Application of DNA Machineries for the Barcode Patterned Detection

Subscriber access provided by Kaohsiung Medical University

Article

Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins Zhixin Zhou, Guo-Feng Luo, Verena Wulf, and Itamar Willner Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.7b04916 • Publication Date (Web): 08 May 2018 Downloaded from http://pubs.acs.org on May 8, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins Zhixin Zhou,‡ Guofeng Luo,‡ Verena Wulf and Itamar Willner* Institute of Chemistry, The Minerva Center for Biohybrid Complex Systems, The Hebrew University of Jerusalem, Jerusalem 91904, Israel ‡

These authors contributed equally.

E-mail: [email protected] Fax: 972-2-6527715

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligands analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two- or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multi-band barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal’s triangle. As a proof-of-concept, the detection of one of six genes, i.e., TP53, Werner Syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene and Cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.

2 Environment ACS Paragon Plus

Page 2 of 29

Page 3 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction The application of nucleic acids as functional constituents for the development of bioanalytical platforms for gene analysis,1 microRNAs2 or aptamer-ligand complexes3-6 detection

attracts

continuous

interest.

Different

optical,7-9

electrochemical,10-14

microgravimetric,15-17 stress sensors18 and more19-20 that use nucleic acid as recognition units were developed. Among the challenges involved with the development of nucleic acid based sensors, issues of sensitivity, multiplexed analysis and high throughput sensing were addressed. Improved sensitivities were accomplished by conjugating catalysts, such as enzymes,21-22 DNAzymes23 or catalytic nanoparticles24 to the sensing events and by the development of analytical assays that recycle the analyte as a part of the sensing events.25-28 Multiplexed analysis of genes or aptamer-ligand complexes was achieved, for example, by applying different sized semiconductor quantum dots29-32 or different sized nucleic acidstabilized Ag nanoclusters,33 and by the application of different fluorophore-labeled nucleic acid probes in combination with nanomaterials, e.g., graphene oxide.34-35 High throughput detection of DNA was reported using quantum dot barcodes,36-37 magnetic barcodes38 or patterned multi-metal nano-rods.39 The development of highly sensitive isothermal detection schemes for the analysis of genes or aptamer-ligand complexes attracts growing interest. A variety of DNA machineries for the amplified detection of genes or aptamer-ligand complexes were developed.40 These included, for example, the rolling circle amplification process that yields catalytic DNAzyme polymer chains,41-42 the development of polymerase/nicking enzyme machineries that synthesize DNAzymes as the result of gene recognition43 or the formation of ligand-aptamer complexes,44 the application of the hybridization chain reaction that synthesizes DNAzyme as a result of gene recognitions,45-46 and the dendritic amplified detection of genes by coupling the hybridization chain reaction with the rolling circle amplification processes.47



The different sensing platforms involving nucleic acid probes require the application of optical, electrochemical or catalytic labels for the amplification and/or transduction of the sensing events. A major breakthrough in gene or aptamer-ligand complex detection can be envisaged by designing a label-free analytical method for the one-shot analysis of a single analyte from a diverse collection of possible analytes. In the present study we introduce a label-free method to detect genes or aptamer-ligand complexes by DNA machineries that yield nucleic acid barcodes as readout signals. We demonstrate that this analytical approach allows the detection of an individual analyte out of many target analytes (genes or aptamer ligands) using the electrophoretic separation of a barcode nucleic acid pattern as a readout “signature” for the detected analyte. By operating, in parallel, the DNA machineries for analyzing different samples, the resulting barcode patterns are used to detect the analytes in the samples.

Experimental section Materials. Klenow fragment (3→5 exo-), dNTPs, and Nt.BbvCI nicking enzyme were purchased from New England Biolabs Inc. (Beverly, MA, USA). VEGF and thrombin were purchased from Sigma-Aldrich. All DNA oligonucleotides in the study were HPLC-purified and purchased from Integrated DNA Technologies Inc. (Coralville, IA). The following DNA sequences were used in the study (5’ to 3’ direction). Type T1a (TP53) T1b (TP53) T1c (TP53) T2a (BRCA1)

Sequence CTTCCCTTCCACTCCATCTAACTTCAACTAACGTCGCTG AGGAGTTTAGATCAATCCTACGA CTTCCACTCCATCTAACTTCAACTAACGTCGCTGAGGA GTTTAGATCAATCCTACGA ACTCCATCTAACTTCAACTAACGTCGCTGAGGAGTTTA GATCAATCCTACGA ACTCCATCTAACTTCAACTAACGTCGCTGAGGCTTCCA ACAGCTA TAAACAGTCCTT


Page 4 of 29

Page 5 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


T2b (BRCA1) T2c (BRCA1) T3a (Smallpox)

ATCTAACTTCAACTAACGTCGCTGAGGCTTCCAACAGC TATAAACAGTCCTT CTTCCCTTCCACTCCATCTAACTTCAACTAACGTCGCTG AGGCTTCCAACAGCTATAAACAGTCCTT ATCTAACTTCAACTAACGTCGCTGAGGTATACCATGAA ATACG

