Analysis of in Situ LNA and DNA Hybridization Events on Microspheres

Subscriber access provided by University of Newcastle, Australia

Article

Analysis of in situ LNA and DNA hybridization events on microspheres Ngozi A. Eze, Richard S. Sullivan, and Valeria Tohver Milam Biomacromolecules, Just Accepted Manuscript • DOI: 10.1021/acs.biomac.6b01373 • Publication Date (Web): 24 Feb 2017 Downloaded from http://pubs.acs.org on February 26, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biomacromolecules is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Analysis of in situ LNA and DNA hybridization events on microspheres Ngozi A. Eze†, Richard S. Sullivan†, and Valeria T. Milam*,†,‡,§ †

‡

School of Materials Science and Engineering

Wallace H. Coulter Department of Biomedical Engineering

§

Parker H. Petit Institute for Bioengineering and Bioscience

Georgia Institute of Technology, 771 Ferst Drive NW, Atlanta, GA 30332-0245 Keywords: duplex, hybridization rate constant, colloid, polystyrene, modified oligonucleotides

ACS Paragon Plus Environment

1

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 33

Abstract The hybridization activity of single-stranded DNA and locked nucleic acid (LNA) sequences on microspheres are quantified in situ using flow cytometry. In contrast to conventional sample preparation for flow cytometry that involves several wash steps for post-hybridization analysis, the current work entails directly monitoring hybridization events as they occur between oligonucleotide-functionalized microspheres and fluorescently-tagged nine or fifteen base-long targets. We find that the extent of hybridization between single-stranded, immobilized probes and soluble targets generally increases with target sequence length or with the incorporation of LNA nucleotides in one or both oligonucleotide strands involved in duplex formation. The rate constants for duplex formation, on the other hand, remain nearly identical for all but one probetarget sequence combination. The exception to this trend involves the LNA probe and shortest perfectly matched DNA target which exhibit a rate constant that is an order of magnitude lower than any other probe-target pairs, including a mismatched duplex case. Separate studies entailing brief heat treatments to suspensions generally do not consistently yield appreciable differences in associated target densities to probe-functionalized microspheres.


2

Page 3 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Introduction LNA is an oligonucleotide analogue in which the ribose sugar moiety is locked in a C3′-endo conformation via a 2′-O, 4′-C methylene linker.1 Incorporation of LNA nucleotides in sequences has been shown to result in enhanced chemical stability against nucleases, thermal stability against duplex dissociation, as well as greater specificity in hybridization activity with complementary DNA, RNA, and LNA targets2-6—important advantages for applications ranging from detection to therapeutics.7-14 The enhanced base pairing stability of LNA-containing sequences is attributed to both enthalpic and entropic factors. First, the increase in the A-type helical structure reported for LNA-based duplexes is thought to promote stronger base-stacking interactions than found in the B-type helix for pure DNA:DNA duplexes.15,16 Next, while the deoxyribose in DNA duplexes largely prefers the C2′-endo conformation, the sugar moiety can transition between two conformational states in single-stranded DNA (ssDNA).17,18 Since the sugar moiety is already conformationally locked in LNA, the entropic penalty for LNA hybridization events is reduced.2,16,19 The effect, however, of each modification on either enthalpic or entropic factors, or both, is highly sequence- and context-specific.20 While the hybridization activity of natural oligonucleotide solutions has been studied for decades, less is known about the hybridization activity of these newer synthetic oligonucleotides. Existing reports on LNA hybridization have focused on thermodynamic studies of oligonucleotide solutions in which no strands are conjugated to a material surface15,16,19-24 and on biotechnological applications of LNA hybridization such as microarrays and gene therapy in which strands may or may not be immobilized to a surface.4,25-33 Many of the thermodynamic studies of LNA solutions have extracted sequence-specific thermodynamic parameters from experimental melting temperature values and heat capacity


3

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 33

data.2,3,19,22 While a robust nearest neighbor model developed for DNA-DNA hybridization encompasses key sequence variables such as internal and end mismatches34,35 and newer models address additional parameters such as noncomplementary spacer segments36 and the effects of immobilization37, current DNA models cannot be directly extended to strands incorporating one or more LNA nucleotides in the sequence. Nearest-neighbor models based on LNA:DNA hybridization20,23,24 include an expanded set of sequence parameters that allow for control over the number, composition, and order of both bases and sugar groups (i.e., natural deoxyribose in DNA vs. modified ribose for LNA) in a given sequence and its partner strand. Current models, for example, can account for both internal mismatches and consecutive LNA nucleotides in a sequence, but are only applicable to the hybridization of a pure LNA sequence or an LNA-DNA mixmer sequence to a pure DNA sequence, and not to the pairs of LNA-DNA mixmers studied here or in related work38. Despite the lack of applicable thermodynamic models, it has been experimentally demonstrated that incorporation of up to 50% LNA nucleotides in a DNA sequence has additive effects on increasing the melting temperature values15,16,39 and nuclease resistance is substantially improved by using mixmers comprised of 33% LNA38. These practical findings are important for LNA-based applications due to the substantially greater cost of incorporating LNA nucleotides into oligonucleotide sequences. While less explored than DNA solutions, hybridization activity of immobilized DNA is known to depend on sequence parameters such as probe density, base length, and salt concentration with reports of either enhanced40,41 or suppressed42,43 duplex stability compared to oligonucleotide solutions. The thermodynamics of LNA hybridization activity on particles has been studied to an even lesser extent, but one study reports the melting temperature of immobilized LNA duplexes exceeds that of analogous DNA duplexes in solution.44 Direct


4

Page 5 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

comparison of the same LNA sequences in another study indicates that the duplex melting temperature is increased by immobilizing LNA duplexes.45 Consistent with the limited number of melting studies for LNA-based duplexes to extract sequence-specific thermodynamic parameters,19-21,23,24,46,47 there are relatively few hybridization kinetics studies on this synthetic oligonucleotide for either solution-based22,48-51 or substratebased52,53 systems. Some report no significant differences in the overall hybridization kinetics occur for various combinations of DNA:DNA, LNA:DNA, and LNA:LNA duplexes in solution.48,49 Select kinetics studies do indicate, however, that the enhanced thermal stability of LNA-based duplexes stems from slower spontaneous duplex dissociation while duplex association rate constants remain relatively similar under identical solution conditions (e.g., salt concentration).48,49,52 These kinetics effects apply to both pure LNA strands48 and LNA-DNA mixmer strands.48,49,52 Similar to DNA54, other studies50,51,55 indicate that hybridization profiles for LNA can also be affected by intrastrand secondary structures—a competing effect often enhanced by the higher binding affinity intrinsic to LNA. While there is less consensus among kinetics studies for LNA solutions, the kinetics of duplex formation between single-stranded DNA sequences in solution has been well studied, yielding functional kinetics models56,57 and association rate constants52, 56-58 of ~105–106 M-1s-1. By comparison, reported48,49 association rate constants for duplex formation in solution between LNA and either DNA or LNA are ~106–107 M-1s-1, but in each case the association rate constants for equivalent DNA sequences are the same order of magnitude as their LNA counterparts. While intrastrand secondary structures are predicted to be unlikely in the pure DNA sequences used in this study58, the lack of predictive tools to estimate thermodynamic parameters for modified oligonucleotides provides less certainty for extending these same assumptions to LNA-DNA mixmers. Motivated by this


