Laboratory Experiment pubs.acs.org/jchemeduc
An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection Kelly M. Elkins* and Raelynn E. Kadunc Chemistry Department and Criminalistics Program, Metropolitan State College of Denver, Denver, Colorado 80217-3362, United States S Supporting Information *
ABSTRACT: In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The primer DNA concentration was evaluated using UV−vis spectroscopy and dilutions were prepared for PCR based upon the absorbance at 260 nm and the theoretical extinction coefficient. In a previous lab, students were instructed in the use of the NCBI Web site to locate genes of interest, PubMed to search for primers, and Web tools to design primers; they were instructed in PCR theory in the paired lecture portion of the course and in previous laboratory sessions. As there are no educational kits for demonstrating real-time PCR, recently published TPOX primers directed at the forensic field in lieu of morecostly DNA quantification kits and purchased student-designed primers were used in conjunction with the iQ SYBR Green Supermix from Bio-Rad. Students pipetted the K562 standard DNA template, the primers, and the reaction mix into a 96-well plate. With the help of the instructor, they programmed the Bio-Rad iQ5 instrument to do gradient PCR. The instructor recovered the plate and data at the completion of the 3-h PCR experiment. In a subsequent laboratory session, the students ran agarose gels of the PCR products to confirm the length of the amplicons with a DNA ladder and analyzed the real-time PCR results. This laboratory was taught to the students enrolled in the second of a sequence of upper-level criminalistics undergraduate classes. Students interested in pursuing post-graduate study and research, technical work in an academic biochemistry or molecular biology or clinical laboratory, or employment as a DNA analyst in the crime lab setting will benefit most by this opportunity. This lab would also be suitable for upper-level biochemistry and molecular biology laboratories. KEYWORDS: Upper-Division Undergraduate, Biochemistry, Curriculum, Laboratory Instruction, Hands-On Learning/Manipulatives, Fluorescence Spectroscopy, Forensic Chemistry, Molecular Biology, Nucleic Acids/DNA/RNA
T
PCR, is used in forensic typing laboratories described previously for detecting Alu repeats and for short tandem repeats (STR) typing.2,3 However, real-time PCR detection is mentioned in only one of the articles in the context of genetically modified foods4 in this Journal. One article in Journal of College Science and Teaching reported the use of PCR for species identification.5 One real-time PCR article is focused on a problem-solving6 exercise. In the journal Biochemistry and Molecular Biology Education, there were 313 hits for PCR including a handful of new exercises demonstrating the use of real-time PCR in the undergraduate laboratory. The latter reports did not meet our need of an experiment that could be used in a DNA molecular biology course for students studying forensic chemistry to mimic the crime lab setting in which human DNA samples are routinely evaluated. However, a recent experiment is appropriate for forensics and uses realtime PCR to amplify canine, as opposed to human, nuclear DNA STRs.7 Another recently published real-time PCR experiment is appropriate for a biochemistry course as a mutant methyl malonyl-CoA mutase is probed.8 Real-time PCR
he real-time polymerase chain reaction (real-time PCR) is a method widely employed in molecular biology and biochemistry to detect the extent of gene expression, to quantify DNA yield, and to evaluate amplification in real time. It is also used to quantify the concentration of extracted DNA for stain identification in the forensic crime laboratory setting. Whereas graduates of our Forensic Education Program Accreditation Commission (FEPAC)-accredited program aspire to positions in a forensics laboratory, making this technique accessible to undergraduates has great practical value. It is not only important that students learn how to perform the experiment, but they also have to be able to analyze the data produced by such a powerful technique and understand its limitations in this age of trace DNA analyses. Unfortunately, the kits and methods employed by professional forensic laboratories for casework are too expensive to be used in an undergraduate setting. A recent search of the World Wide Web yielded several hits for the use of traditional PCR in the undergraduate laboratory curriculum including one article that discusses the use of PCR in the undergraduate biochemistry laboratory in The Chemical Educator1 and 92 hits in this Journal. PCR, but not real-time © 2012 American Chemical Society and Division of Chemical Education, Inc.