T3b (Smallpox) ACTTCAACTAA CGTCGCTGAGGTATACCATGAAATACG T3c (Smallpox) AACTAACGTCGCTGAGGTATACC ATGAAATACG T4a (Werner

CTTCCACTCCATCTAACTTCAACTAACGTCGCTGAGGCA

Syndrome)

TCTTCAAATCCATCTTCTTTTCATTCCACTTT

b

T4 (Werner

ATCTAACTTCAACTAACGTCGCTGAGGCATCTTCAAAT

Syndrome)

CCATCTTCTTTTCATTCCACTTT

a

T5 (Tay-Sachs ACTTCAACTAACGTCGCTGAGGGAACCGTATATCTATC mutant)

CTATG

T5b (Tay-Sachs CTTCCACTCCATCTAACTTCAACTAACGTCGCTGAGGG mutant)

AACCGTATATCTATCCTATG

T6a (Tay-Sachs ACTTCAACTAACGTCGCTGAGGGAACCGTATATCCTAT normal)

GGCC

b

T6 (Tay-Sachs CTTCCACTCCATCTAACTTCAACTAACGTCGCTGAGGG normal) T7a (Cystic fibrosis) T7b (Cystic fibrosis) P1 (VEGF)

P2 (VEGF)

P3 (Thrombin)

P4 (Thrombin)

AACCGTATATCCTATGGCC ACTTCAACTAACGTCGCTGAGGAACACCAAAGATGATA TT ATCTAACTTCAACTAACGTCGCTGAGGAACACCAAAGA TGATATT ACTTCATCTAACTTCAACTAACGTCGCTGAGGAGTCTAT TGTGGGGGTGGACGGGCCGGGTAGAGACGGACT ATCTAACTTCAACTAACGTCGCTGAGGAGTCTACTGTG GGGGTGGACGGGCCGGGTAGAGACGGACT CTTCCACTTCATCTAACTTCAACTAACGTCGCTGAGGAG TCCGTGGTAGGGCAGGTTGGGGTGACT ATCTAACTTCAACTAACGTCGCTGAGGAGTCCGTGGTA GGGCAGGTTGGGGTGACT

P5 (Thrombin) ACTTCAACTAACGTCGCTGAGGAGTCCGTGGTAGGGCA



GGTTGGGGTGACT Smallpox virus gene TP53 gene BRCA1 gene BRCA1 mismatch

CGTATTTCATGGTATA TCGTAGGATTGATCTAAACT CAGGACTGTTTATAGCTGTTGGAAG CAGGACTGTTTATAGCTGTTGGAAC

Werner Syndrome

AAAGTGGAATGAAAAGAAGATGGATTTGAAGATG

gene Tay-Sachs mutant gene Tay-Sachs normal gene Cystic fibrosis gene

CATAGGATAGATATACGGTTC

GGGCCATAGGATATACGGTTC

AATATCATCTTTGGTGTT

The recognition sequence of nicking enzyme is indicated in bold, and the respective aptamer sequences are underlined. General procedure for operating the replication/nicking machineries for the formation of the barcode patterns. All the assays were prepared in 50 µL of 1×NEBuffer 2 buffer that contained 10 mM Tris-HCl (pH 7.9), 50 mM NaCl, 10 mM MgCl2, and 1 mM dithiothreitol. The working solution included 1 µM of each DNA template and 1 µM of the respective target gene. The solution was incubated at 37 oC for 30 min. Next, dNTPs (0.5 mM), Klenow fragment (0.2 U/µL) and Nt.BbvCI (0.2 U/µL) were added to the mixture and incubated at 37 o

C for 1 h. The barcode products were analyzed using a 20% nondenaturating polyacrylamide

gel electrophoresis (PAGE) at 300 V for 6 h. After electrophoresis, the gel was SYBRstained and imaged by a digital camera. Analysis of the targets was examined, when even needs, in the concentration range 0.5 nM to 1 µM.

Results and Discussion


Page 6 of 29

Page 7 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1 outlines the concept of the barcoded, label-free detection of genes using polymerization/nicking enzyme DNA machineries. The concept is exemplified with the detection of a gene (1) by a barcode consisting of two nucleic acids of different lengths. The sensing platform is composed of two templates T1 and T2. Each of the templates includes a recognition sequence X1, a sequence l that upon replication yields a nicking site in the replicated sequence and a dictated sequence S1 or S2, that yields upon replication the predesigned barcode constituents. In the presence of the target analyte gene, the analyte binds to the two templates. In the presence of polymerase/dNTPs and the nicking enzyme Nt.BbvCI, replication of the templates T1 and T2 proceeds, followed by the nicking of the replicated domain. Nicking of the replicated strand allows the subsequent replication of the templates while displacing the strands I1 and I2 that are of different lengths. The strands I1 and I2 provide the barcode transducing constituents, and their electrophoretic separation provide a pattern for the detection of the gene. By staining the electrophoretically separated bands, quantitative evaluation of the genes can be accomplished. That is, the recognition of the respective gene by the appropriate template-scaffolds activates the replications/nicking machinery that yields the pre-designed nucleic acid barcode that defines the nature of the gene. The replication/nicking machinery, represents an autonomous amplification process whereby the capturing of the analyzed gene by the corresponding scaffolds initiates the polymerase/dNTPs induced replication of the respective scaffolds. Each of the scaffolds includes a nicking site, and nicking of the replicated strands by Nt.BbvCI yields an opening for the re-replication of the scaffolds, while displaying the original replicated strands I1 and I2. The displaced strands include the information to define the respective barcode pattern that is electrophoretically separated. Evidently, the DNA machinery shown in Figure 1, represents an amplified gene detection scheme, as upon the recognition of the analyte by the two templates, the cyclic, continuous polymerization/nicking machinery is activated to