5

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 33

uncertainty as well as prior unrelated work59 on particles functionalized with DNA aptamer sequences predicted to self-hybridize, the current work includes studies of heat treatment effects on hybridization activity of particle-immobilized mixmer sequences. Similar to the thermodynamics studies, it had been demonstrated that solution-based parameters for DNA do not necessarily allow for accurate predictions of hybridization kinetics for immobilized strands.60 Prior work61 comparing immobilized and soluble forms of otherwise identical oligonucleotide sequences indicates that attaching DNA to a solid-phase support such as microspheres leads to slightly slower association rate constants (~105 M-1s-1) compared to oligonucleotide solutions (~106 M-1s-1). A separate study62,63 reported similar association rate constants of ~104 M-1s-1 between DNA-functionalized microspheres and DNA targets of varying base-length and sequence fidelity. Intrastrand secondary structures, however, have a marked effect on slowing hybridization kinetics of both immobilized and soluble DNA strands60 while substituting single-stranded probes with double-stranded probes, each possessing a singlestranded segment or toehold at the dangling end, reportedly increases the association rate constant up to 5-fold for an invading target sequence in DNA-functionalized gold nanoparticle suspensions64. Expanding these kinetics studies for immobilized strands to include LNA nucleotides can entail several parameters including the sequence context of LNA substitutions, mismatches, and total sequence length; however, factors ranging from sensitivity to target labeling requirements depend on the type of assay used.53,65,66 Hybridization kinetics studies on planar substrates52 indicate a nearly ten-fold reduction in the target dissociation rate constant for LNA-based strands over DNA, a result similar to solution-based LNA kinetics studies48,49,52. To our knowledge, however, these kinetics studies on planar substrates have not been extended to monitor the in situ


6

Page 7 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

hybridization activity of LNA on microspheres which can serve as mesoscale building blocks in assembly and disassembly schemes as well as substrates for oligonucleotide sensing and separation. Here, the current work expands on our previous work62,63 conducted on pure DNAbased colloidal systems to monitor and compare early hybridization events between various single-stranded LNA-DNA mixmers as well as their isosequential DNA analogues.

Experimental methods Oligonucleotide sequences All DNA sequences (IDT Technologies, Coralville, IA) and LNA sequences (Exiqon, Woburn, MA) were purchased from the manufacturer and purified by HPLC prior to arrival. The choice of sequences in Table 1 is based on previous studies using LNA-DNA mixmers in colloidal assembly schemes.38 For simplicity, all pure DNA sequences will be referred to as DNA probes or DNA targets while “mixmer” sequences incorporating both DNA and LNA nucleotides will be referred to as LNA probes and LNA targets. Briefly, upon arrival, the lyophilized sequences are suspended at a 100 µM concentration in Tris-EDTA (TE) buffer either at pH 8.0 for sequences that are fluorescently labeled with 6-carboxyfluorescein (FAM) or at pH 7.4 for sequences that are aminated. All sequences are aliquoted and then stored at -20 °C until use. The nomenclature of the sequences is as follows: complementary strands used for hybridization are labeled either A or B according to their function as either a probe or target, respectively. This letter is followed by either the total number of bases in the sequence for immobilized probe strands and soluble, labeled targets. For the targets, this number is also equivalent to the number of bases intended to participate in hybridization events with immobilized probes. Incorporation of LNA at every third base is designated by the term L3 which precedes the A/B label. For


7

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 33

example, the 20 base-long LNA probe is labeled L3A20, whereas a 9 base-long, perfectly matched DNA target is labeled B9. Mismatched targets include the letter M in their nomenclature instead of the letter B. All targets are fluorescently tagged with FAM at their 5′ end. The LNA sequences are designed such that the LNA nucleotides on probes hybridize to LNA nucleotides on targets where relevant. Immobilization of multiple copies of aminated probe sequences (A20 or L3A20) onto carboxylated polystyrene microspheres (Bangs Laboratories, Fishers,

IN)

is

carried

out

similarly

as

described

before,

using

1-ethyl-3[3-

dimethylaminopropyl]-carbodiimide hydrochloride (EDAC) at a 7.1 mM concentration as a coupling agent.58,62,63

Table 1 List of the function and nomenclaturea of various DNA and LNA sequences. Values of Gibbs free energy of hybridization at 37 °C, ∆Ghyb, are provided for duplexes comprised of DNA targets hybridized to DNA probes.

Function

Sequence

∆Ghyb (kcal/mol)

immobilized DNA probe

A20 =

immobilized LNA probe soluble DNA 1° targets

L A20 = 3'–TALGTCLGGCLGTTLAGGLTTTTTT–5' B9 = 5'–ATCAGCCGC–3' B15 = 5'–ATCAGCCGCAATCCA–3'

soluble LNA 1° targets

L3B9 = 5'–ATLCAGLCCGLC–3' L3M9 = 5'–ATLCACLCCGLC–3'

3'–TAGTCGGCGTTAGGTTTTTT–5'

3

-19.6 -31.5

L3B15 = 5'–ATLCAGLCCGLCAALTCCLA–3' noncomplementary target

NC14 = 5'–TAGTCGGCGTTAGG–3'

-3.6

Sequence names that contain an “L3” prefix have been designed with an LNA nucleotide substituted at every third position in the intended hybridization segment and are marked by a superscript “L” to the right of the base. An underlined base indicates the location of a single, center mismatch. The ∆Ghyb values for A20 probe and DNA target duplexes were determined using the IDT OligoAnalyzer Hetero-Dimer function (https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/; accessed 08/08/2012). Notably, analogous analytical tools for determining ∆Ghyb values for hybridization between mixmer sequences possessing LNA nucleotides were not available. a


8

Page 9 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Suspension preparation for 30 min target incubation with and without heat treatment To separately evaluate the effects of heat treatment and posthybridization wash steps, suspensions are evaluated only at the 30 min time point. For all suspension cases with heat treatment, both the microsphere suspensions and the target solution are first separately warmed to 60 °C (prior to mixing), mixed together and then allowed to cool for 29 min under room temperature conditions while the untreated suspensions involve room temperature target incubation conditions. Notably, for simplicity, the term “heat treatment” rather than “annealing” is used due to the relatively short cooling time employed here in order to monitor early hybridization events (in contrast to slower cooling conditions more commonly reported as annealing conditions for DNA-functionalized colloidal suspensions67,68). For either heat-treated or untreated suspensions, the handling conditions are otherwise identical as described next. A 1 µL volume of A20- or L3A20-functionalized microspheres at a 1% w/v loading in PBS/Tween (0.2% v/v solution of Tween 20 surfactant in phosphate buffered saline) is added to 1 mL of 1 µM FAM-labeled target solution and vortexed. Following a 29 min incubation with target strands, the sample is vortexed and split into two 0.5 mL aliquots. The first aliquot is immediately placed in the flow cytometer and, after a reliable signal is obtained (~1 min), fluorescence measurements of 10,000 events are taken. The second 0.5 mL aliquot is washed three times in 100 µL PBS/Tween and then resuspended in 0.5 mL PBS/Tween. In situ hybridization measurements In situ hybridization experiments are performed similarly as described in a previous DNA study.62,63 Briefly, a 2.5 µL volume of A20- or L3A20-functionalized microspheres at a 1% w/v loading in PBS/Tween is added to a 1 mL volume of a 1 µM target solution (B9, B15, L3M9, L3B9, or L3B15) in PBS/Tween. The bead suspension is then quickly vortexed, and then


9

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 33

introduced to the flow cytometer. Notably, the mixing step itself marks the start of the target incubation time (i.e. t = 0). After a reliable signal is obtained, two to four separate measurements (each consisting of 10,000 events) are taken at 0 < t < 60 s followed by measurements every minute for the next 29 min. Each timed measurement is complete in less than 10 s. Flow cytometry A Becton Dickinson LSRII flow cytometer (Becton Dickinson, San Jose, CA) is used to quantify FAM-labeled duplexes on populations of microspheres diluted to 1 mL in PBS/Tween. For select cases involving high ionic strength solution, PBS/Tween with additional salt (to yield a 1000 mM NaCl solution) is used as the hybridization buffer for in situ studies. Data acquisition to obtain the average fluorescence associated with the microsphere population of interest is carried out using FACSDiva software (Becton Dickinson). The molecules of equivalent soluble fluorochrome (MESF) units obtained from Quantum FITC-5 standards (Bangs Laboratories) are used along with Quickcal template software (Bangs Laboratories) to convert the mean fluorescence value measured for each sample into the average number of fluorescently labeled targets associated with each microsphere to then calculate the average surface density of associated target, σ, for the 1.1 µm microspheres. For the first series of flow cytometry studies entailing analysis at only one timepoint at 30 min following, Minitab 17 software is utilized to perform two-sample t-tests to determine significant differences in associated target density values. In addition to the MESF standards, probe-functionalized microspheres are (a) run alone (to assess the autofluorescence baseline); (b) incubated with noncomplementary NC14 targets (to determine the extent of nonspecific target binding to the polystyrene microsphere surface or to the immobilized probe strands); or (c) incubated with complementary targets (to record the accumulation of hybridized targets on microspheres over time).


