Antroquinonol, a Ubiquinone Derivative from the ... - ACS Publications

Dec 20, 2016 - Antroquinonol, a Ubiquinone Derivative from the Mushroom Antrodia camphorata, Inhibits Colon Cancer Stem Cell-like Properties: Insights...
1 downloads 4 Views 10MB Size
Download PDF
Article pubs.acs.org/JAFC

Antroquinonol, a Ubiquinone Derivative from the Mushroom Antrodia camphorata, Inhibits Colon Cancer Stem Cell-like Properties: Insights into the Molecular Mechanism and Inhibitory Targets Hsien-Chun Lin,† Mei-Hsiang Lin,‡,∥ Jiahn-Haur Liao,§,∥ Tzu-Hua Wu,# Tzong-Huei Lee,⊗ Fwu-Long Mi,⊥,Π Chi-Hao Wu,Δ Ku-Chung Chen,⊥,Π Chia-Hsiung Cheng,⊥,Π and Cheng-Wei Lin*,⊥,Π,Σ †

Division of Chest Medicine, Department of Internal Medicine, Wan Fang Hospital, Taipei Medical University, Taipei, Taiwan Graduate Institute of Pharmacy, College of Pharmacy, Taipei Medical University, Taipei, Taiwan § Institute of Biological Chemistry, Academia Sinica, Taipei, Taiwan # Department of Clinical Pharmacy, School of Pharmacy, College of Pharmacy, Taipei Medical University, Taipei, Taiwan ⊗ Institute of Fisheries Science, National Taiwan University, Taipei, Taiwan ⊥ Department of Biochemistry and Molecular Cell Biology, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan Π Graduate Institute of Medical Sciences, College of Medicine, Taipei Medical University, Taipei, Taiwan Δ School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan Σ TMU Center for Cell Therapy and Regeneration Medicine, Taipei Medical University, Taipei, Taiwan ‡

ABSTRACT: Antroquinonol (ANQ) is a ubiquinone derivative from the unique mushroom Antrodia camphorata, which exhibits broad-spectrum bioactivities. The effects of ANQ on cancer stem cell-like properties in colon cancer, however, remain unclear. In this study, we found that ANQ inhibited growth of colon cancer cells. The 50% growth inhibitions (GI50) of ANQ on HCT15 and LoVo were 34.8 ± 0.07 and 17.9 ± 0.07 μM. Moreover, ANQ exhibited inhibitory activities toward migration/ invasion and tumorsphere formation of colon cancer cells. Mechanistically, ANQ inhibited pluripotent and cancer stem cellrelated genes and down-regulated β-catenin/T-cell factor (TCF) signaling. Moreover, activation of the phosphatidylinositol-3kinase (PI3K)/AKT/β-catenin signaling axis was identified to be crucial for regulating the expressions of pluripotent genes, whereas suppression of PI3K/AKT by ANQ inhibited expressions of β-catenin and downstream targets. Molecular docking identified the potential interaction of ANQ with PI3K. Our data show for the first time that the bioactive component of A. camphorata, ANQ, suppresses stem cell-like properties via targeting PI3K/AKT/β-catenin signaling. ANQ could be a promising cancer prevention agent for colon cancer. KEYWORDS: antroquinonol, Antrodia camphorata, colon cancer stem cell, β-catenin, cancer prevention

■

INTRODUCTION Antrodia camphorata is a unique mushroom that grows only on the endemic species bull camphor tree, Cinnamomum kanehirae, in Taiwan. A. camphorata is widely used as a folk medicine for several reasons, including liver protection, hypertension, food detoxification, and cancer prevention. Crude extracts of A. camphorata show a broad spectrum of bioactivities including antioxidant and anti-inflammatory properties and suppression of a variety of malignancies including bladder, breast, ovarian, and prostate cancers.1−4 The bioactivity of A. camphorata is dominantly attributed to the high contents of triterpenoids, benzoquinone derivatives, lignans, and polysaccharides.5 However, the great difficulty in cultivating A. camphorata limits its analysis and applications. We previously isolated antroquinonol (ANQ), which is the most abundant component from the mycelium of A. camphorata, and identified its antiinflammatory activity and anticancer potential.6−9 Recent studies reported that ANQ induces apoptosis and autophagy of pancreatic cancer cells10 and inhibits the growth of liver and © XXXX American Chemical Society

lung cancer cells by modulating the AMP-activated protein kinase (AMPK) or phosphatidylinositol-3-kinase (PI3K)/ mammalian target of rapamycin (mTOR) pathways.11,12 We recently found that ANQ inhibited migration and invasion of breast cancer through suppressing expressions of matrix metalloproteinase (MMP)-9 and epithelial−mesenchymal transition (EMT) genes.7 Acquisition of the EMT in tumor cells is known to play an important role in promoting their cancer stem cell-like characteristics. However, the effects of ANQ on colon cancer stem cell-like properties remain unclear. Colon cancer is the third most common cancer worldwide.13 Although several advantageous methods have been applied for treating colon cancer, the overall survival rate is still limited and needs to be improved. Tumor metastasis and recurrence are the Received: September 14, 2016 Revised: December 5, 2016 Accepted: December 7, 2016

A

DOI: 10.1021/acs.jafc.6b04101 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