accumulate the barcode strands, I1, I2. Several important features of this sensing platform should be emphasized: (i) The system can yield barcodes consisting of one, two, three and more barcode transducing strands, and the electrophoretically separated pattern of the barcodes provides a “finger-print” for a specific gene. That is, diverse genes can be analyzed by an appropriate mixture of templates Ti provided that appropriate resolution of the separated bands is possible. (ii) The sensing platform represents an amplified detection system for the label-free analysis of the analytes. (iii) The DNA machinery generating the barcode patterns can be extended to other analytes, such as the detection of aptamer-ligand complexes (vide infra). Figure 2 exemplifies the analysis of three different genes (TP53; Smallpox; BRCA1) using a single barcode band as electrophoretic readout pattern. A mixture of three templates T1a to T3a is prepared, where the templates T1a, T2a and T3a include recognition sites Xi for the respective genes (X1 for TP53; X2 for BRCA1; X3 for Smallpox). The mixture was subjected separately to each of the genes and the replication/nicking machinery was activated, and followed by the electrophoretic separation of the displaced single strand barcodes. Figure 2(B) (right) depicts the reference lane of the nucleic acids that are expected to be generated by the templates T1a – T3a as well as nucleic acid barcodes for other replication systems (vide infra), upon analyzing any of the possible genes. Figure 2(B), lanes 1, 2 and 3 show the pattern of the generated bands that correspond to the respective genes BRCA1, Smallpox and TP53. The results demonstrate clear separation of the single barcode strands that allow the identification of each of the strands upon comparison to the reference ladder. In the next step, Figure 3, we applied the sensing platform to analyze one of three possible genes (TP53, BRCA1, Smallpox) using a set of six template machineries T1a T1b, T2a T2b, T3b T3c that yield a two-band barcode product for each of the analytes (T1a T1b for TP53; T2a T2b for BRCA1 and T3b T3c for Smallpox). Figure 3(A) exemplifies schematically the two-


Page 8 of 29

Page 9 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


barcode analysis of TP53. The reference pattern of the template-generated two-band barcodes that can be generated by the respective DNA machineries is shown in Figure 3(B), right. Subjecting the template mixture to the respective analytes, followed by the activation of the polymerization/nicking machinery, and the electrophoretic separation of the respective twoband barcode patterns generated by the respective templates is shown in Figure 3(B), lanes 13. Clearly, each of the genes can be selectively analyzed by the mixture of the templates and using the two-band barcode pattern as identification readout. Similarly, Figure 4(A) depicts schematically the analysis of a TP53 using the replication/nicking machinery and a threeband barcode as imagining pattern. Figure 4(B) shows the identification of the three genes TP53, BRCA1 and Smallpox using a mixture of nine templates T1a T1b T1c, T2a T2b T2c, T3a T3b T3c that yield distinct three-band barcode patterns upon analyzing each of the genes. Figure 4(B), right, depicts the reference lane corresponding to the three-band barcodes that are anticipated to be generated by the DNA machineries of the template mixtures, upon analyzing any of the three genes. Accordingly, a mixture consisting of nine templates that upon recognition of the different target analytes trigger the replication/nicking machineries to yield the three-band barcode patterns, was subjected to the different genes. Figure 4(B) shows the electrophoretic pattern of the three-bands barcodes generated upon subjecting the sensing mixture to any of the genes. Clearly each of the genes generates the barcode pattern bands that correspond to the reference bands programmed upon designing the sensing mixture of the DNA template scaffolds. Besides the qualitative detection of the genes by the pattern of the barcodes generated by the DNA machineries, the systems can also be applied to evaluate the quantitative concentration of the respective genes. For example, Figure 5 shows the two-band barcode patterns generated by the template mixture discussed in Figure 3 upon subjecting the mixture to different concentrations of the TP53. In these experiments, the template mixture is allowed