10

Page 11 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Analysis of time-dependent hybridization activity on microspheres In addition to reporting the surface density of associated target, σ, over time, the rate constant for hybridization between immobilized, single-stranded probes and soluble, single-stranded targets, k1, is determined through two-parameter curve fits of σ as a function of time, t, as shown in Eq. 1 below using Sigma Plot (SysStat Software Inc., San Jose CA).

σ = σ∞(1 - exp(-k1t))

(1)

in which σ∞ corresponds to the σ value at the 30 min time point. The two-parameter curve fits are undertaken for each of three separate suspension samples (i.e. n = 3) for each probe-target system studied. Average rate constants are only reported for probe-target systems in which the separate curve fits for all three suspension samples have a p-value less than 0.05.

Results and Discussion In order to measure the effects of heat treatment on the overall binding activity between either DNA (A20) or LNA (L3A20) probe-functionalized microspheres and various soluble, FAMlabeled DNA targets (NC14, B9, or B15) or LNA targets (L3M9, L3B9, or L3B15), flow cytometry histograms are taken at one incubation time point (30 min) for all probe-target cases with representative histogram plots presented in Figure 1 for select probe-target pairs, namely L3A20 probes with NC14, L3M9, or L3B15 targets, under comparable handling conditions. For these studies, pre-washed and post-washed duplex analysis is carried out for both untreated and heat-treated suspensions. In each case the relatively low fluorescence intensity of probefunctionalized microspheres incubated with labeled noncomplementary target (NC14), whether or not subjected to heat treatment, indicates that binding of the noncomplementary target to


11

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 33

probe-functionalized microspheres is low compared to that of the short, mismatched target (L3M9) in Figure 1 (a) and (c) and that of the long, perfectly-matched target (L3B15) in Figure 1 (b) and (d). The effects of post-target incubation washing for the nearly matched and perfectly matched targets, on the other hand, appear to depend on the probe-target system. For all cases, the peak breadth in fluorescence intensity values becomes narrower indicating a tighter distribution in the number of associated target species with a colloidal population following posttarget incubation wash steps. Additionally, the maximum peak value for the relative fluorescence intensity shifts to a noticeably lower value if suspensions, both with and without heat treatment, undergo wash steps, as demonstrated for the mismatched target cases shown in Figure 1 (a) and (c) and nearly all other probe-target pairs (additional histogram data not shown). Occasional exceptions to pre-wash vs. post-wash effects on these peak shifts occur as shown in Figure 1(d) for the heat-treated L3A20:L3B15 case. Based on the negligible binding observed for the noncomplementary target case, it does not appear likely that washing steps remove target that is bound in a nonspecific manner (e.g., target adsorption to bare surface patches between immobilized probes). Thus, this leftward shift in the peak values following wash steps could be attributed to removal of some weakly bound targets that are perhaps initially “trapped” in a suboptimal hybridized state to an immobilized probe. The shorter mismatched L3M9 target, appears particularly susceptible to the effects of wash-induced target dissociation due possibly to the weakening, even disruptive effect of the central mismatch to otherwise perfect duplex formation between soluble targets and their respective hybridization segments on the immobilized probes.


12

Page 13 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 1. Flow cytometry histograms of microsphere event counts as a function of relative fluorescence intensity for the following conditions and sequences: (a) L3A20:L3M9 suspensions with no heat treatment; (b) L3A20:L3B15 with no heat treatment; (c) heat-treated L3A20:L3M9 suspensions; (d) heat-treated L3A20:L3B15 suspensions prior to (red) and following (blue) wash steps. In (a)-(d) control suspensions (black) are L3A20-functionalized microspheres incubated with NC14 targets followed by wash steps.

Next, in comparing only unwashed suspensions, heat treatment itself does not appear to have significant effect on the peak breadth or in the maximum peak value for the mismatched target cases shown in Figure 1 (c) (compared to (a)), but it does appear to broaden the peak for


13

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 33

the longest perfectly-matched target in Figure 1 (d) (compared to (b)). The broadening, particularly on the lower intensity tail of the peak in Figure 1 (d), indicates that a single, relatively fast cooling step from an elevated temperature may allow for some suboptimal binding between probes and these longer target species. Incomplete duplex formation between a given probe and target pair represents one possible suboptimal, and thus less stable binding state. For the DNA-LNA mixmer sequences studied here in which the structural nature of the helix (i.e. A helix vs. B helix) is not clear, these suboptimal association states may achieve sufficient initial stability as “trapped” states until either these more weakly bound target species are replaced by another identical target sequence that completes duplex formation during the 30 min target incubation step or until these more weakly bound targets are stripped away during subsequent wash steps. Using calibration standards to convert peak fluorescence intensity values from flow cytometry histograms (e.g., Figure 1) into target density values, the average target densities for all combinations of including or excluding a heat treatment step, both before and after wash steps, are shown in Figure 2 for all probe-target cases at the 30 min time point following the introduction of a given target species to probe-functionalized microspheres. Analysis to identify significant differences in target densities between all two-sample combinations in Figure 2 varies and is thus presented separately in Figures S1 and S2 in the Supporting Information. Based on collective analysis presented in Figures S1 and S2 (see Supporting Information), in most cases shown in Figure 2 (a)-(d) and consistent with Figure 1, the amount of association between noncomplementary target and probe-functionalized microspheres appears small compared to the nearly complementary and perfectly complementary target sequences indicating that the extent of nonspecific target binding is negligible. As shown in Figure S1(c) (see Supporting


14

Page 15 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Information) exceptions to this general observation exist for some A20 probe cases, particularly for several heat-treated cases comparing pre-washed NC14 incubations with, for example, L3M9 (both pre-washed and post-washed) target incubations. Compared to untreated systems, heat treatment results in greater variance in the associated target density values in several cases (e.g., L3B15) for both the pre-washed DNA and pre-washed LNA probe systems as indicated by the larger error bars in Figures 2(c) and 2(d) resulting in target density values with little, if any, significant differences (see Figure S2(c) and S2(d)). As discussed above, these larger ranges in associated target density values for the heat-treated suspensions may be due to the larger number of suboptimal associated target states afforded by the range of elevated temperatures (60º C down to approximately room temperature during the half-hour target incubation) to which suspensions are exposed during target incubation with probe-functionalized microspheres. Though an estimated average spacing of 8 nm exists between immobilized probe functionalities, local heterogeneities in nearest neighbor probe spacing, along with the enhanced mobility and collision frequency of soluble targets and immobilized probes at elevated temperatures, may allow for some target sharing between closely-spaced neighboring probes during the 30 minute cooling step. Wash steps, however, are likely to drive dissociation of these imperfectly bound targets (e.g., duplexes with one or more “frayed” or dissociated base pairs at their ends69) resulting in a lower average density of associated target as well as a narrower distribution of hybridization states as shown by the smaller error bars for all the wash cases. Prior to wash steps, excess soluble targets surround probe-functionalized microspheres allowing dynamic dissociation and either reassociation or new association of targets from the target-rich bulk solution to the immobilized probe “brush” on microspheres. During wash steps, however, any target dissociated from the probe brush layer now enters the target-poor bulk solution making


15

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 33

target:probe reassociation less likely, particularly for weaker hybridization partners as shown in prior studies.62,63,70 Moreover, despite significant loss of soluble mismatched L3M9 target during wash steps in the current studies, the LNA duplex bridges that form between immobilized LNA probes and immobilized L3M9 targets in prior studies38 indicate that these mismatched duplexes are collectively strong enough to mediate colloidal assembly between microspheres and nanoparticles.

