Bazedoxifene-Scaffold-Based Mimetics of Solomonsterols A and B as

Subscriber access provided by SCD Université de Rennes1 | SCD de l'Université de Rennes 1

Article

Bazedoxifene scaffold-based mimetics of solomonsterols A and B as novel pregnane X receptor antagonists Žiga Hodnik, Lucija Peterlin Maši#, Tihomir Tomaši#, Domen Smodiš, Claudio D'Amore, Stefano Fiorucci, and Danijel Kikelj J. Med. Chem., Just Accepted Manuscript • DOI: 10.1021/jm500351m • Publication Date (Web): 14 May 2014 Downloaded from http://pubs.acs.org on May 18, 2014

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Medicinal Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

85x33mm (300 x 300 DPI)

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 51

Bazedoxifene scaffold-based mimetics of solomonsterols A and B as novel pregnane X receptor antagonists Žiga Hodnik,1 Lucija Peterlin Mašič,1 Tihomir Tomašić,1 Domen Smodiš,1 Claudio D’Amore,2 Stefano Fiorucci2, ⊥ and Danijel Kikelj*,1,⊥ 1

University of Ljubljana, Faculty of Pharmacy, Aškerčeva 7, 1000 Ljubljana, Slovenia

2

University of Perugia, Dipartimento di Medicina Clinica e Sperimentale, Nuova Facultàdi

Medicina e Chirurgia, S. Andrea delle Fratte, 06132 Perugia, Italy

KEYWORDS antagonist, bazedoxifene, mimetic, pregnane X receptor, solomonsterol A, solomonsterol B

1 ACS Paragon Plus Environment

Page 3 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ABSTRACT Pregnane X receptor (PXR), a member of the NR1I nuclear receptor family, acts as a xenobiotic sensor and a paramount transcriptional regulator of drug metabolising enzymes and transporters. The overexpression of PXR in various cancer cells indicates the importance of PXR as a drug target for countering multidrug resistance in anticancer treatments. We describe the discovery of novel, bazedoxifene scaffold-based PXR antagonists, inspired by the marine sulphated steroids, solomonsterols A and B, as natural leads. Luciferase reporter assay on a PXR transfected HepG2 cell line identified compounds 19-24 as promising PXR antagonists. Further structure-activity relationship study of the most active PXR antagonist from the series (compound 20, IC50 = 11 µM) revealed the importance of hydroxy groups as hydrogen bond donors for PXR antagonistic activity. PXR antagonists 20 and 24 (IC50 = 14 µM), in addition to the down-regulation of PXR expression, exhibited an inhibition of PXRinduced CYP3A4 expression, which illustrates their potential to suppress PXR-regulated phase I drug metabolism.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 51

INTRODUCTION Cancer, despite the extent of invested efforts, remains one of the leading fatal diseases worldwide. By the estimates of the International Agency for Research on Cancer, 14.1 million new cancer cases and 8.2 million cancer deaths were recorded in 2012.1 Furthermore, the multidrug resistance (MDR) of cancer cells contributes to the problematic 5% success rate of anticancer agents,2, 3 and the latest studies point to the pregnane X receptor (PXR) as one of the key players in the MDR of cancer cells.4-7 PXR, a member of the NR1I nuclear receptor family, is primarily found in the liver, small intestines and colon, but it is also present in brain, breast, prostate, bone marrow, ovary, placenta and immune cells.2 It functions as a xenobiotic sensor and as a paramount transcriptional regulator of drug metabolising enzymes (DMEs) and transporters.8, 9 Primarily targeted phase I DMEs include CYP2B6, CYP2C8, CYP2C9, CYP2C19 and CYP3A4, whereas phase II DMEs regulated by PXR comprise glutathione-S-transferase, acetyltransferase, methyltransferase, sulfotransferase and uridine 5’diphosphoglucuronosyltransferase.8 PXR also regulates the expression of phase III efflux ATP-binding cassette (ABC) drug transporters, such as P-glycoprotein (Pgp), breast cancer resistance protein (BCRP) and multiple resistance drug protein (MRP).9 Considering the impact of PXR on xenobiotic metabolism and transport, it constitutes a major factor involved in drug-drug interactions.10 The ability of PXR to initiate the metabolism and efflux of various molecules and its overexpression in breast,11 prostate,4 colon,6 ovarian,12 osteosarcoma13 and endometrial14 cancer cells, makes PXR a promising target for countering MDR in anticancer treatment.2 Hence, co-treatment of prostate cancer cell line PC-3 with PXR agonist SR12813 and anticancer agents paclitaxel or vinblastine resulted in elevated expression of MDR1 and