Page 10 of 29

to operate the replication/nicking process that generates the barcode bands for a time-interval of 6 hours. Evidently, as the concentration of the gene decreases, the barcode bands are weaker,

consistent

with

the

less-efficient

production

of

the

bands

by

the

polymerization/nicking machinery, as the analyte concentration decreases. In this specific set of experiments, the TP53 gene could be detected with a sensitivity that corresponds to 1 nM. One should note, however, that the sensitivity of the system and the visualization of the barcode pattern can be improved by prolonging the operating time-interval of the polymerization/nicking machinery that intensifies the contents of the displaced barcode. For example, Figure S1, supporting information, shows the electrophoretically separated barcodes, upon analyzing the TP53 gene in the concentration range 1 nM-1µM and operating the replication/nicking machinery for a time-interval of 10 hours. Clearly, comparison of the barcode bands generated by the polymerization/nicking machinery operated for 6 and 10 hours, Figure 5 and Figure S1, reveals that the intensity of the barcode bands is intensified upon prolonging the operation of the polymerization/nicking machinery. Furthermore, the TP53 gene at a concentration of 0.5 nM can not be detected by a visible barcode upon operation of the replicated/nicking machinery for 10 hours. The barcode pattern could be detected, however, upon operating the replication/nicking machinery for a time-interval of 15 hours (see Figure S1, supporting information). The advantage of the multi-band barcoded detection of genes by the mixture of template replication/nicking machineries rests on the ability to design functional analysis mixtures that are capable to detect one of many target genes in a single-shot experiment. To account for this advantage, we recall to the Pascal pyramide, Figure 6, that relates the number of reference lines n to the number of barcode k, with the number of possible target analytes. According to this paradigm the sum of possible analytes ∑, that can be analyzed by a


Page 11 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mixture of templated machineries is given by eq. 1 where n is the number of reference lines and k is the number of lines included in the barcode.

! = 1 ! − !

For example, using five single-bands as barcodes allows the analysis of one of five genes, yet the use of the single-line barcodes as a source for two-strand barcode patterns, three-strand barcodes patterns, four-band barcode patterns, and five-band barcode patterns allow the generation of patterns of additional ten, ten, five and one patterns, respectively, and to a total number of barcodes for the identification of one out of 31 genes (provided that the electrophoretic separation will reveal appropriate resolution to identify and distinguish all of the barcode patterns). To exemplify this advantage, and as a proof of concept, we selected the identification of one out of six genes by a two barcode pattern composed of four single bands. The collection of six genes from which any one of the genes should be detected includes the TP53 gene, Werner Syndrome gene, Tay-Sachs mutant gene, BRCA1 gene, Tay-Sachs normal gene, Cystic fibrosis disorder gene. Clearly, the six genes cannot be analyzed by a four single-band barcodes. Nonetheless, the possible two-band barcode patterns composed of the four single band barcodes, Figure 7(A), can be used to analyze any one of the six genes, as predicted by the Pascal pyramid (see Figure 6 circle number of possibilities). Accordingly, a set of 12 template scaffolds, T1bT1c (for TP53 gene), T2aT2b (for BRCA1 gene), T4aT4b (for Werner Syndrom gene), T5aT5b (for Tay-Sachs mutant gene), T6aT6b (for normal Tay-Sachs gene), T7aT7b (for Cystic Fibrosis gene), were used as the sensing mixture. The mixture was subjected to every single analyte gene, and the subsequent activation of the replication/nicking machineries that yield the displaced strands that provide the two-strand barcodes for identifying the different analytes. Figure 7(B) shows the four single-strand



reference barcodes (right) that provide the strands to assemble the two-band barcodes for the sensing of the six analytes. Figure 7(B) shows the electrophoretic patterns corresponding to the analysis of the Cystic fibrosis genetic disorder gene (lane 1), the normal Tay-Sachs gene (lane 2), the BRCA1 gene (lane 3), the Tay-Sachs mutant gene (lane 4), the Werner Syndrome gene (lane 5) and the TP53 (lane 6). Evidently, each of the genes can be clearly detected by the respective two-baned barcode, thus revealing that the combination of singleband barcodes enhances the diversity of sensing capabilities. An important aspect that needs to be addressed upon developing the barcode-patterned analysis of genes rests on the selectivity of this analytical platform. Accordingly, we compared the barcode-patterned analysis of the BRCA1 gene to the respective mismatch gene using the templates T2a and T2b as scaffolds of the replication/nicking machineries that yield the respective two-band barcode pattern, Figure 8. One may realize that the mismatch gene does not yield any visible barcode pattern. That is the templates T2a and T2b form fully complementary recognition complexes only with the BRCA1 gene, and these results in the selective operation of the replication/nicking machineries by the mutants. In view of the different examples, the advantages and disadvantages of the detection platform involving replication/nicking machineries that yield barcode patterns as readout signals should be addressed. Specifically, the potential analytical applications of the barcode approach should be discussed: (i) The diversity of genes that can be analyzed by a single programmed mixture of template DNA machineries is certainly a major advantage of the method. (ii) The fact that the detection mixture includes many single-strands acting as template scaffolds for the DNA machineries is a disadvantage since it requires careful design of the strand to eliminate cross-interaction that could perturb the sensing platform. Nonetheless, the fact that the template mixtures are not labeled turns the sensing system to be inexpensive. The fact that the template DNA machineries provide an amplification path for