Published: March 2, 2012 784
dx.doi.org/10.1021/ed1006585 | J. Chem. Educ. 2012, 89, 784−790
Journal of Chemical Education
Laboratory Experiment
time PCR laboratory experiment is a commercial human DNA sample (K562) obtained from the Promega Corp.; this facilitates a prediction of the expected amplicon size as the genotype is known. To use student DNA in lieu of K562 DNA, the validated and published human PCR primers for TPOX may be successfully employed as the amplicon is not a STR and not a variable sequence and the amplicon can be predicted. This article describes the design and implementation of a real-time PCR laboratory in the undergraduate laboratory curriculum for upper-level chemistry students enrolled in a forensic DNA biology course for forensic science students (or biochemistry and molecular biology students enrolled in similar courses). The laboratory was designed to illustrate the use of DNA amplification techniques and DNA melt curve analyses, to evaluate the ability of student-designed primers to amplify DNA, to evaluate threshold cycles for dilutions, and to perform DNA quantification. During the first course offering, the laboratory was taught to nine students, and during the second course offering, the course was taught to seven students. The course is an upper-level undergraduate, four credit, 3-h lecture plus 3-h laboratory course offered to third- and fourth-year chemistry majors and is required for students pursuing the FEPAC-accredited B.S. in chemistry with a concentration in criminalistics. The prerequisites include organic chemistry II and analytical chemistry, both with the associated laboratories.
has been used to solve other problems. For example, real-time PCR was used in a virology course to amplify a synthetic HIV nucleic acid target.9 In other laboratories, real-time PCR has been used to amplify DNA for a restriction fragment length polymorphism (RFLP) analysis,10 to amplify DNA for mitochondrial DNA sequencing,11 to probe the Per3 gene that controls circadian rhythms,12 to probe gene production in a murine erythroleukemia cell line,13 to detect a sequence unique to transgenic plants,14 and to evaluate small inhibitory RNA knockdown of gene expression in osteoclasts in a semester-long sequence.15 Crowley has written about the use of the fluorescent detection feature of a plate reader to demonstrate the concept of real-time PCR to determine if a gene was transfected to bacteria.16 A recently published laboratory manual for the forensic chemistry lab does not have a real-time PCR experiment.17 As a result, this real-time PCR laboratory was developed based on primers published for use in the forensic community18 and extendable to using student-designed primers from the same class.19,20 Students in this class also design primers for STR sequences that are included in the Combined DNA Index System (CODIS) loci for DNA typing in the United States in a previous lab and test them in this real-time PCR experiment.20 In the 3-h weekly laboratory, students perform a project that focuses on human DNA analysis for most of the semester. After students become acquainted with quality pipetting techniques, study human and animal hair by microscopy, evaluate the presence or absence of body fluids by presumptive testing, and perform an introductory in silico lab to gain familiarity with DNA cloning, restriction enzymes, and Web tools including the NCBI database,21 students engage in human DNA analysis. The lab sequence begins with having students design PCR primers20 and evaluate their use in multiplexing,20 followed by real-time PCR to evaluate the ability of the primers to amplify the intended DNA loci, and agarose gel electrophoresis to size the amplicons (described herein). Thereafter, students are given the option of using cells donated by the instructor or preparing their own DNA samples by isolating DNA from their buccal cells. (Students are not penalized for not donating their own cells and are made aware that they may use donated cells to execute the lab experiment, in accordance with college policy.) They extract DNA from the buccal cells using the inorganic (Chelex)22 and organic (phenol−cholorform−isoamyl alcohol) methods.23 Students then estimate the quantity and quality of their extracted DNA using agarose gel electrophoresis and UV−vis spectroscopy and use real-time PCR to evaluate the