DMX500 SB spectrometer, Ettlingen, Germany). Mass spectra were acquired by using a Finnigan Thermo Quest MAT 95XL spectrometer (Bremen, Germany). The purity of ANQ was determined to be >95%.6 LY294002 was purchased from Selleckchem (Houston, TX, USA). Reporter plasmids containing a wild-type (TOPflash) or mutant (FOPflash) β-catenin/TCF-binding site were provided by Addgene (plasmids 12456 and 12457). Antibodies against Akt, β-catenin, cyclin D1, c-Myc, GAPDH, GSK3β, phospho-GSK3β, Klf4, Oct4, and Sox2 were purchased from GeneTex (San Antonio, TX, USA). An antibody against phospho-AKT was purchased from Cell Signaling Technology (Beverly, MA, USA). Cell Culture. The human HCT116, HCT15, and LoVo colon cancer cell lines were purchased from the Bioresource Collection and Research Center (Hsinchu, Taiwan). Cells were maintained in RPMI1640 medium containing 10% fetal bovine serum (Gibco, Grand Island, NY, USA) and 100 μg/mL penicillin/streptomycin (Gibco) in a humidified incubator with 5% CO2 at 37 °C. To knock down β-catenin, cells were transfected with the pLKO-sh-β-catenin plasmid (TRCN0000003845, target sequence GCTTGGAATGAGACTGCTGAT, National RNAi Core Facility, Academia Sinica, Taipei, Taiwan) by PolyJet (SignaGen Laboratories, Ijamsville, MD, USA) for 48 h. Protein lysates were then subjected to Western blotting. Cell Viability. Colon cancer cells were seeded into 24-well plates at a concentration of 2 × 105 cells/well. Cells were fed complete growth medium containing different concentrations of ANQ for 24 h of incubation. Viable cells were incubated with 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT; 50 μg/mL) for 1 h and dissolved in isopropanol, and the absorbance at 570 nm was measured with a spectrophotometer. Cell viability was expressed as the percentage of untreated control cells.7 The 50% growth inhibition (GI50) was calculated by a nonlinear regression using GraphPad Prism 5 software. Transwell Migration and Invasion Assay. Cells were seeded into a 24-well transwell insert (8 μm polycarbonate Nucleopore filters, Corning, Corning, NY, USA) coated or not with 0.8 mg/mL Matrigel (BD Biosciences). Cells were then treated with ANQ at the indicated concentrations for 24 h (for migration) or 48 h (for invasion). The lower well contained complete medium. Cells that passed through the membrane were fixed with iced methanol and stained with a Giemsa solution. Cell migration and invasion were scored by counting two randomly selected fields, and results are expressed as a percentage relative to the control group. Each experiment was performed in triplicate.7 Tumorsphere Formation Assay. To assess the effects of ANQ on the self-renewal of HCT116, HCT15, and LoVo colon cancer cells, cells (103 cells/well) were seeded in a 6-well ultralow attachment plate (Corning) with serum-free Dulbecco’s modified Eagle medium (DMEM)−F12 medium containing 20 ng/mL epidermal growth factor (EGF; PeproTech, Rocky Hill, NJ, USA), 20 ng/mL basic fibroblast growth factor (bFGF; PeproTech), and B27 (1:50; Gibco) as a stem cell-permissive medium. ANQ was subsequently added and incubated for 10 days, and the formation of tumorspheres was counted under a light microscope.28 Luciferase Reporter Assay. HCT15 and HCT116 cells were seeded in 24-well plates at a density of 2 × 105 cells/well and transfected with TOPflash or FOPflash plasmids together with an Renilla luciferase (RL)-TK plasmid with a PolyJET transfection reagent (SignaGen Laboratories) for 24 h. Cells were refreshed with complete medium, and ANQ was then added for a further 18 h. The luciferase activity was measured using a dual-luciferase assay kit (Promega, Madison, WI, USA). RL activity was used for transfection efficiency normalization. Cellular Extraction and Western Blot Analysis. Whole-cell extracts were lysed in ice-cold RIPA buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.4, 1 mM EGTA, 0.025% sodium deoxycholate, 1% Nonidet P-40) supplemented with protease inhibitor cocktail and phosphatase inhibitor cocktail ((Millipore, Bedford, MA, USA). To extract cytoplasmic and nuclear fractions, cells were incubated in hypotonic buffer (20 mM Tris-HCl at pH 7.4, 10 mM NaCl, 3 mM MgCl2, and 0.05% NP40) on ice for 15 min and vortexed for 10 s

leading causes of cancer-related deaths. Additionally, acquired mutations in oncogenes such as KRAS or PI3K render tumor cells less responsive to treatment. Moreover, recent studies reported that cancer stem cells play a crucial role in tumor initiation, metastasis, and drug resistance.14 Cancer stem cells refer to a small population of cancer cells that differ from the bulk tumor. Cancer stem cells can undergo molecular regulation similar to normal stem cells, including perpetual proliferation, persistent self-renewal, and differentiation. Cancer stem cells are considered to have more drug-resistant and metastatic capabilities than nontumorigenic cancer cells, and these characteristics limit the efficacy of chemotherapeutic drugs.15,16 Traditional therapies primarily target nontumorigenic cancer cells; the tumor, however, will regenerate because of the self-renewal property of cancer stem cells. Therefore, drugs that are capable of inhibiting both cancer and cancer stem cells may have the potential to overcome obstacles in cancer treatment. Moreover, identifying bioactive compounds from dietary-derived agents with the ability to repress cancer stem cell-like properties may provide novel approaches to cancer prevention strategies.17 Cancer stem cells are regulated by specific factors and signaling. Pluripotent stemness factors (Oct4, Nanog, c-Myc, Klf4, and Sox2), which reprogram adult somatic cells into induced pluripotent stem cells,18 were found to be up-regulated in cancer stem cells. Overexpression of these pluripotent stemness factors not only helps maintain stem-like properties but is also associated with the malignant progression of cancer cells.19−21 Additionally, induction of the EMT by overexpressing specific factors, including Snail and Twist, was shown to generate cells with stem cell-like signatures.22,23 Moreover, activation of Wnt/β-catenin signaling plays a crucial role in neoplastic transformation, especially in colon cancer. βCatenin acts as a transcription cofactor with the T-cell factor (TCF). In unstimulated cells, β-catenin associates with glycogen synthase kinase (GSK)-3β, adenomatous polyposis coli (APC), axin, and casein kinase. GSK-3β phosphorylates βcatenin and triggers its ubiquitination and degradation. On the contrary, phosphorylation and inactivation of GSK-3β by the Wnt ligand or mitogen-activated protein kinase (MAPK)/AKT signaling results in activation of β-catenin. β-Catenin in turn results in stabilization and leads to its activation.24 The AKT axis and Wnt cascade are two signaling pathways with pivotal roles in regulating cell growth, the EMT, self-renewal, and cancer stem cell-like properties.25,26 AKT and Wnt signaling were previously linked to cancer stem cell-like properties in colon cancer, and both the AKT and Wnt cascades were proposed as promising anticancer targets in colon cancer and cancer stem cells.27 Unfortunately, efforts to translate AKT or Wnt antagonists into useful drugs have so far been unsuccessful. On the basis of those reports, we investigated the inhibitory effects and underlying molecular mechanism of ANQ on cancer stem cell-like properties in colon cancer cells. We identified that ANQ substantially inhibited cancer stem cell-like gene expressions, tumor migration/invasion, and tumorsphere formation in colon cancer cells. The inhibitory mechanism of ANQ was identified as modulation of the AKT/GSK3β/βcatenin signaling axis.