Page 12 of 29

Page 13 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the sensing events is certainly a further advantage. (iii) The long time-interval that is needed to operate the detection system involving the replication/nicking process followed by the electrophoretic operation of the respective barcode patterns is certainly a disadvantage. Nonetheless the high diversity to detect in one shot experiment a single gene within this timeinterval is certainly an advantage, and could find many practical applications for high throughput analysis of targets. We note that although a relatively long time-interval (ca. six hours) is required for the barcode-patterned analysis of a specific gene (in a possible mixture of genes), the analytical platform reveals important advantages over conventional applications of fluorophore/quencher-functionalized hairpins on plate-reader assays, that use mixtures of fluorophore/quencher hairpins for multiplexed analysis. The use of fluorophore/quencher hairpins mixtures for multiplex analysis is limited by the overlap fluorescence features of the labels, and certainly suffers from cost effectiveness. The parallel use of plate-reader assays would require a large volumes of the sample for analysis, a problem that is resolved by the present method. (iv) Although the sensitivity of the sensing platforms is moderate, the primary PCR amplification of the analyte mixture could overcome this limitation. Realizing the advantages/disadvantages of the barcodes detection scheme, we suggest that appropriately designed template DNA machineries provide effective detection platforms for the analysis of specific mutants for genetic disorders, identification of mutants for a specific cancer cells or the detection of genes associated with different cancer cells. In addition, different microRNAs acting as biomarkers for different diseases could be accomplished by the templated barcode patterning method. As discussed, the major disadvantage of the present analytical method is the duration required to operate the sensing platform, ca. seven hours (one hour the replication/nicking machinery followed by six hours electrophoretic separation of the barcode-band pattern). Accordingly, attempts were made to shorten the time interval for the analytical protocol.



Evidently, increasing the contents of polymerase/nicking enzyme could enhance the contents of barcode bands products and then shorten the time-interval for operating the polymerization/nicking machinery on the expense of the cost of the added enzymes. The major time-interval to complete the analytical platform required, however, the application of a low-voltage electrophoretic step (300 Volts) to yield the separated barcode bands (six hours). To shorten the time-interval of the electrophoretic step, we examined the possibility to increase the voltage applied to the electrophoretic step (400 Volts). Figure S2 shows the parallel analysis of seven different genes by their respective electrophoretically-separated barcode patterns using an applied potential of 400 Volts. Evidently, all seven genes can clearly identified by the respective barcode patterns after a separation time-interval that corresponds to three and half hour. Note, however that the faster separation of the bands slightly smeared the separated bands. We believe, however, that further optimization of the electrophoretic separation conditions could further decrease the duration of the analytical process. In addition, realizing that PCR is a label-free gene detection method, a fair comparison between the presented DNA machinery barcode-detection scheme of genes and the PCR method should be made. Beyond the need for dedicated instrumentation for PCR analyses, the time durations for the analysis of the genes needs to be compared. While the average time-interval for the PCR analysis of a single gene is estimated to be 2 to 3 hours, our barcode method is capable to analyze the presence of one gene among six possible genes within a time-interval of four to six hours. Clearly, the full analysis of one of six genes by the PCR method would require a substantially longer analysis time-interval, or alternatively, the parallel operation of several PCR machineries. Besides the application of functional template DNA machineries for the barcoded identification of genes (or nucleic acids), one may expand the method to develop analytical


Page 14 of 29

Page 15 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


platforms for the detection of aptamer-ligand complexes, and particularly the sensing of proteins by appropriate aptamers. This has been exemplified with the detection of thrombin and VEGF by barcode patterns. Figure 9(A) exemplifies the analytical platform for the detection of VEGF using the replication/nicking machinery and a two-strand barcode as readout pattern. Two template scaffolds, P1 and P2 provide the functional units for the generation of the two-strand barcode. Each of these templates includes the domain m that is the anti-VEGF sequence. The aptamer is linked at its 3’-end and the 5’-end to the sequences n’ and n that exhibit base complementarity. The sequence n is further elongated with the sequence l that upon its replication yields the nicking site. Finally, the domain l in P1 is elongated with the sequence k1 and in P2 is elongated with the sequence k2, and the strand displacement k1’ and k2’ after operation of the replication/nicking machinery, yields the twoband barcode pattern. In the presence of VEGF, the formation of the aptamer-VEGF complex is co-stabilized by the formation of the duplex n’/n on the template. In the presence of dNTPs/polymerase and the nicking enzyme Nt.BbvCI, and realizing that the duplex n’/n provides a polymerase initiation site, the polymerase-induced replication of the templates is activated. The replication of the domain l in the templates yields the nicking sites on the two scaffolds. Nicking of these sites initiates the cyclic polymerization machinery that results in the release of the strands k1’ and k2’ that act as the two-strand barcode pattern for the electrophoretic detection of VEGF. Using the similar concept, a mixture of three templates P3, P4 and P5 was designed to detect the thrombin using the replication/nicking machinery and a three-band barcode pattern for the detection of the analyte, Figure S2. Accordingly, a mixture of the templates was subjected to one of the two analytes, thrombin or VEGF, and the replication/nicking machineries using dNTPs/polymerase and the nicking enzyme Nt.BbvCI was activated on the respective templates. The resulting strands k1’/k2’ or k3’/k4’/k5’ (see Figure S2) were then electrophoretically separated and these acted as the two-