quantity of their DNA. Subsequently, students amplify their DNA using a commercial multiplex kit prior to performing fragment analysis using capillary electrophoresis, analyze their DNA profile, and evaluate the random match probability of their profile. The final laboratory experiments are devoted to performing statistical analyses of paternity and missing persons data and analyzing DNA sequencing and single nucleotide polymorphism (SNP) results using freeware software. PCR primers designed by the students to amplify CODIS STR loci20 are employed in the real-time PCR laboratory and compared to validated PCR primers recently published for DNA quantitation in the crime laboratory.18 This study was approved by Metro State’s Institutional Review Board (IRB)− Human Subjects Review Committee (HSRC) and the students consented to participate in the study and to the release of the anonymous data shown here. The template used in the real-
■
MATERIALS AND METHODS PCR primers (IDT, Coralville, IA) were purchased to amplify a 64 base pair (bp) amplicon (58% GC content) of the Homo sapiens thyroid peroxidase (TPO) on chromosome 2 (NCBI Accession number: NG_011581) from bases numbered 81262−81325 (inclusive).18 The TPOXF 21 base pair, 5′primer sequence is CGGGAAGGGAACAGGAGTAAG and has a melting temperature of 57.0 °C. The TPOXR 22 base pair, 3′-primer sequence is CCAATCCCAGGTCTTCTGAACA and has a melting temperature of 56.8 °C. Student-designed forward and reverse primers20 (Table 1) were also purchased Table 1. Student-Designed Forward and Reverse Primers Purchased from IDT Locus TH01 D7S820 D5S818 D16S539 CSF1PO D13S317 D8S1179
Student-Designed Primers
Tm/°C
F: 5′-CCATTGGCCTGTTCCTCCCTTATT-3′ R: 5′-AGGGAACACAGACTCCATGGTGAA-3′ F: 5′-CGATTCCACATTTATCCTCATTGAC-3′ R: 5′-GGGTATGATAGAACACTTGTC-3′ F: 5′-AGCAAGTATGTGACAAGGGTG-3′ R: 5′-GTAATTGTCTCTCTCAGAGGAATGC-3′ F: 5′-TATGGGAGCAAACAAAGGCAGAT-3′ R: 5′-CAGCCTACAGAGTGATTCCATT-3′ F: 5′-GAGCACACACTCCAGGGCAGTG-3′ R: 5′-CCCAACCCACATGGTGCCAG-3′ F: 5′-AGTCTTCCTACCACTGAACAT-3′ R: 5′-GAAGGCTGAGGAAGGAGAAT-3′ F: 5′AACGAGGCCTTTTACAAGACATCTG-3′ R: 5′-ATGTGGAGAACTGAAACCCTGTGCA-3′
59.2 60.0 54.0 50.2 55.0 55.1 56.9 54.5 62.5 61.5 53.0 54.1 57.3 60.6
from IDT (Coralville, IA) with the standard desalting and 25 nmol concentrations and were designed to amplify CODIS STR loci including TH01, D7S820, D5S818, D16S539, CSF1PO, D13S317, and D8S1179 with amplicons 90−532 base pairs for K562 DNA (Table 2). Instructors may alternatively purchase CODIS STR primers published by 785
dx.doi.org/10.1021/ed1006585 | J. Chem. Educ. 2012, 89, 784−790
Journal of Chemical Education
Laboratory Experiment
Table 2. The CODIS Loci for the Student-Designed Primers
a
Locus
NCBI Accession Number
NCBI Genotype
STR Repeata
Size (bp) (NCBI)
K562 Genotype
Size (bp) (K562)
Predicted Tm/°C
TPOX TH01 D7S820 D5S818 D16S539 CSF1PO D13S317 D8S1179
M68651 D00269 AC004848 AC008512 AC024591 U63963 AL353628 AF216671
11 9 13 11 11 12 11.3 13
AATG AATG GATA AGAT GATA AGAT TATC TCTA
64 87 195 210 212 289 315 536
9, 9 9.3, 9.3 9, 11 11, 12 11, 12 9, 10 8, 8 12, 12
64 90, 90 179, 187 210, 214 212, 216 277, 281 300, 300 532, 532
78.0 75.9 76.3, 78.4, 80.7, 82.6, 81.7 82.6
76.5 78.4 80.7 82.7
Observed Tm/°C 81.0 77.5 76.0 77.0 79.5 82.5 84.0 80.0
The 5′ strand first repeat or as denoted in the literature.
μL K652 DNA template (Promega, Madison, WI) were pipetted using autoclaved tips, mixed, and amplified using the iQ5 instrument according to the following two-step protocol for a gradient plate: an initial 3 min denaturation at 95 °C and 40 cycles of denaturation at 95 °C for 15 s and annealing− extension gradient from 50 to 65 °C (50 °C, 51.1 °C, 53 °C, 55.7 °C, 59.5 °C, 62.3 °C, 64 °C, 65 °C) for 60 s. A melting curve was produced by conducting 91 cycles of 30 s of melting every 0.5 °C from 50 to 95 °C. The SYBR Green I excitation wavelength is 497 nm and the emission wavelength is 522 nm. The data are reported in relative fluorescence units (RFU). A 14-well, 2% agarose (Fisher, Waltham, MA) gel prepared using a 50 mL of 1× TAE (40 mM Tris-acetate, 1 mM EDTA, pH 8.0) (National Diagnostics, Atlanta, GA) buffer loaded with the DNA Logic molecular weight ladder (Lambda Biotech, St. Louis, MO) and the 20 bp ladder (Lonza, Basel, Switzerland) was used to confirm the size of the amplicon. After heating to dissolve the agarose, the gel material was cooled to