■

MATERIALS AND METHODS

Chemicals. ANQ was extracted from mycelia of A. camphorata, kindly provided by Prof. Tzong-Huei Lee as previously reported.7,8 The spectrum of ANQ was validated by 1H and 13C NMR (Bruker B

DOI: 10.1021/acs.jafc.6b04101 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry every 5 min. Cells were centrifuged for 10 min at 3000 rpm and 4 °C. The supernatant containing the cytoplasmic fraction was collected, and the pellet containing the nuclear fraction was extracted with RIPA buffer for further analysis. Equal amounts of protein were mixed with 4× Laemmli protein sample buffer (Bio-Rad) and subjected on a sodium dodecyl sulfate (SDS)−polyacrylamide gel. After electrophoresis, the gel was transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore). The membrane was blocked with 1% bovine serum albumin/TBS-Tween 20 at room temperature for 1 h and then incubated overnight with specific indicated primary antibodies. The membrane was washed with TBS−Tween 20 and incubated with the appropriate secondary antibody (GeneTex). Immunoreactive bands were visualized with an enhanced chemiluminescence Western blot detection kit (Millipore). Real-Time Polymerase Chain Reaction. Total RNA was extracted, reverse-transcribed with a High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific), and amplified by EvaGreen Master Mix (Biotium, Hayward, CA, USA) in the StepOne Real-Time PCR system (Thermo Fisher Scientific). Results were calculated using the equation ΔΔCT and are expressed as the multiple of change relative to a control sample. Primer sequences are listed in Table 1. The housekeeping gene glyceraldehyde-3-phosphatedehydrogenase (GAPDH) is used as internal control.28

Structural figures were generated with the program LigPlot30 and PyMOL (Schroedinger, New York, NY, USA). Statistical Analysis. Each experiment was performed in triplicate, and results are expressed as the mean ± standard error (SE). The significance of the difference from the respective controls for each experimental test condition was assayed using an unpaired t test. (∗) p < 0.05 or (∗∗) p < 0.01 was regarded as a significant difference related to the indicated group. Statistical analysis was carried out using GraphPad Prism software.

■

RESULTS ANQ Inhibits Cell Growth and Suppresses the Migratory/Invasive Ability of Human Colon Cancer Cells. ANQ is a ubiquinone derivative from A. camphorata (Figure 1). Our recent study reported that ANQ possesses the

Table 1. Oligonucleotides for the Real-Time PCR Assay gene

a

Figure 1. Chemical structure of antroquinonol (ANQ).

a

sequence (5′→3′)

ALDH

F: CCGTGGCGTACTATGGATGC R: GCAGCAGACGATCTCTTTCGAT

ABCG2

F: GAAGTCCCTGAGAAACTCCT R: CACAGAATTCATCACAAACG

Bmi1

F: TGAAGATAGAGGAGAGGTTGC R: CTGCTGGGCATCGTAAGTAT

CD133

F: GATCTGGTGTCCAGCATG R: ACATGAAAAGACCTGGGGG

EpCAM

F: CTGGCCGTAAACTGCTTTGT R: AGCCCATCATTGTTCTGGAG

Nanog

F: GTCCCGGTCAAGAAACAGAA R: TGCGTCACACCATTGCTATT

Sox2

F: ATGGGTTCGGTGGTCAAGT R: ATGTGTGAGAGGGGCAGTGT

Oct4

F: ATTCAGCCAAACGACCATCT R: ACACTCGGACCACATCCTTC

GAPDH

F: CTTCACCACCATGGAGGAGGC R: GGCATGGACTGTGGTCATGAG

ability to inhibit breast cancer migration/invasion by inhibiting the EMT and MMP-9 gene expression.7 Gain of EMT function was reported to impart stemness properties to cells. Therefore, it is worthwhile further investigating the effect of ANQ on cancer stem cell-like characteristics. Three colon cancer cells lines, HCT15, HCT116, and LoVo cells, were treated with different concentrations of ANQ (0−80 μM), and cell viability was measured by an MTT assay. Results showed that ANQ at high concentrations (40−80 μM) exhibited growth inhibitory activities in the three colon cancer cell lines, whereas low concentrations of ANQ (2.5−20 μM) showed modest growth inhibition (Figure 2A). Values of the 50% growth inhibition (GI50) of ANQ on HCT15 and LoVo cells were 34.8 ± 0.07 and 17.9 ± 0.07 μM, and the GI50 of ANQ on HCT116 cells was >80 μM. To evaluate the effect of ANQ on colon cancer migration/invasion, cells were seeded in a transwell and incubated with ANQ. Results showed that treatment with 5− 20 μM ANQ dose-dependently inhibited the migratory and invasive capabilities of the three colon cancer cell lines (Figure 2B). These data suggest that ANQ displays moderate potency to inhibit the growth of colon cancer cells and relatively higher potency to inhibit their migration and invasion. ANQ Inhibits Expressions of Self-Renewal and Cancer Stem Cell-like Genes in Colon Cancer Cells. To further identify the effects of ANQ on cancer stem cell-like traits, we assessed the self-renewal ability by a tumorsphere formation assay. Colon cancer cells were cultivated in stem cell media containing ANQ (0−20 μM) for 10 days, and the formation of tumorspheres was observed. Results showed that the tumorsphere-forming ability was significantly inhibited by ANQ in the three colon cancer cell lines (Figure 3A). Moreover, downregulated expressions of pluripotent stemness factors (Klf4, Oct4, and Sox2) (Figure 3B) and decreased expressions of cancer stem cell-like genes were observed in the presence of ANQ (Figure 3C). These data suggest that ANQ might exhibit the potential to suppress stemness in colon cancer. ANQ Down-regulates Expressions of Cancer Stem Cell-like Genes through Inhibiting the AKT/GSK3β/βCatenin Signaling Axis. Because previous studies reported

F, forward; R, reverse.