strand or three-strand barcode patterns for the detection of thrombin or VEGF, respectively. Figure 9(B) shows the electrophoretic barcode patterns generated by the templates and the polymerase/nicking machinery, upon analyzing VEGF or thrombin, respectively (lane 1 and lane 2). The reference lane (right) depicts the separation of the strands k1’ to k5’ that can be generated by the templates P1 to P5 and the replication/nicking machinery upon sensing the thrombin or VEGF. (Note that the template P2 and P5 yield the common readout band k3’ to highlight that a common strand can be used to generate different barcode patterns for analyzing the two analytes). Lane 1 shows the characteristic pattern of the two-strand barcode that corresponds to the detection of VEGF. Lane 2 shows the three-band barcode pattern that detects thrombin. Clearly, the template machineries and the barcode patterns allow the distinct analysis of any one of the proteins. In addition, the intensities of the images of the barcode patterns are controlled by the concentration of the protein analyte. Figure 9(C) shows the barcode bands generated by the polymerization/nicking machineries (operating for a timeinterval of 6 h), upon sensing different concentration of the VEGF analyte. Evidently, the VEGF can be analyzed a sensitivity that corresponds to 1 nM. It should be noted that the sensitivity of the detection system might be improved by extending time-interval for the polymerization/nicking process.

Conclusions The study has introduced an analytical method to detect genes or aptamer-ligand complexes by DNA machineries that generate nucleic acid barcode patterns as reporting images for the analyte. The approach involves the design of a mixture of “scaffold machineries” that allows the detection of one gene (or an aptamer ligand), out of many other possible analytes, in one-shot analytical process that utilizes the complexity of possible barcode patterns. The possibility to generate single-band, double-band, triple-band or more barcode patterns by the DNA machinery scaffolds introduces a method to detect an individual


Page 16 of 29

Page 17 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


analayte out of complex mixtures of many analytes. The DNA scaffold machineries provide an amplification path, for analyzing the different targets. The parallel operation of the “scaffold machinery” mixture to analyze many individual analytes in samples, and the possibility to image the resulting barcode pattern in a single electrophoretic separation represents the effectiveness of this approach. AUTHOR INFORMATION Corresponding Author *E-mail: [email protected] Author Contributions ‡

These authors contributed equally.

Notes The authors declare no competing financial interest. Supporting Information. Details corresponding to the materials used in the study, and the sequences corresponding to the reference barcode strands, are provided. Also, the electrophoretic barcode image corresponding to the analysis of different concentrations of the TP53 gene, and the scheme for the barcode-patterned detection of thrombin are provided. This material is available free of charge via the Internet at http://pubs.acs.org.

References (1) Liu, S.; Wang, Y.; Ming, J.; Lin, Y.; Cheng, C.; Li, F. Biosens. Bioelectron. 2013, 49, 472-477. (2) Jou, A. F. J.; Lu, C. H.; Ou, Y. C.; Wang, S. S.; Hsu, S. L.; Willner, I.; Ho, J. A. A. Chemical Science 2015, 6, 659-665. (3) Liu, J.; Lu, Y. Angew. Chem. 2006, 118, 96-100. (4) Liu, J.; Lu, Y. Anal. Chem. 2004, 76, 1627-1632. (5) Yang, Y.; Zhao, L. Trends Anal. Chem. 2010, 29, 980-1003. (6) Willner, I.; Zayats, M. Angew. Chem. Int. Ed. 2007, 46, 6408-6418. (7) Medintz, I. L.; Uyeda, H. T.; Goldman, E. R.; Mattoussi, H. Nat. Mater. 2005, 4, 435446. (8) Gill, R.; Zayats, M.; Willner, I. Angew. Chem. Int. Ed. 2008, 47, 7602-7625. (9) Ho, H. A.; Leclerc, M. J. Am. Chem. Soc. 2004, 126, 1384-1387.



