An upconversion fluorescent aptasensor for polychlorinated biphenyls

Subscriber access provided by LUNDS UNIV

Article

An upconversion fluorescent aptasensor for polychlorinated biphenyls detection based on nicking endonuclease and hybridization chain reaction dual-amplification strategy Yu Wang, Jialei Bai, Bingyang Huo, Shuai Yuan, Man Zhang, Xuan Sun, Yuan Peng, Shuang Li, Jiang Wang, Baoan Ning, and Zhixian Gao Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b02159 • Publication Date (Web): 23 Jul 2018 Downloaded from http://pubs.acs.org on July 23, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

An upconversion fluorescent aptasensor for polychlorinated biphenyls detection based on nicking endonuclease and hybridization chain reaction dual-amplification strategy Yu Wanga, #, Jialei Baia, #, Bingyang Huoa, b, Shuai Yuana, Man Zhanga, Xuan Suna,Yuan Penga, Shuang Lia, Jiang Wanga, Baoan Ninga, Zhixian Gaoa, * [a] Tianjin Key Laboratory of Risk Assessment and Control Technology for Environment and Food Safety, Institute of Environmental and Operational Medicine, Academy of Military Medical Science, Academy of Military Science. Tianjin 300050, P.R. China [b] College of Food Science and Engineering, Jilin University, Changchun 130022, P.R. China * E-mail: [email protected]. Tel/fax, +86 22-84655403. ABSTRACT: A novel upconversion fluorescent aptasensor based on hybridization chain reaction and nicking endonuclease has been developed for detection of polychlorinated biphenyls (PCBs). It combined the dual advantages of UCNPs and HCR. Two harpins (H1 and H2) were first designed according to the partial complementary sequence (cDNA) of the PCB72/106. Since the aptamer specifically recognized the target, the cDNA was detached from the magnetic microspheres (MMPs). The cDNA could initiate hybridization chain reaction (HCR) and open the stems of H1 and H2. After the addition of nicking endonuclease, UCNPs were further away from the quenchers (BHQ-1). Hence, the fluorescence intensity of upconversion nanoparticals (UCNPs) could be restored via fluorescence resonance energy transfer (FRET). Therefore, the fluorescence of UCNPs was directly proportional to concentration of PCB72/106, which was the basis for the quantification of PCB72/106. PCB72/106 could be analyzed within the ranges of 0.004 ng/mL to 800 ng/mL with a detection limit of 0.0035 ng/mL (S/N = 3). The aptasensor was also used for the detection of water and soil samples, and the average recoveries ranged from 93.4% to 109.7% and 83.2% to 118.5%, respectively. The relative standard deviations (RSDs) were all below 3.2%. The signal was first amplified through HCR and further amplified with the help of nicking endonuclease. This work also provided the opportunity to develop fluorescent aptasensors for other targets using this dual-amplification strategy.

INTRODUCTION Polychlorinated biphenyls (PCBs), also known as chlorinated biphenyls, are synthetic organic compounds, and have 209 different PCB congeners. They are usually used in industry as heat carriers, insulating oils, and lubricating oils.1 They are extremely difficult to decompose, and they are able to accumulate in large amounts in the body fat and are persistent organic pollutants (POPs).2 Waste discharged from factories using PCBs is the main source of PCBs contamination. The widespread use of PCBs in the industry has caused global environmental pollution problems.3-5 PCBs waste generated during production can be absorbed by the human body through the skin, respiratory tract, and digestive tract. Even ultra-trace levels can be enriched in human tissues, seriously endangering human health and lives.6,7 With the emergence and development of new technology, it has become a hot topic to develop a method for PCBs monitoring and to use them for on-site inspection. Gas chromatography (GC) is a commonly used method for detecting PCBs.8 It has good sensitivity, but it is time-consuming, laborious and expensive. It is difficult to apply to on-site inspection. Current detection methods also include immunoassays,9 assay based on immuno-polymerase chain reactions,10 surface plasmon resonances (SPRs),11 and electrochemical magneto-immunosensors.12 However, the

sensitivity of these methods is general, and the operation is generally complicated. Therefore, it is necessary to further improve the sensitivity and convenience of PCBs detection sensors. The ability to detect PCBs with high sensitivity and simplification of procedures may aid in real-time on-site inspection and other tasks. Compared with the above detection methods, the analysis method based on the fluorescence spectrum shows the advantages of simplicity and high sensitivity, and has been widely used. Among them, quantum dots (QDs) are commonly used as fluorescent markers.13-15 For example, Beloglazova et al.16 used QDs as immunoprobes to establish an immunochromatographic method for the detection of zearalenone. Rare earth doped upconversion nanoparticles (UCNPs) are new type of material whose upconversion luminescence mechanism is derived from rare earth ions and can be converted into high energy visible light under the excitation of infrared light.17 NaYF4: Yb, Er are double-doped upconversion rare earth compounds with high quantum yield and strong fluorescence stability.18 Compared with QDs, UCNPs have the advantages of good stability, high luminescence, almost zero interference background, and long lifetime.19 Therefore, we chose UCNPs as signal output elements. Currently, monoclonal antibodies are still key