Molecular Docking. Docking experiments were performed using the Discovery Studio 4.0 software package (Accelrys Software, San Diego, CA, USA). Structures of the analyzed compounds were built with the Discovery Studio 4.0 module. Before docking, the structure of a compound was optimized by energy minimization. The wortmannin−PI3Kγ complex (PDB ID: 1E7U) was used in docking experiments.29 Hydrogen atoms were added to the unoccupied valence of the apo PI3Kγ structure. In reference to the wortmannin−PI3Kγ complex structure, the region near the wortmannin-binding site of the apo PI3Kγ structure was selected as the docking region. CDOCKER was used for the docking experiments. C

DOI: 10.1021/acs.jafc.6b04101 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 2. ANQ reduces cell viability of and tumor migration/invasion by colon cancer cells. (A) MTT assay analysis of the growth inhibitory activity of ANQ against colon cancer cells. HCT15, HCT116, and LoVo cells were treated with ANQ at the indicated concentrations for 48 h, and cell viability was determined by an MTT assay. Data are expressed as the percentage viability relative to the untreated group. (B) Transwell migration and invasion assay of the effect of ANQ on colon cancer migration and invasion. Representative images show a randomly selected field from a transwell insert. Data are expressed as the percentage of migrating or invading cells relative to the untreated group. (∗) p < 0.05 and (∗∗) p < 0.01, as evaluated by an unpaired t test.

investigate the regulator upstream of β-catenin in the ANQmediated suppressive effect, colon cancer cells were treated with ANQ for 24 h. We found that phosphorylation of AKT and GSK3β was suppressed in the presence of ANQ (Figure 4E). AKT phosphorylates and inactivates GSK3β, which subsequently induces activation and nuclear translocation of β-catenin. In support of our data, addition of the PI3K/AKT inhibitor, LY294002, abrogated phosphorylation of AKT, which was accompanied by inhibition of GSK3β/β-catenin signaling and β-catenin downstream cyclin D1 expression (Figure 4F). Moreover, inhibition of AKT by LY294002 down-regulated pluripotent protein expressions, including the Klf4 and Sox2 proteins, in colon cancer cells (Figure 4G). Taken together, these data suggest that ANQ potentially inhibits cancer stem cell-like properties in colon cancer cells through targeting the AKT/GSK3β/β-catenin signaling axis.

that aberrant activation of β-catenin signaling plays a crucial role in the stemness of colon cancer, we investigated the effect of ANQ on β-catenin signaling. HCT15 and HCT116 cells were transfected with a β-catenin/TCF reporter plasmid, and then ANQ was added for 24 h. Results showed that treatment with ANQ significantly suppressed β-catenin/TCF activity on the wild-type TCF-binding element but not the mutant one (Figure 4A). Moreover, ANQ inhibited the nuclear translocation of β-catenin (Figure 4B) and suppressed protein expressions of β-catenin and the β-catenin downstream targets c-Myc and cyclin D1 (Figure 4C). Notably, knockdown of βcatenin in colon cancer cells resulted in a decrease in pluripotent protein expression (Figure 4D), suggesting that βcatenin/TCF is crucial for regulating expressions of cancer stem cell-related genes and that ANQ potentially suppresses βcatenin/TCF activity in colon cancer cells. Furthermore, to D

DOI: 10.1021/acs.jafc.6b04101 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 3. ANQ suppressed tumorsphere formation and stemness gene expressions. (A) HCT15 and HCT116 cells were seeded in an ultralow dish and treated with ANQ (0−20 μM) for 10 days, and numbers of tumorspheres were calculated. (∗) p < 0.05 and (∗∗) p < 0.01. (B) Colon cancer cells were treated with ANQ (0−20 μM) for 24 h, and expressions of pluripotent stem cell proteins (Oct4, Klf4, and Sox2) were analyzed by Western blotting. (C) Colon cancer cells were treated with ANQ (10 μM) for 24 h, and cancer stem cell-like-related genes were analyzed by a realtime PCR.

■

Potential Interaction of ANQ with PI3K. The PI3K/AKT pathway is the most frequently activated pathway in cancer, which extends beyond the direct regulation of cell proliferation and survival. Several drugs targeting PI3K/ATK are currently in clinical trials, alone or in combination, in different types of malignancies. Because AKT is the substrate of PI3K and our data showed that adding the PI3K inhibitor, LY294002, impeded phosphorylation of AKT and the downstream signaling of AKT, we therefore wondered whether PI3K is a target of ANQ. A modeling study using the crystal structure of PI3K was carried out by docking the ATP-binding pocket of PI3K with ANQ. Results showed that the carbonyl group at position 1 and the methoxyl group at position 2 of ANQ formed two hydrogen bonds with the Lys890 residue of PI3K (Figure 5A). Additionally, ANQ appeared to be sandwiched by the side chains of the hydrophobic residues in the ATP-binding sites of PI3K, which include Ser806, Lys833, Ala885, Ile963, and Asp964 (Figure 5A−C). We also conducted chemical similarity analysis of the known PI3K inhibitors including LY294002, quercetin, and staurosporine. The results showed there is no significant similarity among the three inhibitors. Although these inhibitors seem to interact with PI3K with different hydrogen binding residues, the binding pocket of PI3K provides similar van der Waals interactions with these inhibitors. The residues inside the binding pocket, for example, Ile879, Met953, Ile963, and Asp964, all provide van der Waals interactions with these inhibitors. Our data showed that the framework of ANQ lays in a similar pose with those inhibitors of PI3K, in the binding pocket (Figures 5D−F). Our proposed model showed these residues together with Lys833 may provide van der Waals interactions with ANQ. The hydrophobic tail of ANQ can fit the pocket mentioned above.