Page 5 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


decreased the efficiency of both chemotherapeutics.4 On the other hand, the PXR antagonist sulforaphane increased the chemosensitivity of colorectal cancer cells to irinotecan, which points to the possible use of PXR antagonists to overcome MDR in cancer chemotherapy.6 The xenobiotic-sensing PXR ligand binding domain (LBD) is defined by a spherical and flexible binding pocket with a volume expanding from 1150 to more than 1600 Å3, which binds hydrophobic molecules with the ability to form hydrogen bonds.15 Ligand binding to PXR is followed by conformational changes of the LBD-located ligand-dependent activation function 2 (AF-2) and results in dissociation of corepressor proteins. This is followed by the binding of transcriptional coactivators, which finalises the assembly of proteins that bind to the promoter regions of its target genes as a heterodimer with retinoid X receptor and initiates the transcription.16 On the contrary, PXR antagonists disrupt the binding of coactivators to the AF-2 region of the LBD and therefore suppress the transcription of the PXR target genes.16-18 Ecteinascidin-743 (ET-743), which suppresses SR12813- and paclitaxel-induced PXR activation,19 stands out as the first reported PXR antagonist. The list of currently known PXR antagonists (Figure 1) includes HIV protease inhibitor A79261120 and a biguanide antidiabetic agent metformin,21 both of which act as inhibitors of PXR mediated CYP3A4 expression. Isothiocyanate sulforaphane inhibits PXR by disrupting the binding of the coactivator to the AF-2 region of LBD, which also results in PXR-controlled suppression of CYP3A4 transcription.22 Cytotoxic quinoline alkaloid camptothecin acts as a PXR antagonist by inhibiting the formation of the PXR complex with the steroid receptor coactivator 1, while SPB3255 stands out as the most potent PXR antagonist so far, with IC50 value of 850 nM in PXR-transfected HepG2 cells.16 Undesirable properties of known PXR antagonists, such as toxicity,23, 24 chemical instability25 or activities other than inhibition of PXR mediated transcription of genes,2 are reasons for designing novel and improved PXR antagonists, which is not an easy task due to the promiscuous behaviour of PXR.26 Hence, in contrast to PXR 4 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 51

agonists, the structure-based design of novel PXR antagonists has not been successful so far.16, 27 Furthermore, recent studies suggest that in addition to the binding pocket, the AF-2 helix could serve as a surface for binding the PXR antagonists ketoconazole17 and coumestrol.25 The design and discovery of PXR antagonists therefore presents a challenging task with the demanding combination of fitting a large and flexible binding pocket and/or binding to a presently unknown part of the AF-2 helix surface.

Figure 1. Structures of currently known PXR antagonists. We report here the discovery of novel PXR antagonists 20 and 24 resulting from our ligandbased approach towards the design of PXR modulators using marine sulphated steroids solomonsterols A and B28 as model compounds. Solomonsterols A and B were isolated from a marine sponge, Theonella swinhoei, and were shown to act as PXR agonists in a transactivation experiment on a HepG2 cell line with potency similar to the effective PXR agonist rifaximin.28-30 Furthermore, solomonsterol A successfully protected PXR-humanised mice against the development of clinical signs and symptoms of colitis, apparently by reducing the generation of TNFα, a paramount cytokine responsible for the development of this disease.31


Page 7 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Our strategy to obtain novel PXR modulators from solomonsterols A and B was to replace their steroid core with a synthetically more easily accessible steroidomimetic scaffold of bazedoxifene, a selective oestrogen receptor modulator,32 and to evaluate the effect of sulphated, as well as non-sulphated, bazedoxifene-based solomonsterols analogues as potential PXR modulators because, to our knowledge, no studies involving non-sulphated solomonsterol analogues as PXR modulators were available. Therefore, we have evaluated (i) the impact of sulphate esters formation, (ii) the effect of the number of hydroxy/sulphate ester groups attached to the scaffold and (iii) the length of the alkyl linker at position 5 of the indole moiety on the modulation of PXR (Figure 2).Contrary to our expectations, the compounds resulting from this study did not display any PXR agonistic activity, but some bazedoxifene scaffold-based solomonsterol analogues, unexpectedly, turned out to be low micromolar PXR antagonists. OSO3Na n H

NaO3SO H NaO3SO

H

solomonsterol A (n = 3) solomonsterol B (n = 2)

H

steroidomimetic design

HN

R

O n

HN O R

O

bazedoxifene scaffold based analogues (series I)

R = H or SO3-Na+ n = 0, 2 or 3

R R

O

O n

O R

O

bazedoxifene scaffold based analogues (series II)

Figure 2. Design of the bazedoxifene scaffold based PXR modulators by a steroidomimetic approach using solomonsterols A and B as the model compounds.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 51

RESULTS AND DISCUSSION Design. The design of the bazedoxifene scaffold based solomonsterol analogues was supported by studying their three-dimensional similarity to solomonsterols A and B using the ROCS (OpenEye Scientific Software, Inc)33 method of molecular shape and atom type comparison. The results of the ROCS overlay show that our designed analogues 27a and 29 can adopt similar conformations with sulphate groups overlapping well with those of solomonsterol B and solomonsterol A (Figure 3).

