Amplified Oligonucleotide Sensing in Microliter Volumes Containing

The scanner has a lateral range of 125 × 125 μm and a vertical range of 5 μm. .... (white columns) and the intensity of the oxidation peaks GOx (gr...
0 downloads 0 Views 2MB Size
Download PDF
Anal. Chem. 2006, 78, 5179-5183

Amplified Oligonucleotide Sensing in Microliter Volumes Containing Copper Ions by Solution Streaming Stanislav Hasonˇ* and Vladimı´r Vetterl

Institute of Biophysics, Academy of Sciences of the Czech Republic, Kra´ lovopolska´ 135, CZ-612 65 Brno, Czech Republic

We present a simple, cost-effective design for amplifying oligodeoxynucleotide (ODN) sensing, in microliter ODN volumes containing copper ions, by solution streaming (bubbling). The inert gas streaming (bubbling) at a constant pressure of 0.04 bar drives the motion of a 30-µL ODN droplet containing a three-electrode circuit (inverted drop microcell), and in the presence of copper ions offers an ∼50-times improvement in the detection of ODN samples. The detection of ODNs at the carbon paste electrode is based on the enhancement of the oxidation peaks of purine bases (adenine and guanine) by the anodic stripping of the electrochemically accumulated complex of Cu(I) with purine base residues of acid hydrolyzed ODN samples (Cu(I)-ahODN complex). We used the proposed method for (i) the determination of the percentage content of adenine and guanine units within analyzed ODN samples at subnanomolar concentrations (related to monomer content) and (ii) the detection of the (TTC)n triplet expansion using magnetic DNA hybridization with reporter probes containing guanine units (the TTC trinucleotide repeat expansion is associated with serious hereditary diseases, including Friedreich ataxia). The amplified detection of DNA and synthetic oligonucleotide (ODN) samples is one of the major topics of current nucleic acid electrochemistry due to the fact that electrochemical signal transduction appears to be a useful alternative to the optical one, mainly due to lower costs, simple design, small dimension, and easy operability of the electrochemical instrumentation.1,2 In the 1980s, it was shown that nucleic acid bases and some other purine and pyrimidine derivatives can be determined by cathodic stripping voltammetry (CSV) at a hanging mercury drop electrode (HMDE) at nanomolar concentrations as sparingly soluble compounds with the electrode mercury.3-5 Later, it was shown that after acid hydrolysis of DNA, nanomolar concentra* To whom correspondence should be addressed. Phone: +420541517261. Fax: +420541211293. E.mail: [email protected]; [email protected]. (1) Palecˇek, E.; Fojta, M.; Jelen, F.; Vetterl. In The Encyclopedia of Electrochemistry; Bard, A. J, Stratsmann, M., Eds.; Wiley-VCH: Weinheim, 2002; Vol. 9, pp 365-429. (2) Tarlov, M. J.; Steel, A. B. In Biomolecular Films. Design, Function, and Applications; Rusling, J. F., Ed.; Marcel Dekker: New York, 2003, pp 545608. (3) Palecˇek, E. Anal. Biochem. 1980, 108, 129-138. (4) Palecˇek, E.; Jelen, F.; Juany, M. A.; Lasovsky, J. Bioelectrochem. Bioenerg. 1981, 8, 621-631. 10.1021/ac052227o CCC: $33.50 Published on Web 06/08/2006