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

identifiers commonly used for rapid detection. However, there are some problems, such as time-consuming preparation and limitations of for identifying small-molecule chemicals.20 Aptamers have become an ideal alternative to antibodies due to their advantages of high specificity and high affinity, as well as ease-preparation and low cost relative to antibodies.21 Therefore, we chose aptamer as PCB72/106 recognition element. In order to further improve the detection sensitivity, hybridization chain reaction (HCR) has been gradually developed and received considerable attention. HCR is a novel enzyme-free nucleic acid polymerization,22,23 which belongs to isothermal amplification technology and greatly simplifies the requirements of the instrument. Each initial DNA can trigger HCR to form a super long-stranded DNA. The use of HCR can achieve signal amplification of the target molecule. Some research groups have been studying on the combination of HCR and detection. Xu et al.24 modified the fluorophore and quencher groups on the hairpins, and opened the hairpins through the HCR to recover the fluorescence and realize the detection of staphylococcal enterotoxin B (SEB). Li et al.25 combined the fluorescence quenching of gold nanoparticles (AuNPs) and HCR amplification to detect anterior gradient homolog 2 (AGR2). These methods have simple process but limited sensitivity. Due to the formation of long double-stranded DNA in HCR, the quencher groups and fluorophores did not reach the desired long distance after the hairpin opened. What’s more, most fluorophores had background values. So that the recovery of the fluorescence was incomplete, this would limit the detection sensitivity. Herein, we proposed a novel dual-amplification strategy for the detection of PCB72/106. For the first time, we combined HCR, UCNPs and nicking endonucleases for detection. The nicking endonuclease further enhances the amplification ability of the HCR. UCNPs replaced ordinary fluorophores to achieve highly sensitive detection of the target. The presence of the PCBs caused cDNA to dissociate from the aptamer, and cDNA was collected by magnetic separation. The cDNA as initiator strands could trigger the HCR to open the harpins, so that the fluorescence of the UCNPs could be restored to a certain degree. Then, the nicking endonuclease was added to cut one of the double-stranded DNA at a specific site. UCNPs were released from the long double-stranded DNA and further away from the quencher groups, which could contribute to the maximum recovery of fluorescence. It also proved to be a unique aptasensor that can be used for the detection of actual sample with high sensitivity, wide detection range, strong specificity and easy operation.

EXPERIMENTAL SECTION Reagents and apparatus All the reagents were of analytical grade, and Millipore-Q water (Millipore, 18.2 MΩ cm) was used in all experiments. Yb2O3, Y2O3, Er2O3, oleic acid (OA), 1-octadecylene (ODE), polyacrylic acid (PAA) and diethylene glycol (DEG) were obtained from Sigma-Aldrich (Shanghai, China). Ferric trichloride (FeCl3•6H2O), ethylene glycol (EG), trisodium citrate (Na3C6H5O7) and anhydrous sodium acetate

Page 2 of 8

(CH3COONa) were from Xiya Chemical Reagent (Shandong, China). Agarose (G-10, BIOWEST), genegreen was purchased from Tiangen Co., Ltd. (Beijing, China). 2,4,4'trichlorobiphenyl (PCB28), 2,2',5,5'-tetrachlorobiphenyl (PCB52), 2,3',5,5'-Tetrachlorobiphenyl (PCB72), 2,2',4,5,5'pentachlorobiphenyl (PCB101), 2',3',4',5,5'pentachlorobiphenyl (PCB106), chlorobenzene, and parathionmethyl were purchased from Accu Standard (New Haven, USA). Nt.BbvCI and Nt.BsmAI nicking endonuclease were from New England BioLabs (Ipswich, MA, USA). All DNA sequences were synthesized and subjected to HPLC purification by Sangon Co., Ltd. (Shanghai, China). The sequences of the synthetic DNA are shown in Tab. 1. Fluorescence measurements were performed using an F97pro device (Lengguang Tech.) with an external 980 nm laser diode (Hi-TechOptoelectronic Co. Ltd, China) as the excitation source. The morphology was investigated by a TECNAI G220 S-TWIN transmission electron microscopy (TEM, Japan) and an S-3500N scanning electron microscope (SEM, Hitachi Limited, Japan). Digital heating shaking drybath (TMS-200, Hangzhou, China), ImageQuant 350 gel imaging system and GeneQuant 1300 nucleic acid protein analyzer (GE Healthcare, USA) and were also used in the experiments. Tab. 1. DNA Sequences Employed in This Work Name

sequence (5′ ′−3′ ′)