Figure 3. Overlay of solomonsterol A (left) and solomonsterol B (right) represented by green sticks with the corresponding shape in grey and its pharmacophoric features coloured red for H-bond acceptors, blue for H-bond donors, green for rings and yellow for hydrophobic groups, with the designed bazedoxifene scaffold-based analogues 29 (in cyan; left) and 27a (in magenta; right), as obtained by ROCS (Openeye Scientific Software, Inc.).33


Page 9 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The design was further supported by molecular docking experiments to explore whether the designed solomonsterol analogues can form similar interactions with amino acid residues in the ligand-binding site of PXR to those of solomonsterols A and B. The docking of solomonsterol A to the PXR ligand-binding pocket had shown that the steroidal nucleus forms several hydrophobic interactions with the protein, whereas the sulphate groups were predicted to form ionic interaction with Lys210 (24-O-sulfate) and hydrogen bonds with Ser247 (3-Osulfate) and His407 (2-O-sulfate).28 Our docking experiments using GOLD34 were able to reproduce the binding pose of solomonsterol A28 in the PXR ligand-binding site and also predicted similar interaction patterns for solomonsterol A and its analogue 29 (Figure 4).

Figure 4. Overlay of the GOLD-calculated binding pose of solomonsterol A (cyan lines) and its bazedoxifene scaffold based analogue 29 (grey sticks) in the PXR ligand-binding site (green, PDB entry: 1M13). Ionic interaction and hydrogen bonds between the ligand and PXR residues (magenta) are presented as dashed black lines. Residues forming hydrophobic interactions are presented as green lines. The figure was prepared by PyMOL.35 Chemistry. Compounds 11 and 12 are the key intermediates in the synthesis of the envisaged bazedoxifene-based solomonsterol A and B mimetics because they enable selective introduction of various linkers at position 5 of the indole moiety (Schemes 1 and 2). According to the synthetic plan, orthogonality between the O-protecting groups of the 8 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 51

hydroxy propiophenones and of 4-aminophenol was required. This was achieved by benzyl protection of the hydroxy groups of the propiophenones (compounds 5 and 6) and by methoxymethyl ether (MOM) protecting group, cleavable by mild acidolysis, for the 4aminophenol hydroxy group (compound 4). Therefore, the synthesis of MOM-protected 4aminophenol 3 and its amine hydrochloride 4 was crucial and was completed by a straightforward synthetic procedure from phenol 1 (Scheme 1a). First, the benzyloxycarbonylprotected 4-aminophenol 136 was treated with bromomethyl methyl ether, using sodium hydride as a base to yield totally protected 4-aminophenol 2. Then, the benzyloxycarbonyl protecting group was cleaved, using a standard catalytic hydrogenation procedure, to yield intermediate 3, which was transformed to the amine hydrochloride 4 using the acetyl chloride driven formation of hydrogen chloride in ethanol. Both intermediates 3 and 4 were later used in a two-step Bischler-Möhlau indole synthesis37 (Scheme 1b). To obtain key intermediates 11 and 12, the benzyl-protected 4-hydroxypropiophenones 538 and 639 were first α-brominated with bromine in glacial acetic acid to yield compounds 7 and 8. Unfortunately, in the next step, we were not able to complete the one-step Bischler-Möhlau indole synthesis from intermediates 3 and 7/8 at 120 °C and 150 ºC using DMF as a solvent. We assume that the failure was due to the instability of the MOM protecting group in acidic conditions, but we did not manage to isolate any compounds from the complex reaction mixture that would confirm our assumptions. Furthermore, the addition of triethylamine to the reaction mixture containing 3 and 7/8 resulted in the formation of small amounts of the intermediates 9 and 10, but cyclisation to 11 and 12 was again unsuccessful, which could be explained by the reaction mechanism37 that proposes amine hydrochloride catalysis. Consequently, our search for the optimal reaction conditions resulted in a two-step BischlerMöhlau indole synthesis, using free-amine intermediate 3 and triethylamine in ethanol in the first step to yield compounds 9 and 10. Finally, to complete the indole synthesis and to obtain 9 ACS Paragon Plus Environment