© 2006 American Chemical Society

tions (related to monomer content) of unmodified DNA can be determined using CSV at the HMDE.6 Due to an acid treatment, purine bases are easily released from DNA, thus producing a mixture of the apurinic acid and free adenine and guanine.7 After this treatment, bases are electrochemically determined without separation from other products of the acid DNA degradation. Recently, a new method of DNA determination has been proposed that uses HMDE in the presence of copper ions, thus increasing the sensitivity by at least 1 order of magnitude to picomolar concentrations.8,9 This method of DNA detection is based on the cathodic stripping of the electrochemically accumulated sparingly soluble compounds of Cu(I) with purine base residues released from DNA chains (Cu(I)-ahDNA complex), which is similar to the previously reported detection of purine bases at a HMDE in the presence of copper.10,11 At the beginning of the 1990s, it was observed that the anodic stripping of the electrochemically accumulated Cu(I)-purine base complex increased ∼10-times the heights of the oxidation signals of guanine and adenine bases.12 We have adapted the voltammetric method based on the cathodic stripping of the electrochemically accumulated Cu(I)ahODN complexes to (i) the detection of the different homopurine ODN lengths at picomolar concentrations and (ii) the determination of the number of purine units within the ODN samples containing a random sequence of segments involving both the purine and pyrimidine units at the mercury-modified graphite electrodes 13 and solid amalgam electrodes.14 With the solid amalgam electrodes, we also used fast-scan voltammetry as a strategy to avoid oxygen interference in the unstirred 20-µL ODN analyzed volumes during the potential-controlled accumulation of (5) Palecˇek, E.; Osteryoung, J.; Osteryoung, R. A. Anal. Chem. 1982, 54, 13891394. (6) Palecˇek, E.; Billova´, S.; Havran, L.; Kizek, R.; Miculkova, A.; Jelen, F. Talanta 2002, 56, 919-930. (7) Jelen, F.; Fojta, M.; Palecˇek, E. J. Electroanal. Chem. 1997, 427, 49-56. (8) Jelen, F.; Yosypchuk, B.; Kourilova´, A.; Novotny´, L.; Palecˇek, E. Anal. Chem. 2002, 74, 4788-4793. (9) Jelen, F.; Miculkova´, A.; Pecˇinka, P.; Palecˇek, E. Bioelectrochemistry 2004, 63, 249-252. (10) Glodowski, S.; Bilewicz, R.; Kublik, Z. Anal. Chim. Acta 1986, 186, 3947. (11) Glodowski, S.; Bilewicz, R.; Kublik, Z. Anal. Chim. Acta 1987, 201, 1122. (12) Shiraishi, H.; Takahashi, R. Bioelectrochem. Bioenerg. 1993, 31, 203-213. (13) Hasonˇ, S.; Jelen, F.; Fojt, L.; Vetterl, V. J. Electroanal. Chem. 2005, 577, 263-272. (14) Hasonˇ, S.; Vetterl, V. Talanta 2006, 69, 572-580.

Analytical Chemistry, Vol. 78, No. 14, July 15, 2006 5179

the Cu(I)-ahODN complex.14 We have also shown that the anodic stripping of the Cu(I)-ahODN complex from the surfaceroughened glassy carbon electrode (15-µm abrasion particles for surface-roughening of GCE were used) makes it possible to increase by ∼20 times the detection of ODN samples.15 Quite recently, it has been demonstrated that the rotation of magnetic particles on the electrode surfaces by means of external rotating magnets leads to an amplified detection of DNA, hybridization of DNA, and antibodies.16- 19 This Technical Note reports about amplified ODN sensing using an argon-bubbled, 30-µL, inverted drop microcell. The concept of argon bubble-driven microliter motion in the presence of copper ions makes it possible to increase by about 50 times the detection of ODN samples. It means that the use of inert gasbubbling to drive the motion of microliter volumes may extend the applicability of an adsorptive transfer stripping voltammetry,20 which was introduced in the middle of the 1980s (the adsorption of the DNA sample onto the electrode surface is performed from a stirred 5-µL drop at an open circuit), for the potential-controlled accumulation of the metal-DNA complexes on the chemically modified electrodes using a three-electrode circuit. Finally, we applied the proposed method for (i) the determination of percentage content of adenine and guanine units within the ODN samples at subnanomolar concentrations and (ii) the detection of the (TTC)n triplet expansion using magnetic DNA hybridization with reporter probes containing guanine units (the TTC trinucleotide repeat expansion is associated with serious hereditary diseases, including Friedreich ataxia21). EXPERIMENTAL SECTION Setup of the Inverted Drop Cell. As illustrated in Figure 1, a drop of solution is placed on the platinum plate that serves as the counter electrode. The reference and working electrodes touch the sides of the drop, forming the inverted electrochemical cell, analogous to the earlier used inverted drop cell on the basal plane highly ordered pyrolytic graphite surface.22 Our homemade inverted electrochemical microcell contains two independent mobile parts. The first is a platinum plate (area 25 mm2) where the analyzed drop is placed. The second part is formed by the reference (Ag|AgCl|3 M KCl) and working (carbon paste) electrodes, together with a thin plastic tube (0.3-mm diameter) feeding a pressure of 0.04 bar of argon into the analyzed ODN droplet (Figure 1). This gas streaming (bubbling) gives rise to a continuous motion (rotation) of the analyzed droplets whose volumes are changed between 15 and 30 µL. The working CPE is placed in a plastic body with an 1.0-mm-i.d. cavity. This plastic (15) Fojt, L.; Hasonˇ, S. J. Electroanal. Chem. 2006, 586, 136-143. (16) Katz, E.; Willner, I. J. Am. Chem. Soc. 2002, 124, 10290-10291. (17) Weizmann, Y.; Patolsky, F.; Katz, E.; Willner, I. J. Am. Chem. Soc. 2003, 125, 3452-3454. (18) Katz, E.; Weizmann, Y.; Willner, I. J. Am. Chem. Soc. 2005, 127, 91919200. (19) Zhu, X.; Han, K.; Li, G. Anal. Chem. 2006, 78, 2447-2449. (20) Palecˇek, E.; Postbieglova, I. J. Electroanal. Chem. 1986, 214, 359-371. (21) Campuzano, V.; Montermini, L.; Molto, M. D.; Pianese, L.; Cossee, M.; Cavalcanti, F.; Monros, E.; Rodius, F.; Duclos, F.; Monticelli, A.; Zara, F.; Can ˜izares, J.; Koutnikova, H.; Bidichandani, S. I.; Gellera, C.; Brice, A.; Trouillas, P.; De Michele, G.; Filla, A.; De Frutos, R.; Palau, F.; Patel, P. I.; Di Donato, S.; Mandel, J. L.; Cocozza, S.; Koenig, M.; Pandolfo, M. Science 1996, 271, 1423-1427. (22) McDermott, M. T.; Kneten, K.; McCreery, R. L. J. Phys. Chem. 1992, 96, 3124-3130.