(10) Ronkainen, N. J.; Halsall, H. B.; Heineman, W. R. Chem. Soc. Rev. 2010, 39, 17471763. (11) Hocek, M.; Fojta, M. Chem. Soc. Rev. 2011, 40, 5802-5814. (12) Drummond, T. G.; Hill, M. G.; Barton, J. K. Nat. Biotechnol. 2003, 21, 1192-1199. (13) Li, D.; Yan, Y.; Wieckowska, A.; Willner, I. Chem. Commun. 2007, 3544-3546. (14) Lai, R. Y.; Plaxco, K. W.; Heeger, A. J. Anal. Chem. 2007, 79, 229-233. (15) Pavlov, V.; Xiao, Y.; Shlyahovsky, B.; Willner, I. J. Am. Chem. Soc. 2004, 126, 1176811769. (16) Matsuno, H.; Niikura, K.; Okahata, Y. Chem. Eur. J. 2001, 7, 3305-3312. (17) Prakrankamanant, P.; Leelayuwat, C.; Promptmas, C.; Limpaiboon, T.; Wanram, S.; Prasongdee, P.; Pientong, C.; Daduang, J.; Jearanaikoon, P. Biosens. Bioelectron. 2013, 40, 252-257. (18) Fritz, J.; Baller, M. K.; Lang, H. P.; Rothuizen, H.; Vettiger, P.; Meyer, E.; Güntherodt, H. J.; Gerber, C.; Gimzewski, J. K. Science 2000, 288, 316-318. (19) Ho, D.; Falter, K.; Severin, P.; Gaub, H. E. Anal. Chem. 2009, 81, 3159-3164. (20) Sharon, E.; Freeman, R.; Riskin, M.; Gil, N.; Tzfati, Y.; Willner, I. Anal. Chem. 2010, 82, 8390-8397. (21) Caruana, D. J.; Heller, A. J. Am. Chem. Soc. 1999, 121, 769-774. (22) Patolsky, F.; Lichtenstein, A.; Willner, I. Nat. Biotechnol. 2001, 19, 253-257. (23) Li, D.; Shlyahovsky, B.; Elbaz, J.; Willner, I. J. Am. Chem. Soc. 2007, 129, 5804-5805. (24) Polsky, R.; Gill, R.; Kaganovsky, L.; Willner, I. Anal. Chem. 2006, 78, 2268-2271. (25) Hsieh, K.; Xiao, Y.; Tom Soh, H. Langmuir 2010, 26, 10392-10396. (26) Zuo, X.; Xia, F.; Xiao, Y.; Plaxco, K. W. J. Am. Chem. Soc. 2010, 132, 1816-1818. (27) Zhang, M.; Guan, Y. M.; Ye, B. C. Chem. Commun. 2011, 47, 3478. (28) Freeman, R.; Liu, X.; Willner, I. Nano Lett. 2011, 11, 4456-4461. (29) Liu, X.; Freeman, R.; Golub, E.; Willner, I. ACS Nano 2011, 5, 7648-7655. (30) Freeman, R.; Liu, X.; Willner, I. J. Am. Chem. Soc. 2011, 133, 11597-11604. (31) Zhang, C.; Hu, J. Anal. Chem. 2010, 82, 1921-1927. (32) Algar, W. R.; Krull, U. J. Anal. Chem. 2009, 81, 4113-4120. (33) Enkin, N.; Wang, F.; Sharon, E.; Albada, H. B.; Willner, I. ACS Nano 2014, 8, 1166611673. (34) Liu, X.; Aizen, R.; Freeman, R.; Yehezkeli, O.; Willner, I. ACS Nano 2012, 6, 35533563. (35) Liu, X.; Wang, F.; Aizen, R.; Yehezkeli, O.; Willner, I. J. Am. Chem. Soc. 2013, 135, 11832-11839. (36) Kim, J.; Biondi, M. J.; Feld, J. J.; Chan, W. C. W. ACS Nano 2016, 10, 4742-4753. (37) Ming, K.; Kim, J.; Biondi, M. J.; Syed, A.; Chen, K.; Lam, A.; Ostrowski, M.; Rebbapragada, A.; Feld, J. J.; Chan, W. C. W. ACS Nano 2015, 9, 3060-3074. (38) Liong, M.; Hoang, A. N.; Chung, J.; Gural, N.; Ford, C. B.; Min, C.; Shah, R. R.; Ahmad, R.; Fernandez-Suarez, M.; Fortune, S. M.; Toner, M.; Lee, H.; Weissleder, R. Nat. Commun. 2013, 4, 1752. (39) Nicewarner, P., S. R.; Freeman, R. G.; Reiss, B. D.; He, L.; Pena, D. J.; Walton, I. D.; Cromer, R.; Keating, C. D.; Natan, M. J. Science 2001, 294, 137-141. (40) Wang, F.; Lu, C.-H.; Willner, I. Chem. Rev. 2014, 114, 2881-2941. (41) Cheglakov, Z.; Weizmann, Y.; Basnar, B.; Willner, I. Org. Biomol. Chem. 2007, 5, 223225. (42) Tian, Y.; He, Y.; Mao, C. ChemBioChem 2006, 7, 1862-1864. (43) Weizmann, Y.; Beissenhirtz, M. K.; Cheglakov, Z.; Nowarski, R.; Kotler, M.; Willner, I. Angew. Chem. 2006, 118, 7544-7548.


Page 18 of 29

Page 19 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(44) Shlyahovsky, B.; Li, D.; Weizmann, Y.; Nowarski, R.; Kotler, M.; Willner, I. J. Am. Chem. Soc. 2007, 129, 3814-3815. (45) Wang, F.; Elbaz, J.; Willner, I. J. Am. Chem. Soc. 2012, 134, 5504-5507. (46) Wang, F.; Freage, L.; Orbach, R.; Willner, I. Anal. Chem. 2013, 85, 8196-8203. (47) Shimron, S.; Wang, F.; Orbach, R.; Willner, I. Anal. Chem. 2011, 84, 1042-1048.



Figure 1. Schematic presentation of the analysis of a gene by a two-strand barcode generated by a polymerization/nicking machinery.