Apt

biotin-TTTTTCACTCGGACCCCATTCTCCTT CCATCCCTCATCCGTCCAC

cDNA

GACAAGAGGGATGGGCTGAGGAGA

H1 H2

NH2C6-TTTCTCCTCAGCCCATCCCTCTTGTC GAAGGAGACAAGAGGGATGGGCTG-BHQ-1 BHQ-1-GACAAGAGGGATGGGCTGAGGAGA CAGCCCATCCCTCTTGTCTCCTTCTT-C6NH2

Synthesis of magnetic microspheres Synthetic and modification methods of Fe3O4 microsphere referred to previous report.26 FeCl3•6H2O (1.3 g, 4.8 mmol) and CH3COONa (3.5 g) was dissolved in ethylene glycol (40 mL) to form a solution, followed by the addition of Na3C6H5O7 (2.4 g). The mixture was stirred vigorously for 30 min and then sealed in a teflon-lined stainless-steel autoclave (50 mL capacity). The autoclave was maintained at 210 ℃ for 15 h, and cooled to room temperature. The black products were washed three times with ethanol and dried 60 ℃ for 6 h. The carboxylated magnetic microspheres (100 µL, 2 mg/mL) were activated with EDC (50 µL, 0.2 mg/mL) and NHS (25 µL, 0.2 mg/mL). Then, the modified MMPs were mixed with avidin (100 µL, 0.1 mg/mL) in PBS buffer. The mixture was transferred to a shaker at 37 ℃ for 2 h. After the reaction was completed, the products were washed three times with PBS buffer. Synthesis and surface modification of NaYF4:Yb,Er UCNPs UCNPs was synthesized by the high-temperature thermal decomposition method.27 2 mmol Re(CF3COO)3 (Y: Yb: Er =


Page 3 of 8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry 78%: 20%: 2%), 8 mmol sodium trifluoroacetate, and 40 mL organic solvent ( 20 mL OA/20 mL ODE) was added to a 100 mL three-necked flask and maintained at 100 ℃ for 1 h with nitrogen protection. It was then heated up to 320 ℃ and stirred magnetically at this temperature for 1 h. Then it was naturally cooled to room temperature, and anhydrous ethanol was added. The precipitate was obtained by centrifugation. After repeated washing with water and ethanol three times, the resulting UCNPs can be dissolved in various organic solvents such as cyclohexane, chloroform and the like. The surface modification procedure was based on the previous report.28 1 g PAA dispersed in 20 mL DEG, and the mixture was heated to 110 ℃ and stirred vigorously for 30 min. Then, the above UCNPs (60 mg) were dispersed into 4 mL toluene. The mixture was rapidly added to the solution containing PAA, and kept stirred at the temperature for 15 min in order to evaporate the toluene. It was maintained at 240 ℃ for 1 h. Then it was cooled to room temperature, and excess dilute hydrochloric acid was added. White precipitate was obtained by centrifugation, and the excess PAA was removed by washing with pure water three times. The resulting product had a carboxyl group modification on the surface and was dispersed in PBS for use. Gel electrophoresis To verify the HCR system, hairpin 1 (H1) and hairpin 2 (H2) samples were heated to 95 ℃for 10 min and slowly cooled to 25 ℃ within 2 h by using a PCR instrument. Different concentrations of initiator DNA (H0) reacted with 5 µM of H1 and H2 in the PBS buffer at 37 ℃ for 2 h. The 12% native polyacrylamide gel electrophoresis (PAGE) was prepared with 1×TBE buffer (90 mM Tris-HCl, 90 mM boric acid, 2 mM