5180 Analytical Chemistry, Vol. 78, No. 14, July 15, 2006

Figure 1. Schematic diagram of the inverted drop microcell: (1) platinum plate serving as a counter electrode (area 25 mm2); (2) plastic body containing the inner 1.0-mm-diameter cavity for the invariant position of the working electrode inside the analyzed droplet; (3) PTFE body of the working carbon paste electrode with a 0.5-mm-i.d. cavity; (4) stainless steel screw; (5) bridge of the reference electrode formed by the glass tube with diameter of 2 mm; (6) reference electrode (Ag|AgCl|3 M KCl); and (7) plastic tube (diameter 0.3 mm) feeding the inert gas into the analyzed ODN droplet.

body keeps an invariant position of the working electrode inside the analyzed droplet. A resin, Vycor, which is fixed at the end of a glass tube (2-mm diameter) containing the background electrolyte, makes it possible to connect the reference electrode with the analyzed solution. The carbon paste was made of 70% graphite powder (Aldrich) and 30% mineral oil (Sigma). This carbon paste was filled into the cavity of the PTFE electrode body to give a 0.5-mm-diameter disk surface. Electrical contact to its inner side was made with a stainless steel screw. Prior to measurements, the surface of CPE was mechanically polished on weighing paper. Instrumentation. All voltammetric experiments were performed with a three-electrode system, employing a platinum plate (25 mm2) counter electrode, a Ag|AgCl|3 M KCl reference electrode, and a CPE working electrode, as described above. Electrochemical data were recorded using a commercially available computer-controlled potentiostat (Autolab PGStat12, EcoChemie, Utrecht, The Netherlands). The differential pulse voltammetry (DPV) was applied with a pulse amplitude of 0.025 V, pulse width of 50 ms, and scan rate of 0.015 V s-1. All the DP voltammograms obtained were smoothed using a Savitsky-Golay algorithm, and the baseline was corrected by the moving average method, with a peak width of 1 mV, using the GPES (General Purpose Electrochemical System) software. DPV experiments with CPE were carried out at room temperature under the following parameters: potential of accumulation, EAC ) +0.09 V; accumulation time, tAC ) 8 min; analyzed droplet was bubbled by argon at a constant pressure of 0.04 bar. The measurements were performed in 0.2 M acetate buffer (pH 5.1) with 0.4 mM Cu(II). The AFM used was a Nanoscope III, operating in contact mode (Veeco, Santa Barbara, CA). The scanner has a lateral range of 125 × 125 µm and a vertical range of 5 µm. Chemicals. Oligodeoxynucleotides 80-mer (A80), 30-mers 5′TTCAGTCCTGGCTTTTCCTTTCTCCCAGAA-3′ (P(GA)4), 5′-AA-