Page 11 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


key intermediates 11 and 12, in the second step, amine hydrochloride 4 was reacted with compounds 9/10 in ethanol in a sealed reactor, which resulted in a one-pot indole synthesis and MOM protecting group cleavage to give compounds 11 and 12 (Scheme 1b). The synthesis of the solomonsterol mimetics from intermediates 11 and 12 started with the introduction of a hydroxyalkyl chain (Scheme 2). With 3-bromo-1-propanol and potassium a

b

Scheme 1. Reagents and conditions: (a) bromomethyl methyl ether, NaH, DMF, 0 °C, 3 h; (b) H2, Pd/C, MeOH, rt, 1.5 h; (c) acetyl chloride, EtOH, 0 °C, 2.5 h; (d) Br2, CH3COOH, rt, 30 min; (e) 3, Et3N, EtOH, 80 °C, 16 h; (f) 4, EtOH, 115 °C, 14 h. carbonate intermediates 13 and 14 were obtained in excellent yields, whereas with 2bromoethanol, the reaction did not yield the desired product. Variations of solvents (acetone, DMF and acetonitrile), reaction temperature, base (cesium carbonate) as well as the catalysts (potassium iodide and 18-crown-6) eventually resulted in the decomposition of reactants 11 and 12. Therefore, to obtain two-carbon chain analogues, 2-bromoethyl acetate was used instead of 2-bromoethanol, which in a combination with cesium carbonate as a base in 10 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 51

acetone gave compounds 15 and 16 in moderate yields. The following ester hydrolysis yielded compounds 17 and 18. Finally, O-deprotection of intermediates 11-14, 17 and 18 using standard catalytic hydrogenation procedure yielded hydroxylated solomonsterol A and B analogues 19-24. The latter were then treated with chlorosulfonic acid in anhydrous pyridine with a following sodium hydroxide driven salt formation to give sulphate ester analogues 25-29 (Scheme 2). Due to unknown reasons, although using the same procedure, we have not been able to prepare the sulphate ester analogue 27a from compound 22.

Scheme 2. Reagents and conditions: (a) 3-bromo-1-propanol, K2CO3, acetone, 60 °C, 90 h; (b) 2-bromoethyl acetate, Cs2CO3, acetone, 60 °C, 20 h; (c) NaOH, dioxane/H2O, rt, 5 h; (d) H2, Pd/C, EtOH/THF, rt, 15 h; (e) chlorosulfonic acid, pyridine, rt, 24 h; then NaOH, pyridine, rt, 24 h. In an attempt to further explore the structure-activity relationship, O-methyl and N-alkyl derivatives of compound 20, the most active antagonist from the first series of solomonsterol 11 ACS Paragon Plus Environment

Page 13 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


analogues, were prepared (Figure 5, Scheme 3; compounds 34-38). The indole hydroxy group of intermediate 12 was O-benzylated to produce compound 30, which enabled the selective introduction of various substituents on the indole nitrogen to give compounds 31, 32 and 33 with N-methyl, -propyl and -benzyl substituents. They were O-deprotected using a standard catalytic hydrogenation procedure to give N-substituted analogues 34, 35 and 36. To determine the necessity of hydroxy groups as hydrogen bond donors for PXR antagonism, compound 20 was O-methylated with methyl iodide and cesium carbonate as a base to produce analogue 37. Finally, to explore the effect of the absence of hydrogen bond donors on PXR antagonism, analogue 38 was synthesised by the N-methylation of 37, using methyl iodide and sodium hydride as a base (Scheme 3).

Figure 5. Modification of compound 20, the most active PXR antagonist from the first series of solomonsterol analogues, for the SAR study demonstrating the importance of H-bond donors for PXR antagonistic activity.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 51

Scheme 3. Reagents and conditions: (a) benzyl bromide, K2CO3, acetone, 60 °C, 19 h; (b) for compound 31: methyl iodide, NaH, DMF, rt, 1.5 h; for compound 32: 1-bromopropane, NaH, DMF, rt, 1.5 h; for compound 33: benzyl bromide, NaH, DMF, rt, 1.5 h; (c) H2, Pd/C, EtOH/THF, rt, 15 h; (d) methyl iodide, Cs2CO3, acetone, 60 °C, 2.5 h; (e) methyl iodide, NaH, DMF, rt, 1 h. Biological evaluation. Because solomonsterols A and B have been shown to act as potent PXR agonists,28 our bazedoxifene scaffold-based solomonsterol A and B analogues 19-29 were first evaluated for PXR agonistic activity in a luciferase reporter assay in a human hepatocarcinoma cell line (HepG2), transiently transfected with pSG5-PXR, pSG5-RXR, pCMV-βgalactosidase and p(CYP3A4)-TK-Luc vectors (c.f. Experimental section). Despite their similar molecular shape with that of solomonsterols A and B (c.f. Figure 3), compounds 19-29, at a 10 µM concentration, did not exhibit any significant PXR activation compared to that of the positive controls solomonsterol A (10 µM) and rifaximin (10 µM), demonstrating that they are devoid of PXR agonistic activity (Figure 6a). The series of analogues 19-29 (50 µM) was further tested for PXR antagonism in a luciferase reporter assay on a PXR transfected HepG2 cell line in the presence of rifaximin (10 µM). The results shown in Figure 6b demonstrate that, whereas the sulphate esters 25-29 displayed no or only weak inhibition of rifaximin induced PXR transactivation, the hydroxy analogues 19-24 exhibited evident


Page 15 of 51

antagonistic effects, with compound 20 being the most active PXR antagonist among compounds described here. A 5.0×10 7