EDTA, pH 7.9). Subsequently, the gel was run at 110 V for 90 min and stained with genegreen for 30 min. The gel was visualized by the ImageQuant system. Assay procedure of the fluorescence measurement The avidinized MMPs (50 µL, 10 mg/mL) were incubated with biotinylated aptamers (210 pmol) at 37 ℃ for 10 h to allow the aptamers were immobilised on the surface of MMPs. The solution of MMPs-apt (200 µL) and excessive complementary oligonucleotides (cDNA) were hybridized at 37 ℃ for 30 min, and the unreacted cDNA were removed by an external magnet. Then, 100 µL of PCB72/106 standard solutions at different concentrations were mixed with the 100 µL solution of the MMPs-apt-cDNA and incubated at 37 ℃ for 30 min. Subsequently, the supernatant of cDNA (180 µL) was liberated from the MMPs and transferred into the solution of H1/H2 (20 µL, 10 µM) to hybridize through HCR at 37 ℃ for 1 h. The carboxyl groups of UCNPs were activated with EDC and NHS, and the final concentration of UCNPs was 2 mg/mL. Then, the modified UCNPs were added to the HCR solution, and the mixture was incubated at 37 ℃ for 5 h. 15 U Nt.BbvCI, 15 U Nt.BsmAI and 10×NEB buffer (15 µL) were to the above mixture to reach a final volume of 150 µL. An enzyme-free comparative experiment was done at the same time. The fluorescence intensity of dual-amplification was detected after incubating with shaking at 37 ℃ for 1 h through an F97pro device, and the emission intensity of 544 nm was chosen as quantitative standard. The fluorescence intensity of the mixture without nicking endonuclease was detected under the same conditions.

Figure 1. Schematic illustration of the dual-amplification strategy for PCB72/106 detection of upconversion fluorescent aptasensor based on HCR and nicking endonuclease.



HCR and nicking endonucleases enabled sensitive detection of the target.

Detection of PCBs 72/106 in real samples Water samples and soil samples used in this study were obtained from Tianjin, China. The pretreatment methods for water and soil samples were based on previous reporters.29,30 PCB72/106 was added at five different concentrations: 0, 0.1, 1, 10, and 100 ng/mL (ng/g). Water sample (35 mL) and sodium chloride (6 g) were mixed in the separatory funnel, and n-hexane (2 mL) was added. It was shaken vigorously for 3 min, and then let it stand for 15 min. The supernatant was collected and dried under N2. Finally, the residue was redissolved in 1% methanol. Dry soil (5 g) was weighed into a flask and then n-hexane (5 mL) was added. The flask was placed in the ultrasonic bath for 30 min. Then the mixed solution was centrifuged at 10000 rpm for 10 minutes, and the supernatant was filtered by a 0.22 µm membrane. The filtrate was dried at room temperature with N2, and the residue was redissolved in 1% methanol for analysis.

Feasibility study and characterization

The principle of the upconversion fluorescent aptasensor was based on nicking endonuclease and hybridization chain reaction dual-amplification strategy. As shown in Figure 1, The aptamers/cDNA complex and MMPs were linked together by the interaction of streptavidin and biotin. In the absence of PCB72/106, the HCR process cannot be triggered and the UCNPs were connected to the hairpin. Since no doublestranded DNA was formed, UCNPs were not cut off by nicking endonucleases. A close distance between the UCNPs and the quenching group BHQ-1 resulted in fluorescence resonance energy transfer and the fluorescence was quenched. When the target was present, the aptamers recognized and bound to the target as they released the cDNA. The aptamer sequence of PCB72/106 is based on the work of Mehta et al.31 To further demonstrate the binding of aptamers to PCB72/106, we characterized the aptamer conformational variation by circular dichroism (CD), and the results were shown in Figure S1.

In order to confirm the feasibility of the sensor, we verified the detection principle. As shown in Figure 2a and b, the fluorescence intensity was the lowest without the presence of cDNA, and the presence of the nicking enzyme also had little effect on the fluorescence. Because hairpins were not opened, and UCNPs were in close proximity to BHQ-1. Fluorescence resonance energy transfer occurred, and the fluorescence of UCNPs was quenched. When the initiator chain (cDNA) was added, HCR was initiated, and the hairpins were opened. Therefore, UCNPs were far away from BHQ-1 to a certain degree, and the fluorescence was restored to a certain degree (c). If we added nicking endonuclease on this basis and cut specific sites to release UCNPs, the distance between UCNPs and BHQ-1 would be longer and the fluorescence would be further restored (d). In the FT-IR spectrum (Figure S2), we could find that the carboxyl group (COO-) stretching vibration peaks appeared at 1700 cm-1 and 1384 cm-1 after PAA modification of UCNPs, and the characteristic peak of oleic acid disappears. It was fully demonstrated that the carboxyl group was successfully modified on the surface of UCNPs. We also characterized the MMPs and UCNPs by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The particle size of the magnetic ball is approximately 300 nm (Figure S3). As shown in Figure 3, the UCNPs have a uniform particle size and good particle dispersity, and the particle diameter is approximately 30 nm, which is a spherical shape (A). It could be clearly seen after the connection of UCNPs to the long double-stranded DNA formed by HCR, the UCNPs were clustered together and were no longer uniformly dispersed, which also proved the success of the connection (B). In addition, it can be seen from the electrophoretic gel image (Figure S4) that there was only one clear band in the absence of cDNA (lane 3). This was because there was almost no non-specific hybridization between H1 and H2, and HCR cannot occur without cDNA. What’s more, when different concentrations of cDNA were added, new bands appeared in lanes 4 to 6 and the brightness gradually increased as the concentration of cDNA increased, suggesting that HCR had taken place.