GAGTCCTGGCTTTTCCTTTGAAGGAGAA-3′ (P(GA)8), 5′-AAGGGAAAAGGGAAGGGGAAAGAAGGGGAA-3′ (P(GA)15), 5′-TTCCCCTTCTTTCCCCTTCCCTTTTCCCTT-3′ (P(CT)15), 61-mers 5′-(TTC)4CATCCATTTCATTCTAATCCTTCT(A)25-3′ (T1), 5′-(TTC)8CAACTACCTCAT(A)25-3′ (T2), 5′-(TTC)12(A)25-3′ (T3), and 12-mer 5′-(GAA)4-3′ (RP) were purchased from the Thermo Electron (Ulm, Germany). The ODNs’ concentrations related to the monomer were determined spectrophotometrically using a Libra S22 spectrophotometer. Dynabeads oligo(dT)25 (DBT) and a magnetic particle concentrator, MPC-S, were supplied by Dynal A.S. (Norway). Hydrolysis of Oligodeoxynucleotides. Hydrolysis of ODNs was performed by adding 40 µL of 0.5 M HClO4 to the samples of the same volume of ODNs at concentrations of 2 µM and heating for 30 min at 75 °C. After heating, the samples were cooled and neutralized with NaOH. Under these conditions, only the purine bases are released from ODN chains. ODN Hybridization at Magnetic Beads. Aliquots (usually 40 µL) of DBT were washed twice in a 1:1 volume of 0.3 M NaCl + 50 mM phosphate buffer (pH 7.0), then 40 µL of target ODN (61-mers) solution at 2 µM concentration in the same buffer was added to the DBT. The samples were shaken in a Thermomixer Comfort (Eppendorf, Germany) for 30 min at 25 °C to allow hybridization between the target ODN in solution and the oligo(dT) chains on the bead surface. After capture of the target ODN, the beads were washed twice using 50 µL of phosphate buffer, then the reporter probe (RP) at 10 µM concentration in 40 µL of the phosphate buffer was added, and the bead suspension was shaken for 30 min under the same conditions, followed by washing of the DBT (five times with 100 µL of 0.3 M NaClO4) and release of the hybridized ODNs from the beads into 40 µL of triple-distilled water by heating the DBT suspension at 85 °C for 2 min. The samples were then used for acid hydrolysis with perchloric acid. RESULTS AND DISCUSSION Optimization of the ODN Detection Using the ArgonBubbled 30-µL Drop at a Constant Pressure of 0.04 Bar at the CPE in the Presence of Cu(II). In this Technical Note, we have introduced an electrochemical method, which is based on the anodic stripping of the electrochemically accumulated Cu(I)-ahODN complex from the CPE surface, for sensitive detection of ODNs using argon-bubbled microliter volumes. The potential-controlled accumulation of the Cu(I)-ahODN complex was performed at the potential of the oxidation peak of the copper metal (EAC ) +0.09 V). As illustrated in Figure 2, the CPE mechanically polished on a weighing paper has a rough surface characterized by irregularly shaped micrometer-size flakes of graphite. The cross-sectional AFM height analysis showed that the largest flakes have a height from 0.2 to 1.0 µm and a width from 1.0 to 4.7 µm. The CPE surface is characterized by a rootmean-square roughness (RMS) of ∼520 nm. The RMS is defined as a standard deviation of the height of the surface calculated from all points obtained during a given scan. It means that the CPE surface is rich in active sites for electrodepositing of copper 23,24 and forming of the Cu(I)-ahODN complex. We believe that the (23) Bodalbhai, L.; Brajter-Toth, A. Anal. Chim. Acta 1990, 231, 191-201. (24) Freund, M. S.; Brajter-Toth, A.; Cotton, T. M.; Henderson, E. R. Anal. Chem. 1991, 63, 1047-1049.

Figure 2. AFM image and the cross section of the AFM image of the CPE mechanically polished on the weighing paper.

Figure 3. (A) The differential pulse voltammograms of 0.2 M acetate buffer (pH 5.1) in the presence of (1) 0.4 mM Cu(II); (2) 100 nM A80; and (3, 4) 100 nM acid-hydrolyzed A80 + 0.4 mM Cu(II). Before the potential scan, the accumulation of the Cu(I)-ah(A80) complex under (3) the still and (4) argon bubbling conditions at the CPE was performed. The inset shows the dependence of the current of the oxidation peak AOx of ah(A80) on the concentration of the ah(A80) sample. (B) The current of the oxidation peak AOx of ah(A80) recorded after anodic stripping of the electrochemically accumulated Cu(I)-ah(A80) complex under the still (white columns) and argon bubbling (grey columns) preconcentration conditions for three different volumes of the analyzed solution. The values are means ( standard deviations of 20 experiments.