Figure 2. Density of various bound targets on the following probe-functionalized microsphere populations (a) untreated A20; (b) untreated L3A20; (c) heat-treated A20; (d) heat-treated L3A20 suspensions prior to (gray) and following (black) wash steps. The average and standard deviation values from three separate suspensions are shown.


16

Page 17 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Finally, in comparing the extent of binding activity of pure DNA sequences with analogous modified sequence pairs under the same processing conditions (e.g.,

unwashed

suspensions with no heat treatment), higher duplex densities result from the substitution of DNA with LNA nucleotides in the perfectly-matched shorter targets (10,000 oligos/µm2 for A20:B9 vs. 16,800 oligos/µm2 for A20:L3B9) or probes (17,600 oligos/µm2 for L3A20:B9) or both (18,400 oligos/µm2 for L3A20:L3B9) though the inclusion of LNA in both the targets and probes in this fourth case results in only a relatively modest increase in hybridization activity over the DNA probe-LNA target case (A20:L3B9) and the LNA probe-DNA target case (L3A20:B9) for the mixmer sequences studied here (see Figures S1 and S2 in Supporting Information). This same trend of increases in duplex densities with LNA inclusions in the sequences, however, is not consistently observed for the longer perfectly-matched target cases involving B15 and L3B15. For a given processing condition (e.g., unwashed suspensions with no heat treatment) mismatched LNA targets consistently result in lower duplex densities for the DNA probe (2900 oligos/µm2 for A20:L3M9) compared to analogous perfectly-matched DNA targets (10,000 oligos/µm2 for A20:B9) or LNA targets (16,800 oligos/µm2 for A20:L3B9) indicating the weakening effect of a central mismatch on duplex stability. Similar trends were observed for the LNA probe though differences in hybridization activity between the mismatched LNA targets and analogous perfectly-matched targets are not consistently significant (see Figures S1 and S2 in Supporting Information). The in situ hybridization activity between either immobilized DNA or immobilized LNA probes and various soluble targets is investigated using flow cytometry immediately after introducing suspensions of A20- or L3A20-functionalized microspheres to DNA (NC14, B9, or B15) or LNA (L3M9, L3B9, or L3B15) targets. Wash steps prior to flow cytometry


17

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 33

measurements are commonly used by our group as well as others to remove unhybridized target or target that is possibly weakly bound to probe-functionalized microspheres through nonspecific attractive interactions.58,67,70-80 In the absence of wash steps, however, these in situ measurements allow for direct quantification of binding events as they occur between the probe-functionalized microspheres and fluorescently labeled targets while also avoiding potential wash-induced target dissociation, especially of weak hybridization partners. For DNA-functionalized microspheres shown in Figure 3, the time to reach half the maximum bound target density ranges does not exceed 17 s (t½ value for A20:L3B15). Additionally, the time-dependent association of all complementary or nearly complementary targets reaches a plateau value within the first 5 min of target incubation. This trend indicates that an apparent equilibrium is reached within the experimental timeframe explored here, regardless of the base length or LNA content of the targets employed. Importantly, the lack of noncomplementary target (NC14) association with A20-functionalized microspheres indicates that nonspecific association of targets either to the immobilized DNA probes or to the microsphere surface is low (~200-300 oligos/µm2 which corresponds to 3–4% of the smallest target density measured for the weakest hybridization pair, A20:L3M9). In contrast, the 15 base-long LNA target, L3B15, exhibits the highest target density on the A20-functionalized microspheres indicating that this LNA target has the highest relative affinity for immobilized DNA probes. Given the nearly negligible association of noncomplementary DNA to these microspheres, even in the absence of conventional wash steps, all other target density values appear to directly correspond to the density of duplexes formed on the surface of the microspheres.


18

Page 19 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 3. In situ measurements of binding activity between A20-functionalized microspheres and soluble, fluorescently labeled DNA targets [NC14 (aqua hexagons); B9 (blue diamonds); or B15 (red inverted triangles)] or LNA targets [L3M9 (pink triangles); L3B9 (green squares); or L3B15 (black circles)]. Dotted lines represent curve fits to Eq. 1. Error bars indicating standard deviation for target densities for the average of three suspension samples are shown. Comparisons within subgroups of related, perfectly matched LNA or DNA targets reveal that longer sequences consistently result in higher average duplex densities at the 30 min timepoint. For example, A20:L3B15 exhibits a higher duplex density than A20:L3B9 (14,300 vs. 8600 oligos/µm2), while A20:B15 has a higher duplex density than A20:B9 (10,300 vs. 6300 oligos/µm2). Comparisons between subgroups of LNA and DNA targets reveal varying degrees of dependence on length. For example, in contrast to the pairwise comparisons above between only LNA or only DNA targets of varying base length, A20:B15 and A20:L3B9 have a more modest duplex density difference of ~1700 oligos/µm2 despite an additional six DNA bases in the B15 target. Additionally, the greater difference in duplex density values between longer duplexes of A20:L3B15 (with 5 locked nucleotides) and A20:B15 than between shorter duplexes of A20:L3B9 (with 3 locked nucleotides) and A20:B9 indicates that target sequence length and/or


19

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 33

LNA content effects on the resulting hybridization activity are apparently additive for the target sequences studied here with DNA-functionalized microspheres. To examine the effects of a base mismatch on the kinetics and extent of hybridization activity, an intentional mismatch is introduced to the center of the LNA target. Not surprisingly, of all the DNA and LNA targets examined here, the mismatched A20:L3M9 pair has the lowest duplex density (5900 oligos/µm2). The lower duplex density is likely due to the combined effect of incorporating a center mismatch on an LNA nucleotide. Notably, the DNA target analog of L3M9 is not explored in the current study due to its exceedingly low hybridization activity revealed in prior work.38 Notably, though multiple batches of freshly probe-coupled microspheres (all from the same manufacturer’s lot) are prepared for each series of case studies presented in a given Figure, differences in the average duplex density values between Figure 1 (e.g., 2900 oligos/µm2 for A20:L3M9) and subsequent figures (e.g., 5900 oligos/µm2 for A20:L3M9 in Figure 3) may be due to microsphere aging effects over the duration of these experimental studies. The extent of hybridization for various targets with LNA-functionalized microspheres in Figure 4 follows many of the same trends as the DNA-functionalized microspheres shown in Figure 3. Once again, at the 30 min time point, L3M9 has the lowest target density (5700 oligos/µm2) and the noncomplementary target (NC14) exhibits nearly negligible binding activity. Thus, similar to the DNA-functionalized microspheres, nonspecific target binding to LNAfunctionalized microspheres appears negligible and in situ duplex densities can be directly measured. Surprisingly, the L3B9 target ultimately exhibits the highest target density (23,100 oligos/µm2), exceeding that of the longer L3B15 target (20,200 oligos/µm2). As with the DNA probe cases, incorporation of LNA nucleotides at every third base in the target significantly