The released cDNA initiated HCR as the initiator, and formed a long double-stranded DNA. Then it connected to the UCNPs. Since the hairpin structure was opened, the distance between the UCNPs and BHQ-1 was further away and the fluorescence was recovered. This is the first step of amplification. It was not difficult to find that the distance between UCNPs and BHQ-1 was not too far, which would affect the efficiency of fluorescence recovery to some extent. In order to further increase the sensitivity, we had also introduced nicking endonucleases. By designing the recognition site of the nicking endonucleases in the hairpin, after the HCR was initiated to form the double-stranded DNA, the nicking endonucleases cut at the specific site of the double-stranded DNA, and UCNPs left the double-stranded DNA and were away from BHQ-1. The fluorescence intensity was restored to a maximum level and the dual-amplification was achieved. The intensity of the UCNPs fluorescence signal was positively correlated with the concentration of PCB72/106, and could be quantitatively detected. The dual-amplification of

Figure 2. Fluorescence spectra of H1,H2 and UCNPs (a); H1,H2, UCNPs and nicking endonuclease (b); H1,H2, UCNPs and cDNA (c); H1, H2, UCNPs, cDNA and nicking endonuclease (d).

RESULTS AND DISCUSSION Principle for upconversion fluorescent aptasensor sensing assay


Page 4 of 8

Page 5 of 8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Figure 3. (A) TEM image of UCNPs and (B) UCNPs-HCR; inset: partially enlarged TEM image of UCNPs-HCR.

Optimization of the assay conditions The performance of the aptasensor could be affected by several factors including the HCR conditions, the conditions of MMPs and aptamers reaction, and the concentration of UCNPs. Figure 4A and B presented the optimal temperature and time of HCR. It was found that the recovery fluorescence intensity was maximum when the temperature was 37℃, and the recovery fluorescence intensity increased with the increasing reaction time. A plateau was acquired at 50 min. As shown in Figure 4C, the concentration of aptamers in the supernatant was positively correlated with the amount of aptamers. When the amount of aptamers was 210 pmol, the remaining amount of aptamers in the supernatant was the least, which demonstrating that 210 pmol was the optimal aptamers amount. Figure 4D showed that when the reaction was carried out for 2 h, there was only a slight decrease of aptamers in the supernatant. Hence, the reaction time of MMPs and aptamers was 2 h. The results on the effect of the concentration of UCNPs and reaction time of HCR products and UCNPs were shown in Figure 5. It clearly revealed that the recovery fluorescence intensity was maximum when the concentration of UCNPs was 2.5 mg/mL (A, B). The fluorescence intensity gradually decreased with the reaction time increased, because UCNPs were linked to DNA with quencher groups, the fluorescence intensity was quenched. Meanwhile, when the time increased to 5 h, the fluorescence intensity tended to stabilize (C, D). Hence, the reaction time of HCR products and UCNPs was set to 5 h.

Figure 5. (A) Spectra of fluorescence recovery intensity of the aptasensor with different concentrations of UCNPs; (B) effect of the concentration of UCNPs on fluorescence recovery intensity; (C) Spectra of the fluorescence intensity of aptasensor with different reaction time for UCNPs and HCR products; (D) effect of the reaction time for UCNPs and HCR products on fluorescence intensity.

Figure 6. (A) fluorescent spectra of the aptasensor in the presence of various concentrations of PCB72/106; (B) calibration curve of the fluorescence intensity for concentrations ranging from 0.004 ng/mL to 800 ng/mL; (C) fluorescent spectra of the sensor without nicking endonuclease for detection of different concentrations of PCB72/106; (D) calibration curve of the fluorescence intensity for concentrations ranging from 0.04 ng/mL to 80 ng/mL.