Page 20 of 29

Page 21 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(A)

(B)

Figure 2. (A) A scheme displays in the electrophoretic imaging of an analyte gene by a single-strand barcode generated by the polymerization/nicking machinery. (B) Image of the stained, electrophoretically-separated, barcodes corresponding to the analysis of three genes. Right side – the reference ladder of six possible barcode bands used in the present study. Lane 1 – imaging of the BRCA1 gene; Lane 2 – imaging of the Smallpox gene; Lane 3 – imaging of the TP53 gene.



Page 22 of 29

(B)

(A)

Figure 3. (A) Schematic electrophoretic analysis and imaging of an analyte gene (TP53) using a two-strand barcode generated by the polymerization/nicking machinery. (B) Image of the stained, electrophoretically-separated, two-strand barcodes corresponding to the analysis of three different genes. Right side – the reference lane of the separated six bands corresponding to the two-strand barcode imaging of three analytes by the scaffold mixture T1a T1b, T2a T2b, T3bT3c. Lane 1 – analysis of the TP53 gene; Lane 2 – analysis of the BRCA1 gene; Lane 3 – analysis of the Smallpox gene.


Page 23 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(A)

(B)

Figure 4. (A) Schematic electrophoretic analysis and imaging of an analyte gene (TP53), using a three-strand barcode generated by the polymerization/nicking machinery. (B) Image of the stained, electrophoretically-separated, three-band barcodes corresponding to the analysis of three different genes. Right – reference lane corresponding to the six different strands comprising the three possible barcodes that analyze the three genes by the scaffold mixture T1a T1b T1c, T2a T2b T2c, T3a T3b T3c. Lane 1 – analysis of TP53 gene; Lane 2 – analysis of BRCA1 gene; Lane 3 – analysis of Smallpox gene.



Figure 5. Electrophoretic image corresponding to analysis of different concentrations of the TP53 gene according to Figure 3(A). The concentration of the analyte gene corresponds to: Lane 1 – 0 mM; Lane 2 – 1 nM; Lane 3 – 10 nM; Lane 4 – 100 nM; Lane 5 – 1.0 µM. In all experiments the polymerizing/nicking machinery was allowed to operate for a time-interval of 6 hours. The concentrations of the sensing mixture: T1a T1b, 100 nM each; dNTPs, 0.5 mM; polymerase, 0.2 U/µL and nicking enzyme, 0.2 U/µl.


Page 24 of 29

Page 25 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Pascal triangle corresponding to the number of detectable analyte as a function of a system that includes n reference line and k barcode line, assuming that the different possible barcodes are electrophoretically resolvable.



(A)

(B)

Figure 7. (A) Schematic possible barcodes that can image six genes by a four-strand reference mixture that yields six different two-strand barcode patterns. (B) Image of the stained electrophoretically-separated analysis of six genes using two-band barcode patterns: Right – the reference lane consisting of the four separated strands that comprise the two-band barcodes. Lane 1 – detection of Cystic fibrosis gene, Lane 2 – detection of the normal TaySachs gene, Lane 3 – detection of the BRCA1 gene, Lane 4 – detection of Tay-Sachs mutant gene, Lane 5 – detection of the Werner Syndrome gene, Lane 6 – detection of the TP53 gene. For analyzing the different genes, a mixture of twelve scaffolds, each 1 µM, is subjected to one of the genes and the respective two-band identifying barcodes are generated according to the machinery displayed in Figure 3(A) in the presence of dNTPs, 0.5 mM, polymerase 0.2 U/µL and nicking enzyme 0.2 U/µL.


Page 26 of 29

Page 27 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8. Selective electrophoretic barcode-patterned analysis of the BRCA1 gene vs. the mismatch gene. Right – reference band for possible barcodes. Lane 1 – barcode bands generated upon analyzing the BRCA1 gene, 1 µM, by the T2a and T2b templates and the polymerization/nicking machinery. Lane 2 – analysis of mismatch gene by the T2a and T2b templates and the polymerization/nicking machinery



(A)

(B)

(C)

Figure 9. (A) Schematic electrophoretic analysis of a protein (e.g., VEGF) generated by the polymerization/nicking machinery triggered by the formation of the aptamer-protein complex. (B) Image of the stained electrophoretically-separated, barcode patterns upon analyzing VEGF (using a two-strand barcode) or thrombin (using a three-band barcode). Right – reference lane corresponding to all separated single strand that comprise the barcodes. Lane 1 – two-strand barcode corresponding to the analysis of VEGF, Lane 2 – three-band barcode pattern corresponding to the analysis of thrombin. In these experiments, the scaffold mixture, each 1.0 µM, is subjected to one of the proteins, 1.0 µM, in the presence of dNTPs, 0.5 mM, polymerase 0.2 U/µL and nicking enzyme 0.2 U/µL, operation time of the sensing machinery 1 hour. (C) Electrophoretic image corresponding to the analysis of different concentrations of VEGF, using the sensing machinery displayed in (A). Right - reference bands, Lane 1 – 0 mM; Lane 2 – 1 nM; Lane 3 – 10 nM; Lane 4 – 100 nM; Lane 5 – 1 µM.


Page 28 of 29

Page 29 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC


Application of DNA Machineries for the Barcode Patterned Detection

Recommend Documents