20

Page 21 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

increases the resulting duplex density of L3A20:L3B9 compared to L3A20:B9 (16,500 oligos/µm2). Unlike the DNA probe cases, however, there is a greater difference in duplex density values between L3A20:L3B9 and L3A20:B9 than between L3A20:L3B15 and L3A20:B15 (17,800 oligos/µm2) indicating a possible limited additive effect on hybridization activity if both probe and longer targets possess LNA moieties. Such diminishing effects of incorporating additional LNA substitutions on the duplex melting temperature, a commonly reported indicator of LNA hybridization affinity, have been observed previously in oligonucleotide solutions.1,2,24

Figure 4. In situ measurements of binding activity between L3A20-functionalized microspheres and soluble, fluorescently labeled DNA targets [NC14 (aqua hexagons); B9 (blue diamonds); or B15 (red inverted triangles)] or LNA targets [L3M9 (pink triangles); L3B9 (green squares); or L3B15 (black circles)]. Dotted lines represent curve fits to Eq. 1. Error bars indicating standard deviation for target densities for the average of three suspension samples are shown. Further comparison of the two probe-functionalized microsphere systems indicates that, for perfectly matched targets, the target density for LNA probes is always higher than that obtained for DNA probes with the same target sequences. Finally, unlike the DNA probe case in


21

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 33

which a plateau in target densities is reached within the first 5 min (see Figure 3), only the L3M9 target case appear to reach a plateau in duplex density values for L3A20-functionalized microspheres within the 30 min experimental time frame shown in Figure 4. This slower duplex formation with the LNA probe is underscored by the longer t1/2 time to reach half the maximum target densities (taken at 30 min) which range from ~23–128 s for LNA probes compared to 17 s or less for the DNA probe cases. This slower accumulation of bound targets indicates that more time is necessary to reach an apparent equilibrium for LNA-based probes. In addition to measuring the extent of hybridization, the kinetics of hybridization is investigated using curve fits of time-dependent hybridization activity to Eq. 1 as indicated by the dotted lines in Figures 3 and 4. The resulting rate constants for hybridization of various targets to single-stranded DNA and LNA probes are listed in Table 2. For both the DNA and LNA probe cases, the values for the hybridization rate constant, k1, are generally similar for all target sequences with one exception. The perfectly matched L3A20:B9 case is approximately an order of magnitude slower than any other probe-target pair. Overall, the slightly lower k1 value for LNA probes than for DNA probes with identical perfectly matched targets may be indicative of the longer incubation times needed for the duplex density values to reach a plateau for LNA probe cases in Figure 4 compared to the DNA probe cases shown in Figure 3 as discussed previously. For the L3A20:B9 case, however, the reasons for the order of magnitude difference in k1 are not completely clear. This lower rate constant does not appear to directly correlate with the extent of hybridization shown in Figure 3 since the B9 target is not the weakest target studied. In fact, similar k1 values are found in all other probe-target cases despite large differences in duplex density values. Compared to oligonucleotide solutions in which neither probe nor target strands are bound to a material substrate, surface-immobilized DNA has


22

Page 23 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

reportedly slower hybridization activity due to issues stemming from electrosteric hindrance, conformational restrictions of the probe, and high probe density.54,61,81 In the current studies, however, these parameters are comparable for nearly all probe-target combinations and neither the single-stranded L3A20 probes (based on “scoring” provided by Exiqon’s Oligo Optimer Tool82 under unspecified salt conditions) nor the B9 targets (based on Zuker’s mfold server83) have any predicted intrastrand secondary structures that have previously been shown54 to suppress the kinetics of hybridization. Additionally, hybridization of B9 to A20 exhibits a faster hybridization rate constant, although the resulting duplex density is lower than the comparative case involving L3A20 probes. Thus, perhaps the combination of nine base target sequence length which is too short to complete a helical turn and the lack of matching LNA nucleotides in both probe and target sequences ultimately drives relatively slower duplex formation of B9 with the LNA probe. Table 2. Observed rate constants for duplex formation, k1, as determined from in situ experiments in PBS (154 mM NaCl) with both DNA A20- and LNA L3A20-functionalized microspheres and various DNA and LNA targets listed below. Notably, in situ experiments for the A20:M9 (DNA probe:mismatched DNA target) case are not run due to exceedingly low hybridization activity in prior work.38 k1 (s-1) Target

DNA Probe

LNA Probe

L3B15

4.11×10-2 ± 1.1×10-3

3.05×10-2 ± 3.4×10-3

B15

5.38×10-2 ± 1.4×10-2

2.05×10-2 ± 1.1×10-3

L3B9

7.37×10-2 ± 4.9×10-3

1.44×10-2 ± 4.1×10-3

B9

5.66×10-2 ± 1.4×10-2

5.4×10-3 ± 7×10-4

L3M9

---

1.90×10-2 ± 2.7×10-3


23

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 33

Given the slower hybridization kinetics observed for L3A20:B9, the next set of experiments specifically explore the effects of increasing the solution ionic strength for this particular case. Figure 5 shows that duplex formation does occur more quickly at the higher salt concentration (1000 mM NaCl) and reaches a plateau in target density values within ~7 min. The resulting rate constant for hybridization, k1, is approximately five-fold greater in the buffer containing 1000 mM NaCl than in the buffer containing 154 mM NaCl (2.47×10-2 ± 2.9×10-3 s-1 vs. 5.42×10-3 s-1) and more closely matches the k1 values found in all other L3A20 probe-target combinations shown in Table 2. Surprisingly, however, the duplex density is lower at 1000 mM NaCl than at 154 mM NaCl (13,500 vs. 16,500 oligos/µm2). Thus, while duplexes form more quickly between available LNA probes and DNA targets to reach a plateau value sooner in high salt, more complete duplex formation may be hindered by a portion of the LNA probe population that remains self-hybridized under the ambient temperature conditions employed for these in situ studies. Notably, however, this possible explanation lacks further backing since thermodynamic calculators are not readily available to provide theoretical estimates of self-melt temperatures of LNA-DNA mixmers under high salt conditions. The effects of salt concentration on the hybridization rate constants for LNA-modified sequences in the current study on microsphere surfaces are consistent with an earlier report on planar substrates52.


24

Page 25 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 5. In situ measurements of binding activity between L3A20-functionalized microspheres and soluble, fluorescently labeled B9 DNA targets in 154 mM (open circles) and 1000 mM (closed circles) NaCl conditions. Dotted lines represent curve fits to Eq. 1. Error bars indicating standard deviation for target densities for the average of three suspension samples are shown. Due to the small number of studies on surface-based LNA hybridization kinetics52,53, solution-based studies22,48-51 of the kinetics of LNA hybridization can provide some insight, though conclusions from these limited studies do not entirely agree with one another. In general, hybridization kinetics in oligonucleotide solutions has been shown to be faster than on surfaces.54,61,84,85 Assuming a two-state model for dissociation in which two strands are either hybridized or completely dissociated49,85,86 and an excess and effectively constant concentration of target [T1] in the absence of any wash steps, the observed rate constant of duplex formation, k1, can be related to the second order association rate constant, ka, by the equation k1 = ka[T1] + kr.62,63,87,88 This equation can be approximated as k1 ~ ka[T1] if the dissociation rate constant, kr, of the duplexes is assumed to be small—an assumption that is particularly relevant to LNA48,49,52. With the exception of the L3A20:B9 case at 154 mM NaCl, the resulting values of ka for the LNA and DNA probes are ~1-3×104 M-1s-1 and ~4-7×104 M-1s-1, respectively, which is also in


25

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 33

reasonable agreement (within an order of magnitude) with values reported for hybridization of soluble DNA targets to single-stranded DNA probes immobilized on planar substrates84,89,90 and on microspheres61-63,91. These results indicate that substituting one-third of the hybridization segment with LNA nucleotides does not significantly affect hybridization kinetics, similar to previous reports for LNA-based sequences in solution48,49.