Fluorescence signal response of the aptasensor

Figure 4. (A) Effect of the temperature on HCR; (B) effect of the reaction time on HCR; (C) addition optimization of aptamer; (D) optimization of coupling reaction time between aptamer and MMPs.

Based on the above optimized experimental conditions, we further studied the relationship between the value of UCNPs fluorescence and concentration of PCB72/106. To obtain a standard curve, we detected PCB72/106 at different concentrations (0.004, 0.008, 0.02, 0.08, 0.32, 2, 16, 100, 800 ng/mL). As shown in Figure 6A and B, F increased with increasing concentration of PCB72/106 and exhibited a good linear relationship with the concentration of PCB72/106 in the



range of 0.004 - 800 ng/mL. The linear equation was F= 119.6366 lgC+618.8279 (R2=0.9978), and the detection limit was 0.0035 ng/mL (S/N = 3). The spectrums of the aptasensor without nicking endonucleases were shown in Figure 6C and D. The standard curve was F=84.2752 lgC+436.5031 (R2=0.9964). The detection range was from 0.04 ng/mL to 80 ng/mL and the detection limit was 0.04 ng/mL (S/N = 3). After addition of nicking endonuclease, the sensitivity of the aptasensor was increased by 10-fold, and the detection range was wider (more than one order of magnitude). Therefore, the aptasensor of HCR with the nicking endonuclease indeed had higher detection sensitivity and wider detection range than traditional HCR aptasensor. The comparison results between this method and other methods were shown in Tab. S1 (Supplementary). The result was better than those of most current methods. Specificity of the proposed assay In order to evaluate the specificity of the aptasensor, three structural analogues of PCB72/106 (PCB28, PCB52, PCB101) and two functional analogues of PCB72/106 (chlorobenzene, and parathion-methyl) were selected at two concentrations (10, 100 ng/mL). Figure S5 showed a good specificity towards PCB72/106, and the fluorescence intensity of PCB72/106 was significantly higher than that of the other analogues, because of a small amount of nonspecificity adsorption. The data revealed that the aptasensor exhibited good specificity to discriminate PCB72/106. Applications in the analysis To further assess the application of the proposed aptasensor in naturally contaminated samples, the concentration of PCB72/106 was measured by the developed method. The results were shown in Tab. S2. PCB 72/106 was found in sample 1 and sample A with the concentrations of 0.061 ng/mL and 0.187 ng/g, respectively. None of the other samples were detected to contain the target. Moreover, the average recoveries were range from 93.4% to 109.7% (water samples) and 83.2% to 118.5% (soil samples), respectively. The relative standard deviations (RSDs) for determinations were found to be in the range from 1.6% to 2.9% and 2.1% to 3.2%, respectively. It was indicated that the aptasensor would be accurate and the method could be applied in real sample monitoring.

Page 6 of 8

operation and a wide detection range. It has promising potential for broad applications in other hazardous compounds, environmental monitoring, and clinic. Our follow-up experiments will continue to increase the universality and stability of the aptasensor, making it more suitable for on-site and clinical detection.

ASSOCIATED CONTENT Supporting Information The following Supporting Information is available online: CD spectroscopy of aptamer and PCB72/106, FT-IR spectra of UCNPs and UCNPs-PAA, SEM images of the MMPs, polyacrylamide gel (12%) electrophoresis image of HCR products, fluorescence recovery intensity of the aptasensor in the presence of PCB72/106 and other analogues, comparison between this method and other methods in literatures, recovery of PCB72/106 at different concentration levels in water and soil samples (n =4). AUTHOR INFORMATION Corresponding Author * Z. Gao: e-mail, [email protected]; tel/fax, +86 22-84655403.

Author Contributions #These authors contributed equally. The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Notes The authors declare no competing financial interest. ACKNOWLEDGMENT The authors thank the National Natural Science Foundation of China (Grant No. 81602896, 81502847, 21477162) and the National Key Research and Development Program (Grant No. 2017YFF0104903, 2017YFC1200903) for funding this research project.

REFERENCES (1) Thomas, G. O. Polychlorinated Biphenyls. Encyclopedia of Ecology 2008, 85, 2872-2881.