surface morphology (roughness) of the CPE responds the high sensitivity of the ODN detection in the presence of copper. After application of still preconcentration conditions, the 100 nM A80 the A80 contains only 80 adenine units) in the presence of 0.4 mM Cu(II) gives well-developed voltammetric peaks on the DPV at potentials of EI ) +0.36 V (peak IOx) and EA ) +1.09 V (peak AOx) (Figure 3A, curve 3). The first voltammetric signal (peak IOx) is attributed to the anodic stripping of the electrochemically accumulated Cu(I)-ah(A80) complex from the CPE surface. The more positive voltammetric signal (peak AOx) corresponds to the oxidation of adenine residues. As illustrated in Figure 3, the argon bubbles generated through the 30-µL analyzed drop make a significant increase the height of both peaks (curve 4). The gas bubbling gives rise to a continuous motion (rotation) of the analyzed droplet and, thus, accelerates the Analytical Chemistry, Vol. 78, No. 14, July 15, 2006

5181

Figure 4. (A) The parts of differential pulse voltammograms of 100 nM acid hydrolyzed 30-mer ODNs: (1) P(CT)15, (2) P(GA)4, (3) P(GA)8, and (4) P(GA)15. (B) Correlation between the number of guanine (adenine) units within the 30-mer ODNs (white columns) and the intensity of the oxidation peaks GOx (grey columns) and AOx (reticulated columns) providing that the number of guanine (adenine) units within the P(GA)4 sample was taken as 100%. The values are means ( standard deviations of 10 experiments.

transport of the electroactive species to the electrode surface, where the Cu(I)-ah(A80) complex is formed under controlled potential. We have found that the heights of peaks IOx and AOx are about 4- and 5-times higher (the charge calculated as the surface under the oxidation peaks IOx and AOx increases by a factor of ∼4 and 10) under the argon-bubble-driven analyzed droplet motion than that under still conditions in the presence of copper ions, respectively. When the DPV of A80 without copper ions was measured, only the peak AOx (the height of the peak AOx is ∼5-times lower than in the presence of copper) of adenine residues was observed (Figure 3A, curve 2). It means that the argon bubbling of the 30-µL ODN droplet containing copper ions increased by ∼50 times the detection of ODN samples. The inset of Figure 3A shows a linear concentration dependence of A80 in the range from 0.5 to 100 nM. Figure 3B shows that the argon bubbles generated through the 30-µL analyzed droplet yield a well-developed oxidation peak, AOx, of A80 as well as the stirred bulk solution (usually 3 mL; stirring rod, 3000 rpm). In addition, our designed inverted electrochemical microcell is still a powerful tool for sensitive ODN detection in the 15-µL droplets (Figure 3B). Determination of the Number of Guanine and Adenine Units within the 30-mer ODNs in the Presence of Cu(II). We applied the above-mentioned procedure for sensitive determination of the number of guanine and adenine units within the 30-mer ODNs containing both the purine and pyrimidine units at nanomolar concentrations. The analysis was carried out in the argon-bubbled 30-µL drop. We used four different 100 nM 30-mer ODNs in the presence of copper. Samples P(GA)4 and P(GA)8 contained random sequence segments involving 4 guanines + 4 adenines and 8 guanines + 8 adenines, respectively. The P(GA)15 and P(CT)15 contained only purine (15 guanine + 15 adenine) and pyrimidine (15 cytosine + 15 thymine) units, respectively. It can 5182 Analytical Chemistry, Vol. 78, No. 14, July 15, 2006

Figure 5. Correlation between the length of the (TTC)n trinucleotide repeats within the 61-mer target ODNs and the intensity of the oxidation peak GOx of guanine base residues that have been released from reporter probe-target ODN hybridization sequences by acidic hydrolysis. The values are means ( standard deviations of five experiments.