Conclusions Flow cytometry allows for in situ monitoring of early binding events between various DNA and LNA-DNA sequences on microsphere surfaces and reveals similar association rate constants for nearly every probe-target combination. Despite the dissociation of duplexes upon washing or incubation in target-free buffer for every probe-target combination, the overall trends in the extent of hybridization are comparable to those from in situ hybridization studies in the absence of wash steps. Importantly, while these in situ studies impose a 30-minute incubation time for monitoring hybridization kinetics, distinction in the hybridization behavior of various probetarget combinations is revealed within the first several minutes of target incubation and indicates that this technique may be a promising in situ tool for rapid, reliable assessment of probe-target hybridization activity without the need for wash steps. While only brief heat treatments are explored in the current work to capture an early time point in hybridization activity, future work can employ longer or cyclic heat treatments of LNA sequences.

SUPPORTING INFORMATION Supporting Data are available: Supporting Figures S1-S2. This material is available free of charge via the Internet at http://pubs.acs.org.


26

Page 27 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

AUTHOR INFORMATION Corresponding Author *E-mail: [email protected] Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Notes The authors declare no competing financial interest. ACKNOWLEDGEMENTS This work was supported by the Army Research Office (W911NF-09-1-0479) and an NSF CAREER for V.T.M. (DMR-0847436); and with funds from the Provost’s office at the Georgia Institute of Technology. Partial support for N.A.E. was provided by a GAANN Fellowship through the Center for Drug Design, Development and Delivery (CD4) at Georgia Tech and a Christopher Sanders Fellowship through the School of Materials Science and Engineering at Georgia Tech. Flow cytometry was performed at the Petit Institute for Bioengineering and Bioscience (IBB) Core Lab facilities. The authors are grateful to James Hardin for helpful discussion.


27

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 33

REFERENCES (1) Singh, S. K.; Koshkin, A. A.; Wengel, J.; Nielsen, P. LNA (locked nucleic acids): Synthesis and high-affinity nucleic acid recognition. Chem. Commun. 1998, 455-456. (2) Koshkin, A. A.; Nielsen, P.; Meldgaard, M.; Rajwanshi, V. K.; Singh, S. K.; Wengel, J. LNA (locked nucleic acid): An RNA mimic forming exceedingly stable LNA:LNA duplexes. J. Amer. Chem. Soc. 1998, 120, 13252-13253. (3) Wengel, J.; Petersen, M.; Nielsen, K. E.; Jensen, G. A.; Håkansson, A. E.; Kumar, R.; Sørensen, M. D.; Rajwanshi, V. K.; Bryld, T.; Jacobsen, J. P. LNA (locked nucleic acid) and the diastereoisomeric α-L-LNA: Conformational tuning and high-affinity recognition of DNA/RNA targets. Nucleosides, Nucleotides Nucleic Acids 2001, 20, 389-396. (4) Crinelli, R.; Bianchi, M.; Gentilini, L.; Magnani, M. Design and characterization of decoy oligonucleotides containing locked nucleic acids. Nucleic Acids Res. 2002, 30, 2435-2443. (5) Frieden, M.; Hansen, H. F.; Koch, T. Nuclease stability of LNA oligonucleotides and LNA-DNA chimeras. Nucleosides, Nucleotides Nucleic Acids 2003, 22, 1041-1043. (6) Di Giusto, D. A.; King, G. C. Strong positional preference in the interaction of LNA oligonucleotides with DNA polymerase and proofreading exonuclease activities: Implications for genotyping assays. Nucleic Acids Res. 2004, 32, e32. (7) Petersen, M.; Wengel, J. LNA: A versatile tool for therapeutics and genomics. Trends Biotechnol. 2003, 21, 74-81. (8) Stenvang, J.; Silahtaroglu, A. N.; Lindow, M.; Elmen, J.; Kauppinen, S. The utility of LNA in microRNA-based cancer diagnostics and therapeutics. Semin. Cancer Biol. 2008, 18, 89102. (9) Jacobsen, N.; Bentzen, J.; Meldgaard, M.; Jakobsen, M. H.; Fenger, M.; Kauppinen, S.; Skouv, J. LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E. Nucleic Acids Res. 2002, 30. (10) Jepsen, J. S.; Pfundheller, H. M.; Lykkesfeldt, A. E. Downregulation of p21((WAF1/CIP1)) and estrogen receptor alpha in MCF-7 cells by antisense oligonucleotides containing locked nucleic acid (LNA). Oligonucleotides 2004, 14, 147-156. (11) Riahi, R.; Dean, Z.; Wu, T.-H.; Teitell, M. A.; Chiou, P.-Y.; Zhang, D. D.; Wong, P. K. Detection of mRNA in living cells by double-stranded locked nucleic acid probes. Analyst 2013, 138, 4777-4785. (12) Sidon, P.; Heimann, P.; Lambert, F.; Dessars, B.; Robin, V.; El Housni, H. Combined locked nucleic acid and molecular beacon technologies for sensitive detection of the JAK2(V617F) somatic single-base sequence variant. Clin. Chem. 2006, 52, 1436-1438. (13) Valoczi, A.; Hornyik, C.; Varga, N.; Burgyan, J.; Kauppinen, S.; Havelda, Z. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 2004, 32. (14) Yang, C. J.; Wang, L.; Wu, Y. R.; Kim, Y. M.; Medley, C. D.; Lin, H.; Tan, W. H. Synthesis and investigation of deoxyribonucleic acid/locked nucleic acid chimeric molecular beacons. Nucleic Acids Res. 2007, 35, 4030-4041. (15) Nielsen, K. E.; Singh, S. K.; Wengel, J.; Jacobsen, J. P. Solution structure of an LNA hybridized to DNA: NMR study of the d(CT(L)GCT(L)T(L)CT(L)GC): d(GCAGAAGCAG) duplex containing four locked nucleotides. Bioconjugate Chem. 2000, 11, 228-238.