DISCUSSION Our present study showed for the first time that ANQ potentially inhibits colon cancer stem cell-like traits. ANQ targets PI3K/AKT to down-regulate GSK3β/β-catenin signaling, and therefore inhibits expressions of stemness-associated genes and cancer stem cell-like characteristics (Figure 6). Our previous work also demonstrated that attenuation of AKT/NFκB signaling by ANQ inhibited tumor EMT and invasiveness. Pluripotent stem cell factors, including Klf4, Oct4, Sox2, and cMyc, were identified as core factors in the formation of induced pluripotent stem cells,31 and they also play key roles in maintaining stemness properties in both normal and cancer stem cells. Overexpression of these pluripotent stem cell factors in cancer cells is well documented as participating in tumor initiation, metastasis, and cancer recurrence.21,28 Therefore, identifying natural components with the ability to inhibit pluripotent stem cell factors may have the potential to suppress cancer stemness properties and prevent cancer formation. In the present study, treatment with ANQ substantially suppressed tumor migration/invasion (Figure 2) and tumorsphere formation (Figure 3A) in colon cancer cells. Our data showed that treatment with 2.5−20 μM ANQ in the three colon cancer cell lines for 48 h decreased viability by 10−40%, although it did not induce cell death (data not shown). On the contrary, treatment with ANQ at these concentrations for 24 h effectively inhibited stemness-associated gene expressions and down-regulated the PI3K/AKT mechanism, indicating that these inhibitory effects were not attributed to cytotoxicity. PI3K/AKT plays a critical role in cell growth and survival; therefore, the decrease in cell viability may have been due to inhibition of PI3K/AKT signaling by ANQ. Our present data are consistent with our previous study in which 2.5−10 μM ANQ substantially suppressed breast tumor migration and E

DOI: 10.1021/acs.jafc.6b04101 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 4. ANQ down-regulated β-catenin activation through modulation of the AKT/GSK3β signaling axis. (A) HCT15 and HCT116 cells were treated with ANQ (0−20 μM) for 24 h, and the activity of β-catenin/TCF was analyzed by a luciferase reporter assay as described under Materials and Methods. TOP, TCF reporter plasmid; FOP, mutant TCF-binding site. (∗) p < 0.05 and (∗∗) p < 0.01. (B) Cells were treated with ANQ (0−20 μM) for 24 h, and expressions of β-catenin in the nuclear (NE) and cytosolic extracts (CE) were analyzed by Western blotting. α-Tubulin and poly(ADP ribose) polymerase (PARP) were used as internal controls for the cytosolic and nuclear fractions, respectively. (C) Colon cancer cells were treated with ANQ for 24 h, and protein expressions of β-catenin, c-Myc, and cyclin D1 were analyzed by Western blotting. (D) Knockdown of β-catenin inhibited expressions of pluripotent stem cell proteins. (E) ANQ abrogated AKT/GSK-3β signaling. Cells were treated with ANQ (0−20 μM) for 24 h, and phosphorylation of AKT and GSK-3β was analyzed by Western blotting. (F, G) PI3K/AKT is crucial for regulation of β-catenin/ TCF and pluripotent stem cell protein expressions in colon cancer cells. Cells were treated with LY294002 (0−20 μM) for 24 h, and (F) expressions of the AKT/GSK3β/β-catenin signaling cascade and (G) pluripotent stem cell proteins (c-Myc, Klf4, and Sox2) were analyzed by Western blotting.

μM) inhibited the migration and invasion of C6 glioma cells32 and showed cytoprotective activity against ethanol-induced

invasion without inducing cytotoxicity.7 In support of our data, a recent study reported that ANQ at low concentrations (5−10 F

DOI: 10.1021/acs.jafc.6b04101 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 5. Hypothetical models of PI3K complexed with ANQ. (A) Interactions of the ANQ-PI3Kγ complex shown by LigPlot. Carbon, oxygen, and nitrogen atoms are respectively shown as green, red, and blue circles. Red eyelashes indicate residues involved in hydrophobic interactions. Hydrogen bonds are shown by blue dashed lines. (B) Docking pose of ANQ in the binding site of PI3Kγ. The ANQ molecule is depicted as light-blue sticks. Some important residues involved in the binding to ANQ are indicated by variously colored sticks. Hydrogen bonds are shown as red dashed lines. (C) Surface charge distribution of the ligand-binding site of PI3Kγ. Positive and negative charges are shown by blue and red colors, respectively. The ANQ molecule is depicted by light-blue sticks. (D−F) The docking pose of PI3K inhibitors. ANQ showed a similar binding pose with LY294002 (D), quercetin (E), and staurosporine (F) in the binding pocket of PI3K. The blue circles indicate the moieties of these PI3K inhibitors may provide van der Waals interactions with PI3K. The ANQ molecule is depicted as yellow sticks.

hepatic damage.33 Similarly, the GI50 of ANQ against liver cancer cells was reported to be approximately 3−10 μM.12 On the contrary, a high concentration of ANQ (40 μM) was reported to elicit apoptosis and autophagy in pancreatic cancer cells.10 More evidence is needed to clarify the dose responses of ANQ on cell cycle regulation and the apoptotic mechanism. Together with other studies, we propose that ANQ displays moderate potency to inhibit the growth of cancer cells and relatively higher potency to inhibit their aggressiveness and stemness. Additionally, a recent study reported that 4acetylantroquinonol B (4-AAQB), a derivative of ANQ, inhibits tumorigenesis and expressions of cancer stem-like genes (CD133, CD44, Sox2, Lgr5, and VEGF).34 Our data showed that ANQ inhibited expressions of pluripotent stem cell factors, including Klf4, Oct4, and Sox2. We found that ANQ downregulated mRNA levels of cancer stem cell-related genes including Bmi1, CD133, ALDH, Nanog, and EpCAM (Figure

