agric. Food Chem. XXXX, XXX, XXX−XXX