* 4.0×10 7

RLU/β gal

* 3.0×10 7

2.0×10 7

1.0×10 7

0 NT

R

SOL.A 19

20

21

22

23

24

25

26

27

28

29

37

B 3.0×10 7

* 2.5×10 7

*

2.0×10 7

RLU/β β gal

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1.5×10 7

#

# 1.0×10 7

#

#

#

# #

5.0×10 6

# 0 NT

R

19

20

21

22

23

24

25

26

27

28

29

37

R

Figure 6. The luciferase reporter assay performed in HepG2 cells transiently transfected with pSG5-PXR, pSG5-RXR, pCMV-βgal and p(cyp3a4)TKLUC vectors and stimulated for 18 h with (A) rifaximin (R), solomonsterol A (SOL-A), 20-29 and 37 (10 µM) or (B) with 10 µM rifaximin alone (R), or in combination with 20-29 and 37 (50 µM). * p < 0.05 vs. not treated (NT); # p < 0.05 vs. R.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 51

The sulphate esters 28 and 29 possess a three carbon atom linker and displayed a weak inhibition of rifaximin induced PXR transactivation compared to sulphate ester 27 with a two carbon linker and compounds 25 and 26 with sulphate ester groups bound directly to the bazedoxifene scaffold, which did not exhibit any PXR antagonistic activity. From the obtained results, a connection between the number of sulphate ester groups and the inhibition of rifaximin induced PXR transactivation was not evident. In general, the potential low cellular membrane permeability of sulphated solomonsterol analogues 25-29 could present the reason for no or weak PXR-modulatory activities. In the series of hydroxylated analogues 1924 possessing PXR antagonistic activity, preliminary SAR implied that, in the case of analogues with two hydroxy groups (compounds 19, 21 and 23), the presence and length of the linker at position 5 of the indole moiety does not impact the affinity towards PXR. These three analogues displayed similar antagonistic potencies that are, however, weaker compared to those of the corresponding analogues with three hydroxy groups (compounds 20, 22 and 24). Among the latter, compound 20 stands out as the most active PXR antagonist in the series. The antagonistic effect of the two most active PXR antagonists among compounds described here, 20 and 24, was quantified by concentration-response transactivation experiments performed on HepG2 cells. The concentration-response curves revealed the concentrationdependent effects of antagonists 20 and 24, with IC50 values of 11 µM and 14 µM, respectively (Figure 7). Since potency of compound 20 correlated with the potency of PXR antagonist coumestrol (IC50 = 12 µM),25 we evaluated the three-dimensional similarity of both compounds, using the ROCS method of molecular shape and atom type comparison (Figure 8). Results of overlay revealed better shape similarity (Tanimoto shape score = 0.81) than pharmacophoric feature similarity (Tanimoto colour score = 0.39) of coumestrol and


Page 17 of 51

antagonist 20. The best overlay can be observed between the phenol rings of both compounds, indicating the equal distance between hydroxy groups of coumestrol and compound 20. A

1.0×10 7

*

110 7.5×10 6

100

5.0×10

90

% Maximal Response

RLU/β β gal

#

6

# #

2.5×10 6

80 70

20 IC50: 11.39µM

60 50 40 30 20 10 0

0 NT

R

10

25

50

0

20 (µM)

B

10 -5

10 -4

[20], M

R

*

6×10 0 6

110

#

100

% Maximal Response

90 4×10 0 6

RLU/β gal

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


# # 2×10 0 6

80 70

24 IC50: 14 µM

60 50 40 30 20 10 0

0 NT

R

10

25

50

24 (µM)

0

R

10 - 5

10 - 4

[24], M

Figure 7. Concentration-response curves for compounds 20 (A) and 24 (B). HepG2 cells were transfected as described above and stimulated with rifaximin (R) alone or in combination with increasing concentration of 20 or 24 (10, 25 and 50 µM) to determine the IC50 value. * p < 0.05 vs. NT; # p < 0.05 vs. R. With an aim to study the impact of the indole N-substitution for the antagonistic effect of the most active compound 20 from the first series of solomonsterol analogues, compounds possessing methyl (34), propyl (35) or benzyl substituents (36) at position 1 of the indole core have also been biologically evaluated. The necessity of hydrogen bond donors for antagonistic



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 51

activity of the compound 20 was evaluated by testing the O-methylated analogues 37 and 38 (Figure 5, Scheme 3). A transactivation experiment in the presence of rifaximin on HepG2 cells indicated PXR antagonistic activity of analogues 34-38, but the morphological analysis revealed that at a dose of 50 µM, N-alkylated compounds 34, 35, 36 and 38 were cytotoxic. Cytotoxicity was not observed for antagonist 37, which exhibited weaker potency compared to its parent compound 20 (Figure 6b). This suggests the necessity of hydroxy groups as hydrogen bond donors for the low micromolar antagonistic effect of compound 20.