3). Expressions of these genes were reported to be correlated with tumorigenesis and cancer stemness in colon cancer cells.28,35 These data support the notion that ANQ exhibits the potential to suppress stemness in colon cancer cells. β-Catenin is an important transcriptional factor that regulates stem cell-related genes and maintains self-renewal properties of both normal and malignant stem cells. β-Catenin can be regulated by the Wnt ligand or AKT signaling. Our previous study found that ANQ suppresses expressions of EMT genes through inhibiting AKT/NF-κB signaling.7 In support of our data, inhibition of AKT/mTOR by ANQ was reported to inhibit the growth of lung cancer cells,11 induce cross-talk between apoptosis and autophagy, and accelerate cellular senescence in pancreatic cancer cells.10 In the current study, we further identified that activation of AKT/GSK3β/β-catenin signaling was crucial for regulating expressions of pluripotent stemness factors (Figure 4). Because acquisition of the EMT G

DOI: 10.1021/acs.jafc.6b04101 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

States and Taiwan) for non-small-cell lung cancer and was granted orphan drug status for pancreatic cancer. Taken together, ANQ may be a promising chemopreventive agent for cancer prevention and a therapeutic drug for cancer treatment. It is worth further investigating the combined activities of ANQ with conventional chemotherapy.

■

AUTHOR INFORMATION

Corresponding Author

*(C.-W.L.) Department of Biochemistry and Molecular Cell Biology, School of Medicine, College of Medicine, Taipei Medical University, 250 Wu-Xing Street, Taipei 110, Taiwan. E-mail: [email protected]. Phone: 886-2-27361661, ext. 3160. Fax: 886-2-27356689. ORCID

Tzong-Huei Lee: 0000-0001-8036-7563 Cheng-Wei Lin: 0000-0003-4622-2680 Author Contributions ∥

Figure 6. Proposed model and mechanisms by which ANQ suppresses colon cancer stemness. ANQ targets PI3K, thereby down-regulating the AKT/GSK3β/β-catenin signaling axis and suppressing expressions of cancer stemness- and tumorigenesis-related genes. Additionally, suppression of the AKT/NF-κB pathway by ANQ was identified to inhibit the EMT and aggressiveness in tumors.

M.-H.L. and J.-H.L. contributed equally to this work.

Funding

We acknowledge the support of the Taiwan Protein Project (MOST105-0210-01-12-01). This study was supported by the Ministry of Science and Technology (MOST104-2320-B-038048) and Wan-Fang Hospital (104TMU-WFH-02-3). Notes

confers stem cell-like properties to tumor cells, it is postulated that AKT acts as a major regulator in mediating cancer motility and stemness ability. In the past few years, natural compounds such as quercetin and myricetin were identified as selectively targeting PI3K for the development of anticancer agents.36 The Lys890 residue in PI3K is crucial for ATP binding upon activation of PI3K, and its side chain projects toward the ATP-binding pocket at the entrance to the catalytic site but projects away from the aryl ring of LY294002.37 The interference between Lys890 of PI3K by natural components such as kaempferol was reported to show effective inhibition of neoplastic transformation.38,39 We found that PI3K might be the molecular target of ANQ by hydrogen bonding with the Lys890 residue in PI3K. Additionally, the hydrophobic tail of ANQ lays in a similar pose with those known PI3K inhibitors through van der Waals interactions. However, additional X-ray crystallographic studies to determine the ANQ−PI3K complex structure are required to identify the precise binding modes of ANQ to PI3K. Moreover, a structure−activity relationship study regarding the inhibitory effects of ANQ on PI3K and its anticancer properties is needed to optimize the therapeutic efficacy of ANQ. The investigation of toxicity and pharmacological effects of the drug metabolites is important during drug development. Recently, a phase I pharmacokinetic and safety study of ANQ in patients with non-small-cell lung cancer reported that ANQ administered up to a dose level of 600 mg daily for 4 weeks had a mild toxicity profile,40 suggesting that ANQ exhibits fewer side effects than other anticancer agents. Our study shows consistent results with previous findings that ANQ at 5 μM concentration exhibits antitumor activities; therefore, it is an achievable dosage from the supplement. Moreover, a recent study identified four major metabolites from the urine of ANQtreated rat.41 However, the bioactivity of these metabolites has not been determined yet. After much effort to improve the productivity and exciting biological properties of ANQ, ANQ is currently undergoing phase II clinical trials (in the United

The authors declare no competing financial interest.

■

ABBREVIATIONS USED ANQ, antroquinonol; APC, adenomatous polyposis coli; bFGF, basic fibroblast growth factor; EGF, epidermal growth factor; EMT, epithelial−mesenchymal transition; GAPDH, glyceraldehyde-3-phosphatedehydrogenase; GSK3, glycogen synthase kinase 3; MAPK, mitogen-activated protein kinase; MMP, matrix metalloproteinase; mTOR, mammalian target or rapamycin; PI3K, phosphatidylinositol-3-kinase; TCF, T-cell factor