28

Page 29 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

(16) Petersen, M.; Nielsen, C. B.; Nielsen, K. E.; Jensen, G. A.; Bondensgaard, K.; Singh, S. K.; Rajwanshi, V. K.; Koshkin, A. A.; Dahl, B. M.; Wengel, J.; Jacobsen, J. P. The conformations of locked nucleic acids (LNA). J. Mol. Recognit. 2000, 13, 44-53. (17) Saenger, W. Principles of Nucleic Acid Structure; Springer-Verlag: New York, 1984. (18) Saenger, W.; Hunter, W. N.; Kennard, O. DNA conformation is determined by economics in the hydration of phosphate groups. Nature 1986, 324, 385-388. (19) Kaur, H.; Arora, A.; Wengel, J.; Maiti, S. Thermodynamic, counterion, and hydration effects for the incorporation of locked nucleic acid nucleotides into DNA duplexes. Biochemistry 2006, 45, 7347-7355. (20) McTigue, P. M.; Peterson, R. J.; Kahn, J. D. Sequence-dependent thermodynamic parameters for locked nucleic acid (LNA)−DNA duplex formation. Biochemistry 2004, 43, 53885405. (21) Hughesman, C. B.; Turner, R. F. B.; Haynes, C. A. Role of the heat capacity change in understanding and modeling melting thermodynamics of complementary duplexes containing standard and nucleobase-modified LNA. Biochemistry 2011, 50, 5354-5368. (22) Bruylants, G.; Boccongelli, M.; Snoussi, K.; Bartik, K. Comparison of the thermodynamics and base-pair dynamics of a full LNA:DNA duplex and of the isosequential DNA:DNA duplex. Biochemistry 2009, 48, 8473-8482. (23) Owczarzy, R.; You, Y.; Groth, C. L.; Tataurov, A. V. Stability and mismatch discrimination of locked nucleic acid-DNA duplexes. Biochemistry 2011, 50, 9352-9367. (24) You, Y.; Moreira, B. G.; Behlke, M. A.; Owczarzy, R. Design of LNA probes that improve mismatch discrimination. Nucleic Acids Res. 2006, 34, 11. (25) Kaur, H.; Babu, B. R.; Maiti, S. Perspectives on chemistry and therapeutic applications of locked nucleic acid (LNA). Chem. Rev. 2007, 107, 4672-4697. (26) Wahlestedt, C.; Salmi, P.; Good, L.; Kela, J.; Johnsson, T.; Hökfelt, T.; Broberger, C.; Porreca, F.; Lai, J.; Ren, K.; Ossipov, M.; Koshkin, A.; Jakobsen, N.; Skouv, J.; Oerum, H.; Jacobsen, M. H.; Wengel, J. Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. Proc. Natl. Acad. Sci. USA 2000, 97, 5633-5638. (27) Lundin, K. E.; Højland, T.; Hansen, B. R.; Persson, R.; Bramsen, J. B.; Kjems, J.; Koch, T.; Wengel, J.; Smith, C. I. E. In Advances in Genetics; Theodore Friedmann, J. C. D., Stephen, F. G., Eds.; Academic Press: 2013; Vol. Volume 82, p 47-107. (28) Karlsen, K. K.; Wengel, J. Locked nucleic acid and aptamers. Nucleic Acid Therapeutics 2012, 22, 366-370. (29) Machlin, E. S.; Sarnow, P.; Sagan, S. M. Combating Hepatitis C virus by targeting microRNA-122 using locked nucleic acids. Curr. Gene Ther. 2012, 12, 301-306. (30) Ostergaard, M. E.; Hrdlicka, P. J. Pyrene-functionalized oligonucleotides and locked nucleic acids (LNAs): Tools for fundamental research, diagnostics, and nanotechnology. Chem. Soc. Rev. 2011, 40, 5771-5788. (31) Veedu, R. N.; Wengel, J. Locked nucleic acids: Promising nucleic acid analogs for therapeutic applications. Chemistry & Biodiversity 2010, 7, 536-542. (32) Mouritzen, P.; Nielsen, A. T.; Pfundheller, H. M.; Choleva, Y.; Kongsbak, L.; Møller, S. Single nucleotide polymorphism genotyping using locked nucleic acid (LNA™). Expert Rev. Mol. Diagn. 2003, 3, 27-38. (33) Yamamoto, T.; Nakatani, M.; Narukawa, K.; Obika, S. Antisense drug discovery and development. Future Medicinal Chemistry 2011, 3, 339-365.


29

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 33

(34) SantaLucia, J.; Allawi, H. T.; Seneviratne, A. Improved nearest-neighbor parameters for predicting DNA duplex stability. Biochemistry 1996, 35, 3555-3562. (35) SantaLucia, J.; Hicks, D. The thermodynamics of DNA structural motifs. Annu. Rev. Bioph. Biom. 2004, 33, 415-440. (36) Michele, L. D.; Mongetti, B. M.; Yanagishima, T.; Varilly, P.; Ruff, Z.; Frenkel, D.; Eiser, E. Effect of inert tails on the thermodynamics of DNA Hybridization. J. Amer. Chem. Soc. 2014, 136, 6538-6541. (37) Singh, A.; Eksiri, H.; Yingling, Y. G. Theoretical perspective on properties of DNAfunctionalized surfaces. J. Polym. Sci. Pol. Phys. 2011, 49, 1563-1568. (38) Eze, N. A.; Milam, V. T. Exploring locked nucleic acids as a bio-inspired materials assembly and disassembly tool. Soft Matter 2013, 9, 2403-2411. (39) Singh, S. K.; Wengel, J. Universality of LNA-mediated high-affinity nucleic acid recognition. Chem. Commun. 1998, 1247-1248. (40) Akamatsu, K.; Kimura, M.; Shibata, Y.; Nakano, S.; Miyoshi, D.; Nawafune, H.; Sugimoto, N. A DNA duplex with extremely enhanced thermal stability based on controlled immobilization on gold nanoparticles. Nano Letters 2006, 6, 491-495. (41) Lytton-Jean, A. K. R.; Mirkin, C. A. A thermodynamic investigation into the binding properties of DNA functionalized gold nanoparticle probes and molecular fluorophore probes. J. Amer. Chem. Soc. 2005, 127, 12754-12755. (42) Xu, J.; Craig, S. L. Thermodynamics of DNA hybridization on gold nanoparticles. J. Amer. Chem. Soc. 2005, 127, 13227-13231. (43) Chen, C. L.; Wang, W. J.; Ge, J.; Zhao, X. S. Kinetics and thermodynamics of DNA hybridization on gold nanoparticles. Nucleic Acids Res. 2009, 37, 3756-3765. (44) Seferos, D. S.; Giljohann, D. A.; Rosi, N. L.; Mirkin, C. A. Locked nucleic acidnanoparticle conjugates. Chembiochem 2007, 8, 1230-1232. (45) McKenzie, F.; Faulds, K.; Graham, D. Sequence-specific DNA detection using highaffinity LNA-functionalized gold nanoparticles. Small 2007, 3, 1866-1868. (46) Obika, S.; Nanbu, D.; Hari, Y.; Andoh, J.; Morio, K.; Doi, T.; Imanishi, T. Stability and structural features of the duplexes containing nucleoside analogues with a fixed n-type conformation, 2 '-O,4 '-C-methyleneribonucleosides. Tetrahedron Lett. 1998, 39, 5401-5404. (47) Wengel, J.; Petersen, M.; Frieden, M.; Koch, T. Chemistry of locked nucleic acids (LNA): Design, synthesis, and bio-physical properties. Lett. Pept. Sci. 2004, 10, 237-253. (48) Christensen, U. Thermodynamic and kinetic characterization of duplex formation between 2′-O, 4′-C-methylene-modified oligoribonucleotides, DNA and RNA. Bioscience Rep. 2007, 27, 327-333. (49) Christensen, U.; Jacobsen, N.; Rajwanshi, V. K.; Wengel, J.; Koch, T. Stopped-flow kinetics of locked nucleic acid (LNA)-oligonucleotide duplex formation: Studies of LNA-DNA and DNA-DNA interactions. Biochem. J. 2001, 354, 481-484. (50) Ormond, T. K.; Spear, D.; Stoll, J.; Mackey, M. A.; St. John, P. M. Increase in hybridization rates with oligodeoxyribonucleotides containing locked nucleic acids. J. Biomol. Struct. Dyn. 2006, 24, 171-182. (51) Donini, S.; Clerici, M.; Wengel, J.; Vester, B.; Peracchi, A. The advantages of being locked: Assessing the cleavage of short and long RNAs by locked nucleic acid-containing 8-17 deoxyribozymes. J. Biol. Chem. 2007.