Figure 8. Overlay of coumestrol represented by green sticks with the corresponding shape in grey and its pharmacophoric features coloured red for H-bond acceptors, blue for H-bond donors, green for rings and yellow for hydrophobic groups, with the designed bazedoxifene scaffold-based analogue 20 (in orange), as obtained by ROCS (Openeye Scientific Software, Inc.).33 To further support the determined antagonistic activity of the most promising analogues from the series, 20 and 24, we have evaluated their effects on the rifaximin influenced expression of PXR and its master target gene CYP3A4 (Figure 9). The real-time PCR analysis, which was performed on cDNA isolated from HepG2 cells, displayed a significant down-regulation of PXR expression and a strong inhibition of CYP3A4 expression by both analogues. These results highlight compounds 20 and 24 as promising PXR antagonists with the capacity to suppress PXR-regulated phase I drug metabolism in vitro. To our knowledge, both


Page 19 of 51

compounds also represent a unique example of PXR antagonists that are capable of downregulating PXR expression. A

B

1.0

#

0.5

#

CYP3a4

3

relative expression

PXR

1.5

relative expression

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


* 2

1

#

# 0.0

0 NT

Rifaximin

20 24 Rifaximin

NT

Rifaximin

20

24 Rifaximin

Figure 9. Real-Time PCR analysis of PXR mRNA relative expression (A) and its target gene CYP3A4 mRNA relative expression (B) in HepG2 cells treated with rifaximin (10 µM) alone and in combination with 20 or 24 (50 µM). Values are normalised relatively to GAPDH mRNA and are expressed relative to those of non-treated cells (NT), which are arbitrarily set to 1. Data are the mean of two different experiments. * p < 0.05 vs. NT; # p < 0.05 vs. R. CONCLUSION In conclusion, our attempt to obtain novel PXR modulators by replacing a steroid core of natural leads solomonsterol A and solomonsterol B with a steroidomimetic bazedoxifene scaffold resulted in the discovery of novel PXR antagonists 19-24, among which compounds 20 and 24, with IC50 values of 11 µM and 14 µM, respectively, for the inhibition of rifaximin induced PXR transactivation, represent promising novel PXR antagonists. Although less potent than SPB3255,16 these compounds stand out as an important new structural class of PXR antagonists offering good opportunity for further optimization. The SAR study, as well as the overlay of compound 20 with previously described PXR antagonist coumestrol,25 pointed out the importance of hydroxy groups as hydrogen bond donors for the PXR antagonistic activity of compound 20. The suppression of PXR master target gene CYP3A4



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 51

highlights compounds 20 and 24 as PXR antagonists with the capacity to attenuate PXRregulated phase I drug metabolism in vitro. Finally, both compounds represent a unique example of PXR antagonists that are shown to down-regulate the expression of PXR.

EXPERIMENTAL SECTION General procedures. All reagents were used as received from commercial sources without further purification unless otherwise indicated. Analytical TLC was performed on Merck silica gel (60 F 254) plates (0.25 mm) and components visualized with staining reagents or ultraviolet light. Column chromatography was carried out on silica gel 60 (particle size 240400 mesh). Reversed-phase column chromatography was performed on Biotage Isolera One system, using Biotage SNAP KP-C18-HS cartridge. HPLC analyses were performed on Agilent Technologies 1100 instrument with G1365B UV-VIS detector, G1316A thermostat and G1313A autosampler using Agilent Eclipse Plus C18 column (5 µm, 4.6 × 150 mm). Three different methods were used for HPLC analyses: a) Method A: Agilent 5µ C18 column; mobile phase: 0.1% trifluoroacetic acid in water (A) and methanol (B); gradient: 90% A to 30% A in 20 min, then 5 min 30 % A; flow rate 1.0 mL/min; injection volume: 10 µL; b) Method B: Agilent 5µ C18 column; mobile phase: 0.1% trifluoroacetic acid in water (A) and methanol (B); gradient: 90% A to 30% A in 20 min, then 10 min 30 % A; flow rate 1.0 mL/min; injection volume: 10 µL; c) Method C: Agilent 5µ C18 column; mobile phase: 20 mM phosphate buffer (pH 7.0) (A) and methanol (B); gradient: 90% A to 30% A in 15 min, then 5 min 30 % A; flow rate 1.0 mL/min; injection volume: 10 µL. All tested compounds were ≥95% pure by HPLC. 1H NMR and 13C NMR spectra were recorded at 400 MHz and 101 MHz, respectively, on a Bruker AVANCE III spectrometer in DMSO-d6, CD3OD or CDCl3 solution with TMS as an internal standard at 25 °C. Spectra were assigned using 19 ACS Paragon Plus Environment