■

REFERENCES

(1) Hseu, Y. C.; Chen, S. C.; Chen, H. C.; Liao, J. W.; Yang, H. L. Antrodia camphorata inhibits proliferation of human breast cancer cells in vitro and in vivo. Food Chem. Toxicol. 2008, 46, 2680−2688. (2) Peng, C. C.; Chen, K. C.; Peng, R. Y.; Chyau, C. C.; Su, C. H.; Hsieh-Li, H. M. Antrodia camphorata extract induces replicative senescence in superficial TCC, and inhibits the absolute migration capability in invasive bladder carcinoma cells. J. Ethnopharmacol. 2007, 109, 93−103. (3) Chen, K. C.; Peng, C. C.; Peng, R. Y.; Su, C. H.; Chiang, H. S.; Yan, J. H.; Hsieh-Li, H. M. Unique formosan mushroom Antrodia camphorata differentially inhibits androgen-responsive LNCaP and -independent PC-3 prostate cancer cells. Nutr. Cancer 2007, 57, 111− 121. (4) Yang, H. L.; Lin, K. Y.; Juan, Y. C.; Kumar, K. J.; Way, T. D.; Shen, P. C.; Chen, S. C.; Hseu, Y. C. The anti-cancer activity of Antrodia camphorata against human ovarian carcinoma (SKOV-3) cells via modulation of HER-2/neu signaling pathway. J. Ethnopharmacol. 2013, 148, 254−265. (5) Geethangili, M.; Tzeng, Y. M. Review of pharmacological effects of Antrodia camphorata and its bioactive compounds. Evidence-Based Complement. Alternat. Med. 2011, 2011, 212641. (6) Wang, S. C.; Lee, T. H.; Hsu, C. H.; Chang, Y. J.; Chang, M. S.; Wang, Y. C.; Ho, Y. S.; Wen, W. C.; Lin, R. K. Antroquinonol D, isolated from Antrodia camphorata, with DNA demethylation and anticancer potential. J. Agric. Food Chem. 2014, 62, 5625−5635.

H

DOI: 10.1021/acs.jafc.6b04101 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry (7) Lee, W. T.; Lee, T. H.; Cheng, C. H.; Chen, K. C.; Chen, Y. C.; Lin, C. W. Antroquinonol from Antrodia camphorata suppresses breast tumor migration/invasion through inhibiting ERK-AP-1- and AKTNF-kappaB-dependent MMP-9 and epithelial-mesenchymal transition expressions. Food Chem. Toxicol. 2015, 78, 33−41. (8) Lee, T. H.; Lee, C. K.; Tsou, W. L.; Liu, S. Y.; Kuo, M. T.; Wen, W. C. A new cytotoxic agent from solid-state fermented mycelium of Antrodia camphorata. Planta Med. 2007, 73, 1412−1415. (9) Wang, H. C.; Chu, F. H.; Chien, S. C.; Liao, J. W.; Hsieh, H. W.; Li, W. H.; Lin, C. C.; Shaw, J. F.; Kuo, Y. H.; Wang, S. Y. Establishment of the metabolite profile for an Antrodia cinnamomea health food product and investigation of its chemoprevention activity. J. Agric. Food Chem. 2013, 61, 8556−8564. (10) Yu, C. C.; Chiang, P. C.; Lu, P. H.; Kuo, M. T.; Wen, W. C.; Chen, P.; Guh, J. H. Antroquinonol, a natural ubiquinone derivative, induces a cross talk between apoptosis, autophagy and senescence in human pancreatic carcinoma cells. J. Nutr. Biochem. 2012, 23, 900− 907. (11) Kumar, V. B.; Yuan, T. C.; Liou, J. W.; Yang, C. J.; Sung, P. J.; Weng, C. F. Antroquinonol inhibits NSCLC proliferation by altering PI3K/mTOR proteins and miRNA expression profiles. Mutat. Res., Fundam. Mol. Mech. Mutagen. 2011, 707, 42−52. (12) Chiang, P. C.; Lin, S. C.; Pan, S. L.; Kuo, C. H.; Tsai, I. L.; Kuo, M. T.; Wen, W. C.; Chen, P.; Guh, J. H. Antroquinonol displays anticancer potential against human hepatocellular carcinoma cells: a crucial role of AMPK and mTOR pathways. Biochem. Pharmacol. 2010, 79, 162−171. (13) Siegel, R. L.; Miller, K. D.; Jemal, A. Cancer statistics, 2015. Ca− Cancer J. Clin. 2015, 65, 5−29. (14) Hu, Y.; Fu, L. Targeting cancer stem cells: a new therapy to cure cancer patients. Am. J. Cancer Res. 2012, 2, 340−356. (15) Clarke, M. F.; Fuller, M. Stem cells and cancer: two faces of eve. Cell 2006, 124, 1111−1115. (16) Gupta, P. B.; Onder, T. T.; Jiang, G.; Tao, K.; Kuperwasser, C.; Weinberg, R. A.; Lander, E. S. Identification of selective inhibitors of cancer stem cells by high-throughput screening. Cell 2009, 138, 645− 659. (17) Khan, S.; Karmokar, A.; Howells, L.; Thomas, A. L.; Bayliss, R.; Gescher, A.; Brown, K. Targeting cancer stem-like cells using dietaryderived agents − where are we now? Mol. Nutr. Food Res. 2016, 60, 1295−1309. (18) Takahashi, K.; Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006, 126, 663−676. (19) Chiou, S. H.; Wang, M. L.; Chou, Y. T.; Chen, C. J.; Hong, C. F.; Hsieh, W. J.; Chang, H. T.; Chen, Y. S.; Lin, T. W.; Hsu, H. S.; Wu, C. W. Coexpression of Oct4 and Nanog enhances malignancy in lung adenocarcinoma by inducing cancer stem cell-like properties and epithelial-mesenchymal transdifferentiation. Cancer Res. 2010, 70, 10433−10444. (20) Hermann, P. C.; Huber, S. L.; Herrler, T.; Aicher, A.; Ellwart, J. W.; Guba, M.; Bruns, C. J.; Heeschen, C. Distinct populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer. Cell Stem Cell 2007, 1, 313−323. (21) Ben-Porath, I.; Thomson, M. W.; Carey, V. J.; Ge, R.; Bell, G. W.; Regev, A.; Weinberg, R. A. An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat. Genet. 2008, 40, 499−507. (22) Mani, S. A.; Guo, W.; Liao, M. J.; Eaton, E. N.; Ayyanan, A.; Zhou, A. Y.; Brooks, M.; Reinhard, F.; Zhang, C. C.; Shipitsin, M.; Campbell, L. L.; Polyak, K.; Brisken, C.; Yang, J.; Weinberg, R. A. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008, 133, 704−715. (23) Yang, M. H.; Hsu, D. S.; Wang, H. W.; Wang, H. J.; Lan, H. Y.; Yang, W. H.; Huang, C. H.; Kao, S. Y.; Tzeng, C. H.; Tai, S. K.; Chang, S. Y.; Lee, O. K.; Wu, K. J. Bmi1 is essential in Twist1-induced epithelial-mesenchymal transition. Nat. Cell Biol. 2010, 12, 982−92. (24) Clevers, H. Wnt/beta-catenin signaling in development and disease. Cell 2006, 127, 469−480.