30

Page 31 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

(52) Arora, A.; Kaur, H.; Wengel, J.; Maiti, S. Effect of locked nucleic acid (LNA) modification on hybridization kinetics of DNA duplex. Nucleic Acids Symp. Series 2008, 52, 417-418. (53) Mohrle, B. P.; Kumpf, M.; Gauglitz, G. Determination of affinity constants of locked nucleic acid (LNA) and DNA duplex formation using label free sensor technology. Analyst 2005, 130, 1634-1638. (54) Gao, Y.; Wolf, L. K.; Georgiadis, R. M. Secondary structure effects on DNA hybridization kinetics: A solution versus surface comparison. Nucleic Acids Res. 2006, 34, 33703377. (55) Hull, C.; Szewcyk, C.; St John, P. M. Effects of locked nucleic acid substitutions on the stability of oligonucleotide hairpins. Nucleosides, Nucleotides Nucleic Acids 2012, 31, 28-41. (56) Wetmur, J. G. Hybridization and renaturation kinetics of nucleic acids. Annu. Rev. Biophys. Bioeng. 1976, 5, 337-361. (57) Livshits, M. A.; Mirzabekov, A. D. Theoretical analysis of the kinetics of DNA hybridization with gel-immobilized oligonucleotides. Biophysical J. 1996, 71, 2795-2801. (58) Tison, C. K.; Milam, V. T. Reversing DNA-mediated adhesion at a fixed temperature. Langmuir 2007, 23, 9728-9736. (59) Dunaway, A. B.; Sullivan, R. S.; Siegel, K. J.; Milam, V. T. Evaluating the dual target bnding capabilities of immobilized aptamers using flow cytometry. Biointerphases 2015, 10, 019015. (60) Sekar, M. M. A.; Bloch, W.; St John, P. M. Comparative study of sequence-dependent hybridization kinetics in solution and on microspheres. Nucleic Acids Res. 2005, 33, 366-375. (61) Henry, M. R.; Wilkins Stevens, P.; Sun, J.; Kelso, D. M. Real-time measurements of DNA hybridization on microparticles with fluorescence resonance energy transfer. Anal. Biochem. 1999, 276, 204-214. (62) Hardin, J. O.; Milam, V. T. Measuring in situ primary and competitive DNA hybridization activity on microspheres. Biomacromolecules 2013, 14, 986-992. (63) Hardin, J. O.; Milam, V. T. Correction to measuring in situ primary and competitive DNA hybridization activity on microspheres. Biomacromolecules 2013, 14, 2961. (64) Prigodich, A. E.; Lee, O.-S.; Daniel, W. L.; Seferos, D. S.; Schatz, G. C.; Mirkin, C. A. Tailoring DNA structure to increase target hybridization kinetics on surfaces. J. Amer. Chem. Soc. 2010, 132, 10638-10641. (65) Diaz, M. R.; Jacobson, J. W.; Goodwin, K. D.; Dunbar, S. A.; Fell, J. W. Molecular detection of harmful algal blooms (HABs) using locked nucleic acids and bead array technology. Limnol. Oceanogr. Meth. 2010, 8, 269-284. (66) Diercks, S.; Gescher, C.; Metfies, K.; Medlin, L. Evaluation of locked nucleic acids for signal enhancement of oligonucleotide probes for microalgae immobilised on solid surfaces. J. Appl. Phycol. 2009, 21, 657-668. (67) Kim, A. J.; Biancaniello, P. L.; Crocker, J. C. Engineering DNA-mediated colloidal crystallization. Langmuir 2006, 22, 1991-2001. (68) Park, S. Y.; Lytton-Jean, A. K. R.; Lee, B.; Weigand, S.; Schatz, G. S.; Mirkin, C. A. DNA-programmable nanoparticle crystallization. Nature 2008, 451, 553-556. (69) Frank-Kamenetskii, M. D.; Prakash, S. Fluctuations in the DNA double helix: A critical review. Phys. Life Rev. 2014, 11, 153-170.


31

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 33

(70) Baker, B. A.; Milam, V. T. Hybridization kinetics between immobilized double-stranded DNA probes and targets containing embedded recognition segments. Nucleic Acids Res. 2011, 39. (71) Iannone, M. A.; Taylor, J. D.; Chen, J.; Li, M.-S.; Rivers, P.; Slentz-Kesler, K. A.; Weiner, M. P. Multiplexed single nucleotide polymorphism genotyping by oligonucleotide ligation and flow cytometry. Cytometry 2000, 39, 131-140. (72) Walsh, M. K.; Wang, X.; Weimer, B. C. Optimizing the immobilization of singlestranded DNA onto glass beads. J. Biochem. Biophys. Methods 2001, 47, 221-231. (73) Milam, V. T.; Hiddessen, A. L.; Crocker, J. C.; Graves, D. J.; Hammer, D. A. DNAdriven assembly of bidisperse, micron-sized colloids. Langmuir 2003, 19, 10317-10323. (74) Steinberg, G.; Stromsborg, K.; Thomas, L.; Barker, D.; Zhao, C. Strategies for covalent attachment of DNA to beads. Biopolymers 2004, 73, 597-605. (75) Kim, A. J.; Manoharan, V. N.; Crocker, J. C. Swelling-based method for preparing stable, functionalized polymer colloids. J. Amer. Chem. Soc. 2005, 127, 1592-1593. (76) Corrie, S. R.; Lawrie, G. A.; Trau, M. Quantitative analysis and characterization of biofunctionalized fluorescent silica particles. Langmuir 2006, 22, 2731-2737. (77) Dunbar, S. A. Applications of Luminex® xMAP™ technology for rapid, high-throughput multiplexed nucleic acid detection. Clin. Chim. Acta 2006, 363, 71-82. (78) Zhang, Y.; Milam, V. T.; Graves, D. J.; Hammer, D. A. Differential adhesion of microspheres mediated by DNA hybridization I: Experiment. Biophysical J. 2006, 90, 41284136. (79) Biancaniello, P. L.; Crocker, J. C.; Hammer, D. A.; Milam, V. T. DNA-mediated phase behavior of microsphere suspensions. Langmuir 2007, 23, 2688-2693. (80) Tison, C. K.; Milam, V. T. Programming the kinetics and extent of colloidal disassembly using a DNA trigger. Soft Matter 2010, 6, 4446-4453. (81) Peterson, A. W.; Heaton, R. J.; Georgiadis, R. M. The effect of surface probe density on DNA hybridization. Nucleic Acids Res. 2001, 29, 5163-5168. (82) Tolstrup, N.; Nielsen, P. S.; Kolberg, J. G.; Frankel, A. M.; Vissing, H.; Kauppinen, S. OligoDesign: optimal design of LNA (locked nucleic acid) oligonucleotide capture probes for gene expression profiling. Nucleic Acids Res. 2003, 31, 3758-3762. (83) Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406-3415. (84) Tawa, K.; Yao, D.; Knoll, W. Matching base-pair number dependence of the kinetics of DNA–DNA hybridization studied by surface plasmon fluorescence spectroscopy. Biosens. Bioelectron. 2005, 21, 322-329. (85) Porschke, D.; Uhlenbec, O. C.; Martin, F. H. Thermodynamics and kinetics of helix-coil transition of oligomers containing GC base pairs. Biopolymers 1973, 12, 1313-1335. (86) Stevens, P. W.; Henry, M. R.; Kelso, D. M. DNA hybridization on microparticles: Determining capture-probe density and equilibrium dissociation constants. Nucleic Acids Res. 1999, 27, 1719-1727. (87) Gotoh, M.; Hasegawa, Y.; Shinohara, Y.; Shimizu, M.; Tosu, M. A new approach to determine the effect of mismatches on kinetic parameters in DNA hybridization using an optical biosensor. DNA Res. 1995, 2, 285-293. (88) Koval, V. V.; Gnedenko, O. V.; Ivanov, Y. D.; Fedorova, O. S.; Archakov, A. I.; Knorre, D. G. Real-time oligonucleotide hybridization kinetics monitored by resonant mirror technique. IUBMB Life 1999, 48, 317-320.


32

Page 33 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

(89) Liebermann, T.; Knoll, W.; Sluka, P.; Herrmann, R. Complement hybridization from solution to surface-attached probe-oligonucleotides observed by surface-plasmon-field-enhanced fluorescence spectroscopy. Coll. Surface A 2000, 169, 337-350. (90) Okahata, Y.; Kawase, M.; Niikura, K.; Ohtake, F.; Furusawa, H.; Ebara, Y. Kinetic measurements of DNA hybridization on an oligonucleotide-immobilized 27-MHz quartz crystal microbalance. Anal. Chem. 1998, 70, 1288-1296. (91) Rogers, W. B.; Sinno, T.; Crocker, J. C. Kinetics and non-exponential binding of DNAcoated colloids. Soft Matter 2013, 9, 6412-6417.

TOC graphic


33

Analysis of in Situ LNA and DNA Hybridization Events on Microspheres

Recommend Documents