Page 21 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


gradient COSY, HSQC and DEPT experiments. IR spectra were recorded on a Thermo Nicolet Nexus 470 ESP FT-IR spectrometer. Mass spectra were obtained using a VGAnalytical Autospec Q mass spectrometer. All reported yields are yields of purified products. Benzyl (4-hydroxyphenyl)carbamate (1). To the solution of 4-aminophenol (4.37 g, 40.0 mmol) in a mixture of water (50 mL) and THF (50 mL) was added Na2CO3 (8.48 g, 80.0 mmol) and the mixture was cooled to 0 °C. Benzyl chloroformate (5.90 mL, 41.6 mmol) in THF (20 mL) was added dropwise during 1 h. The brown suspension was then stirred for 30 min at room temperature and the THF was removed in vacuo. Brown solution was diluted with water to 100 mL and extracted with ethyl acetate (1 x 100 mL), which was then washed with brine (2 x 80 mL) and dried over Na2SO4. The solvent was removed under reduced pressure and the crude product was recrystallized from ethyl acetate to yield 1 as an off-white crystals. Yield: 8.71 g (90%); IR (ATR) ν 3302, 1700, 1534, 1516, 1383, 1308, 1234, 1063, 827, 800, 746, 734 cm-1;1H NMR (400 MHz, DMSO-d6) δ 5.12 (s, 2H, CH2), 6.66-7.00 (m, 2H, 2 x Ar-H), 7.24 (d, 2H, J = 8.1 Hz, 2 x Ar-H), 7.31-7.47 (m, 5H, 5 x Ar-H), 9.12 (s, 1H, OH), 9.44 (br s, 1H, NH) ppm (lit.361H NMR (400 MHz, DMSO-d6) 5.11 (s, 2H), 6.66-6.68 (d, 2H), 7.22 (d, 2H), 7.35-7.49 (m, 5H), 9.11 (s, 2H), 9.43 (s, 2H) ppm); 13C NMR (101 MHz, DMSO-d6) δ 65.41, 115.12 (2C), 120.00 (2C), 127.92, 127.98 (2C), 128.39 (2C), 130.50, 136.83, 152.81, 153.51 ppm. HRMS m/z for C14H13NO3 ([M+H+]+): calcd 244.0974; found 244.0975. Benzyl (4-(methoxymethoxy)phenyl)carbamate (2). To a suspension of sodium hydride (695 mg, 27.5 mmol) in dry DMF (50 mL) at 0 °C was added benzyl (4-hydroxyphenyl)carbamate (1) (6.08 g, 25.0 mmol) under argon atmosphere. The mixture was stirred for 30 min at 0 °C and then for 30 min at room temperature, upon which the hydrogen gas evolvement had stopped. The reaction mixture was again cooled to 0 °C, bromomethyl methyl ether (2.50 mL, 20 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 51

27.5 mmol) was added and the mixture was stirred for 2 h at room temperature. The red solution was concentrated in vacuo and the residue was suspended in ethyl acetate (150 mL). Suspension was washed with 10% citric acid (4 x 80 mL), 1M NaOH(aq) (2 x 80 mL), brine (1 x 100 mL) and dried over Na2SO4. The solvent was removed under reduced pressure and the crude product was recrystallized from ethanol to yield 2 as white crystals. Yield: 4.20 g (59%); IR (ATR) ν 3328, 1700, 1542, 1509, 1413, 1228, 1150, 1064, 995, 844, 763, 741 cm1 1

; H NMR (400 MHz, CDCl3) δ 3.50 (s, 3H, CH3), 5.16 (s, 2H, CH2), 5.22 (s, 2H, O-CH2-O),

6.62 (br s, 1H, NH), 6.99-7.04 (m, 2H, 2 x Ar-H), 7.29-7.45 (m, 7H, 7 x Ar-H) ppm; 13C NMR (101 MHz, CDCl3) δ 55.96, 67.00, 94.82, 116.93 (2C), 120.47, 128.34 (2C), 128.36 (2C), 128.64 (2C), 131.99, 136.13, 153.56, 153.64 ppm. HRMS m/z for C16H17NO4 ([M+H+]+): calcd 288.1236; found 288.1228. 4-(Methoxymethoxy)aniline (3).Benzyl (4-(methoxymethoxy)phenyl)carbamate (2) (4.20 g, 14.6 mmol) was dissolved in methanol (200 mL), 10% Pd/C (630 mg) was added and the reaction mixture was stirred under hydrogen atmosphere for 3 h. The catalyst was filtered off and the solvent was removed under reduced pressure. Brown oil was purified by column chromatography with ethyl acetate/hexane (1:1) as an eluent to afford 3 as orange oil. Yield: 1.88 g (84%); IR (ATR) ν 3355, 2953, 1626, 1507, 1227, 1193, 1148, 1072, 989, 916, 825 cm-1; 1H NMR (400 MHz, CDCl3) δ 3.42-3.55 (m, 5H, CH3, NH2), 5.10 (s, 2H, CH2), 6.636.68 (m, 2H, 2 x Ar-H), 6.87-6.92 (m, 2H, 2 x Ar-H) ppm; 13C NMR (101 MHz, CDCl3) δ 55.83, 95.51, 116.23 (2C), 117.87 (2C), 141.21, 150.22 ppm. HRMS m/z for C8H11NO2 ([M+H+]+): calcd 154.0868; found 154.0871. 4-(Methoxymethoxy)benzenaminium chloride (4). Acetyl chloride (286 µl, 4.0 mmol) was added into the absolute ethanol (10 mL) under argon atmosphere. Reaction mixture was stirred for 1 h at room temperature. The colourless solution was then cooled to 0 °C and the solution of 4-(methoxymethoxy)aniline (3) (612 mg, 4.0 mmol) in absolute ethanol (15 mL) 21 ACS Paragon Plus Environment