CONCLUSION To conclude, the high sensitivity and excellent accuracy of upconversion fluorescent aptasensor for PCB72/106 detection confirmed that the dual-amplification strategy was very effective and can be used for the detection of other targets. To our best knowledge, this is the first time that innovatively introducing nicking endonuclease on the basis of HCR, which has further enhanced the recovery intensity of fluorescence and sensitivity, and solved the problem of limited recovery of fluorescence intensity in fluorescence detection with HCR. Moreover, magnetic separation technology is more conducive to real-time detection in the field. This robust aptasensor can be applied for the analysis of actual samples, and it is considered to have high sensitivity, excellent selectivity, easy

(2) Joshi, M. D.; Ho, T. D.; Cole, W. T.; Anderson, J. L. Determination of polychlorinated biphenyls in ocean water and bovine milk using crosslinked polymeric ionic liquid sorbent coatings by solid-phase microextraction. Talanta 2014, 118, 172-179. (3) Jones, K. C.; Voogt, P. D. Persistent organic pollutants (POPs): state of the science. Environ. Pollut. 1999, 100, 209221. (4) Li, Y. F.; Harner, T.; Liu, L.; Zhang, Z.; Ren, N. Q.; Jia, H.; Ma, J.; Sverko, E. Polychlorinated Biphenyls in Global Air and Surface Soil: Distributions, Air-Soil Exchange, and


Page 7 of 8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry Fractionation Effect. Environ. Sci. Technol. 2010, 44, 27842790. (5) Centi, S.; Silva, E.; Laschi, S.; Palchetti, I.; Mascini, M. Polychlorinated biphenyls (PCBs) detection in milk samples by an electrochemical magneto-immunosensor (EMI) coupled to solid-phase extraction (SPE) and disposable low-density arrays. Anal. Chim. Acta. 2007, 594, 9-16.

(19) Wang, F.; Liu, X. Recent advances in the chemistry of lanthanide-doped upconversion nanocrystals. Cheminform 2009, 38, 976-989. (20) Chihching Huang; Shenghsien Chiu; Yufen Huang, A.; Huantsung Chang, ‡. Aptamer-Functionalized Gold Nanoparticles for Turn-On Light Switch Detection of PlateletDerived Growth Factor. Anal. Chem. 2007, 79, 4798-4804.

(6) Safe, S. H. Polychlorinated Biphenyls (PCBs): Environmental Impact, Biochemical and Toxic Responses, and Implications for Risk Assessment. Crit. Rev. Toxicol. 1993, 24, 87-149.

(21) Chen, T.; Shukoor, M. I.; Chen, Y.; Yuan, Q.; Zhu, Z.; Zhao, Z.; Gulbakan, B.; Tan, W. Aptamer-conjugated nanomaterials for bioanalysis and biotechnology applications. Nanoscale 2011, 3, 546-556.

(7) Borgã, K.; Fisk, A. T.; Hargrave, B.; Hoekstra, P. F.; Swackhamer, D.; Muir, D. C. Bioaccumulation factors for PCBs revisited. Environ. Sci. Technol. 2005, 39, 4523-4532.

(22) Dirks, R. M.; Pierce, N. A. Triggered amplification by hybridization chain reaction. Proc. Natl. Acad. Sci. USA. 2004, 101, 15275-15278.

(8) Nikonova, A. A.; Gorshkov, A. G. Rapid Chromatography for the Determination of Polychlorinated Biphenyls by GCMS in Environmental Monitoring. Anal. Lett. 2011, 44, 12901300.

(23) Huang, J.; Gao, X.; Jia, J.; Kim, J. K.; Li, Z. Graphene Oxide-Based Amplified Fluorescent Biosensor for Hg2+ Detection through Hybridization Chain Reactions. Anal. Chem. 2014, 86, 3209-3215.

(9) Bender, S.; Sadik, O. A. Direct Electrochemical Immunosensor for Polychlorinated Biphenyls. Environ. Sci. Technol. 1998, 32, 788-797.

(24) Xu, Y. Y.; Huo, B. Y.; Sun, X.; Ning, B. A.; Peng, Y.; Bai, J. L.; Gao, Z. X. Rapid detection staphylococcal enterotoxin B in milk sample based on fluorescence hybridization chain reaction amplification. RSC Adv. 2018, 8, 16024-16031.