be seen from Figure 4A that the height of the peak GOx (oxidation of guanine residues) and AOx (oxidation of adenine residues) increased almost linearly with the number of guanine and adenine units within the 30-mer ODNs. The P(CT)15 containing only pyrimidine units produced appreciable DPV signal under the experimental conditions used. If the height of the oxidation peak GOx (AOx) obtained with P(GA)4 (30-mer involving 4 guanine, 4 adenine, and 22 pyrimidine units) was taken as 100%, then the height of peak GOx (AOx) exhibited 206 ( 12% and 379 ( 14% for 30-mer ODNs P(GA)8 (30-mer involving 8 guanine, 8 adenine, and 14 pyrimidine units) and P(GA)15 (30-mer involving only 15 guanine, and 15 adenine units), respectively (Figure 4B). These values were in agreement with the increasing percentage content of guanine and adenine units within three different 30-mer ODNs, if the number of guanine or adenine units within the P(GA)4 sample was taken as 100%. Our proposed method in connection with carbonbased electrodes is a powerful tool for the subnanomolar detection of ODN samples in microliter volumes, and overcomes the difficulty of the separation of adenine and guanine signals within the analyzed ODN samples. In the case of mercury-based electrodes, it is possible to detect only the total amount of purines in the analyzed samples; it is not possible to distinguish guanine and adenine.13, 14 Detection of the (TTC)n Triplet Expansion Using Magnetic DNA Hybridization with Reporter Probes Containing Guanine Units in the Presence of Cu(II). In this experimental protocol, we applied a proposed approach that allows accumulation of a reporter probe via hybridization to its target sequence in an ODN molecule captured on the surface of magnetic beads, that is, a “double-surface” (DS) method.8,25 The detection of trinucleotide repeat (TTC)n within the target ODN molecule captured at the magnetic beads is based on a partly modified (we (25) Palecˇek, E.; Fojta, M.; Jelen, F. Bioelectrochem. 2002, 56, 85-90.

used different final electrochemical detection strategy) protocol recently proposed by Fojta et al.26 The protocol contains the following steps, depicted in Figure 5: (i) the 61-mer target ODNs (T1, T2, and T3 containing 4, 8, and 12 trinucleotide TTC units, respectively) were hybridized via their 3′-terminal (A)25 stretches with the (T)25 capture probe; (ii) after magnetoseparation, the target ODN solution was removed, and the beads were washed; (iii) the 12-mer reporter probe containing four trinucleotide (GAA) units complementary to the target (TTC)4 was hybridized with the target ODNs captured at the beads; (iv) after the separationwashing procedure, the DNA molecules were detached from the beads by thermal denaturation in the triple-distilled water; (v) finally, the guanine base residues released from reporter probetarget ODN hybridization sequences ((GAA)n-(TTC)n) by acidic hydrolysis in perchloric acid were detected by anodic stripping of the electrochemically accumulated Cu(I)-guanine base residue complexes at the CPE. To obtain a response depending only on the triplet repeat length, the RP must be applied in sufficient excess (we used 10 µM RP), securing saturation of all possible binding sites in the target ODNs (we used 2 µM of three different 61-mer target ODNs). The final analyzed solution was 20-times diluted. Figure 5 shows a correlation between the length of the (TTC)n trinucleotide repeats within the 61-mer target ODNs and the intensity of the guanine base residues (peak GOx) released from the reporter probe-target ODN hybridization sequences by acidic hydrolysis. The height of the peak GOx increased almost linearly with the number of triplets, exhibiting 207 ( 13 and 324 ( 14% for target ODNs T2 and T3, respectively (the signal obtained with T1 was taken as 100%). It seems that one molecule of T1, containing 4 TTC triplets, can be expected to form a hybrid (26) Fojta, M.; Havran, L.; Kizek, R.; Billova, S.; Palecˇek, E. Biosens. Bioelectron. 2004, 20, 985-994.

with one RP molecule with 4 GAA triplets. The T2 and T3 target ODNs, involving 8 and 12 triplets, can adopt up to 2 or 3 RP molecules, respectively. CONCLUSION In this technical note, we have presented a simple and inexpensive method for amplifying oligodeoxnucleotide sensing in a 30-µL inverted drop micro-cell containing copper ions by the argon-streaming (bubbling) of analyzed volumes. The argon bubbles generated through the analyzed microliter volumes containing copper ions increased of about 50-times the detection of ODN samples. We have demonstrated that the proposed method in connection with carbon-based electrodes is a powerful tool for subnanomolar detection of ODN samples in microliter volumes and have overcome the difficulty of separation of adenine and guanine signals within the analyzed ODN samples. We have shown one possible strategy for the sensitive detection of TTC triplet expansion within the DNA molecules that is associated with serious hereditary diseases, including Friedreich ataxia. ACKNOWLEDGMENT This work was supported by the Grant Agency of the Academy of Sciences of the Czech Republic KAN200040651 (S.H.), A4004404 (V.V.), the Grant Agency of the Ministry of Education (LCO6035), and an institutional grant (AVOZ 50040507). The authors thank Dr. Petr Klapetek (Czech Metrology Institute, Brno, Czech Republic) for his help in obtaining the AFM data. Received for review December 16, 2005. Accepted May 10, 2006. AC052227O

Analytical Chemistry, Vol. 78, No. 14, July 15, 2006

5183