(25) Katoh, M. Network of WNT and other regulatory signaling cascades in pluripotent stem cells and cancer stem cells. Curr. Pharm. Biotechnol. 2011, 12, 160−170. (26) Larue, L.; Bellacosa, A. Epithelial-mesenchymal transition in development and cancer: role of phosphatidylinositol 3′ kinase/AKT pathways. Oncogene 2005, 24, 7443−7454. (27) Reya, T.; Clevers, H. Wnt signalling in stem cells and cancer. Nature 2005, 434, 843−850. (28) Lin, C. W.; Liao, M. Y.; Lin, W. W.; Wang, Y. P.; Lu, T. Y.; Wu, H. C. Epithelial cell adhesion molecule regulates tumor initiation and tumorigenesis via activating reprogramming factors and epithelialmesenchymal transition gene expression in colon cancer. J. Biol. Chem. 2012, 287, 39449−39459. (29) Wu, P.; Hu, Y. Z. Small molecules targeting phosphoinositide 3kinases. MedChemComm 2012, 3, 1337−1355. (30) Wallace, A. C.; Laskowski, R. A.; Thornton, J. M. LIGPLOT: a program to generate schematic diagrams of protein-ligand interactions. Protein Eng., Des. Sel. 1995, 8, 127−134. (31) Takahashi, K.; Tanabe, K.; Ohnuki, M.; Narita, M.; Ichisaka, T.; Tomoda, K.; Yamanaka, S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007, 131, 861−872. (32) Thiyagarajan, V.; Tsai, M. J.; Weng, C. F. Antroquinonol targets FAK-signaling pathway suppressed cell migration, invasion, and tumor growth of C6 glioma. PLoS One 2015, 10, e0141285. (33) Kumar, K. J.; Chu, F. H.; Hsieh, H. W.; Liao, J. W.; Li, W. H.; Lin, J. C.; Shaw, J. F.; Wang, S. Y. Antroquinonol from ethanolic extract of mycelium of Antrodia cinnamomea protects hepatic cells from ethanol-induced oxidative stress through Nrf-2 activation. J. Ethnopharmacol. 2011, 136, 168−177. (34) Chang, T. C.; Yeh, C. T.; Adebayo, B. O.; Lin, Y. C.; Deng, L.; Rao, Y. K.; Huang, C. C.; Lee, W. H.; Wu, A. T.; Hsiao, M.; Wu, C. H.; Wang, L. S.; Tzeng, Y. M. 4-Acetylantroquinonol B inhibits colorectal cancer tumorigenesis and suppresses cancer stem-like phenotype. Toxicol. Appl. Pharmacol. 2015, 288, 258−268. (35) Zhang, C.; Zhou, C.; Wu, X. J.; Yang, M.; Yang, Z. H.; Xiong, H. Z.; Zhou, C. P.; Lu, Y. X.; Li, Y.; Li, X. N. Human CD133-positive hematopoietic progenitor cells initiate growth and metastasis of colorectal cancer cells. Carcinogenesis 2014, 35, 2771−2777. (36) Walker, E. H.; Pacold, M. E.; Perisic, O.; Stephens, L.; Hawkins, P. T.; Wymann, M. P.; Williams, R. L. Structural determinants of phosphoinositide 3-kinase inhibition by wortmannin, LY294002, quercetin, myricetin, and staurosporine. Mol. Cell 2000, 6, 909−919. (37) Frazzetto, M.; Suphioglu, C.; Zhu, J.; Schmidt-Kittler, O.; Jennings, I. G.; Cranmer, S. L.; Jackson, S. P.; Kinzler, K. W.; Vogelstein, B.; Thompson, P. E. Dissecting isoform selectivity of PI3K inhibitors: the role of non-conserved residues in the catalytic pocket. Biochem. J. 2008, 414, 383−390. (38) Lee, K. M.; Lee, K. W.; Byun, S.; Jung, S. K.; Seo, S. K.; Heo, Y. S.; Bode, A. M.; Lee, H. J.; Dong, Z. 5-Deoxykaempferol plays a potential therapeutic role by targeting multiple signaling pathways in skin cancer. Cancer Prev. Res. 2010, 3, 454−465. (39) Lee, K. M.; Lee, D. E.; Seo, S. K.; Hwang, M. K.; Heo, Y. S.; Lee, K. W.; Lee, H. J. Phosphatidylinositol 3-kinase, a novel target molecule for the inhibitory effects of kaempferol on neoplastic cell transformation. Carcinogenesis 2010, 31, 1338−1343. (40) Lee, Y. C.; Ho, C. L.; Kao, W. Y.; Chen, Y. M. A phase I multicenter study of antroquinonol in patients with metastatic nonsmall-cell lung cancer who have received at least two prior systemic treatment regimens, including one platinum-based chemotherapy regimen. Mol. Clin. Oncol. 2015, 3, 1375−1380. (41) Chen, C. K.; Kang, J. J.; Wen, W. C.; Chiang, H. F.; Lee, S. S. Metabolites of antroquinonol found in rat urine following oral administration. J. Nat. Prod. 2014, 77, 1061−1064.

I

DOI: 10.1021/acs.jafc.6b04101 J. Agric. Food Chem. XXXX, XXX, XXX−XXX