(10) Chen, H. Y.; Zhuang, H. S. Real-time immune-PCR assay for detecting PCBs in soil samples. Anal. Bioanal. Chem. 2009, 394, 1205-1211. (11) Hong, S.; Kang, T.; Oh, S.; Moon, J.; Choi, I.; Choi, K.; Yi, J. Label-free sensitive optical detection of polychlorinated biphenyl (PCB) in an aqueous solution based on surface plasmon resonance measurements. Sensor. Actua.t B-Chem. 2008, 134, 300-306. (12) Mascini, M. Detection of Polychlorinated Biphenyls (PCBs) in Milk using a Disposable Immunomagnetic Electrochemical Sensor. Anal. Lett. 2007, 40, 1371-1385. (13) Ren, M.; Xu, H.; Huang, X.; Kuang, M.; Xiong, Y.; Xu, H.; Xu, Y.; Chen, H.; Wang, A. Immunochromatographic assay for ultrasensitive detection of aflatoxin B₁ in maize by highly luminescent quantum dot beads. ACS Appl. Mater. Interfaces. 2014, 6, 14215-14222. (14) Wang, Z.; Wang, L.; Zhang, Q.; Tang, B.; Zhang, C. Correction: Single quantum dot-based nanosensor for sensitive detection of 5-methylcytosine at both CpG and non-CpG sites. Chem. Sci. 2018, 9, 1701. (15) Li, D. Y.; He, X. W.; Chen, Y.; Li, W. Y.; Zhang, Y. K. Novel hybrid structure silica/CdTe/molecularly imprinted polymer: synthesis, specific recognition, and quantitative fluorescence detection of bovine hemoglobin. Acs Appl. Mater. Interfaces. 2013, 5, 12609-12616. (16) Beloglazova, N. V.; Speranskaya, E. S.; De, S. S.; Hens, Z.; Abé, S.; Goryacheva, I. Y. Quantum dot based rapid tests for zearalenone detection. Anal. Bioanal. Chem. 2012, 403, 3013-3024. (17) Cheng, L.; Wang, C.; Liu, Z. Upconversion nanoparticles and their composite nanostructures for biomedical imaging and cancer therapy. Nanoscale 2013, 5, 23-37. (18) Wang, F.; Banerjee, D.; Liu, Y.; Chen, X.; Liu, X. Upconversion nanoparticles in biological labeling, imaging, and therapy. Analyst 2010, 135, 1839-1854.

(25) Li, Z.; Miao, X.; Cheng, Z.; Wang, P. Hybridization chain reaction coupled with the fluorescence quenching of gold nanoparticles for sensitive cancer protein detection. Sensor. Actuat. B-Chem. 2017, 243, 731-737. (26) Liu, J.; Sun, Z.; Deng, Y.; Zou, Y.; Li, C.; Guo, X.; Xiong, L.; Gao, Y.; Li, F.; Zhao, D. Highly Water ‐ Dispersible Biocompatible Magnetite Particles with Low Cytotoxicity Stabilized by Citrate Groups. Angew. Chem. Int. Edit. 2009, 48, 5875-5879. (27) Cheng, L.; Yang, K.; Shao, M.; Lee, S. T.; Liu, Z. MµLticolor In Vivo Imaging of Upconversion Nanoparticles with Emissions Tuned by Luminescence Resonance Energy Transfer. J. Phys. Chem. C. 2011, 115, 2686-2692. (28) Liu, C.; Wang, H.; Li, X.; Chen, D. Monodisperse, sizetunable and highly efficient β-NaYF4: Yb, Er (Tm) upconversion luminescent nanospheres: controllable synthesis and their surface modifications. J. Mater. Chem. 2009, 19, 3546-3553. (29) Qin, M. Y.; Zhang, X. S.; Kang, L.; Chen, G. C.; Yang, Q. Determination of Polychlorinated Biphenyls in Water Samples Using Automated Solid Phase Extraction and Molecular Sieve Dehydration Coupled with Gas Chromatography/Mass Spectrometry. Chinese. J. Anal. Chem. 2013, 41, 76-82. (30) Lin, S.; Gan, N.; Cao, Y.; Chen, Y.; Jiang, Q. Selective dispersive solid phase extraction-chromatography tandem mass spectrometry based on aptamer-functionalized UiO-66NH2 for determination of polychlorinated biphenyls. J. Chromatogr. A. 2016, 1446, 34-40. (31) Mehta, J.; Rouahmartin, E.; Dorst, B. V.; Maes, B.; Herrebout, W.; Scippo, M. L.; Dardenne, F.; Blust, R.; Robbens, J. Selection and Characterization of PCB-Binding DNA Aptamers. Anal. Chem. 2012, 84, 1669-1676.



Page 8 of 8

for TOC only


8

An upconversion fluorescent aptasensor for polychlorinated biphenyls

Recommend Documents