Page 23 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was added dropwise during 15 min. Brown reaction mixture was then stirred at 0 °C for 75 min and the solvent was evaporated under reduced pressure to give 4 as brown solid. Yield: 745 mg (98%); IR (ATR) ν 2922, 2591, 1662, 1610, 1504, 1455, 1354, 1274, 1217, 1171, 1107, 826 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 3.37 (s, 3H, signal overlapped with H2O, CH3), 5.20 (s, 2H, CH2), 7.08-7.13 (m, 2H, 2 x Ar-H), 7.27-7.32 (m, 2H, 2 x Ar-H), 10.09 (br s, 3H, NH3+Cl-) ppm; 13C NMR (101 MHz, DMSO-d6) 55.60, 93.86, 117.00 (2C), 124.50 (2C), 125.15, 156.14 δ ppm. Synthesis of compounds 5 and 6. To the solution of 4’-hydroxypropiophenone (2.70 g, 18 mmol) or 3’,4’-dihydroxypropiophenone (2.99 g, 18 mmol) in acetone (50 mL) was added K2CO3 (4.98 g, 36.0 mmol) and the mixture was stirred for 30 min at room temperature. Benzyl bromide (19.8 mmol or 39.6 mmol) was added and the mixture was refluxed overnight. Solvent was removed in vacuo and the residue was suspended in diethyl ether (200 mL). The suspension was washed with water (1 x 100 mL), brine (1 x 100 mL) and dried over Na2SO4. Removal of the solvent under reduced pressure gave yellow crystals that were suspended in petroleum ether (50 mL) and filtered to yield compound 5 or 6. 1-(4-(Benzyloxy)phenyl)propan-1-one (5). Yield: 4.02 g (93%); white crystals; IR (ATR) ν 1677, 1597, 1509, 1386, 1257, 1224, 117, 1011, 950, 844, 798, 756, 700 cm-1; 1H NMR (400 MHz, CDCl3) δ 1.24 (t, 3H, J = 7.3 Hz, CH3), 2.98 (q, 2H, J = 7.3 Hz, CH2), 5.16 (s, 2H, ArCH2), 7.01-7.06 (m, 2H, 2 x Ar-H), 7.35-7.49 (m, 5H, 5 x Ar-H), 7.95-8.00 (m, 2H, 2 x Ar-H) ppm (lit.38 1H NMR (300 MHz, CDCl3) δ 1.24 (t, 3H, J = 7.3 Hz), 2.97 (q, 2H, J = 7.3 Hz), 5.15 (s, 2H), 7.03 (d, 2H, J = 8.9 Hz), 7.31-7.48 (m, 5H), 7.97 (d, 2H, J = 8.9 Hz) ppm); 13C NMR (101 MHz, CDCl3) δ 8.46, 31.45, 70.12, 114.54 (2C), 127.51 (2C), 128.26, 128.72 (2C), 130.23, 130.26 (2C), 136.24, 162.45, 199.52 ppm. HRMS m/z for C16H16O2 ([M+H+]+): calcd 241.1229; found 241.1233.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 51

1-(3,4-bis(Benzyloxy)phenyl)propan-1-one (6).Yield: 5.54 g (89%); white crystals; IR (ATR) ν 1675, 1594, 1580, 1515, 1453, 1424, 1266, 1178, 1146, 1022, 878, 786, 732 cm-1; 1H NMR (400 MHz, CDCl3) δ 1.21 (t, 3H, J = 7.3 Hz, CH3), 2.93 (q, 2H, J = 7.3 Hz, CH2), 5.24 (s, 2H, Ar-CH2), 5.26 (s, 2H, Ar-CH2), 6.96 (d, 1H, J = 8.4 Hz, Ar-H), 7.31-7.52 (m, 10H, 10 x ArH), 7.57 (dd, 1H, J = 2.1, 8.4 Hz, Ar-H), 7.65 (d, 1H, J = 2.0 Hz, Ar-H) ppm (lit.39 1H NMR (CDCl3) δ 1.20 (t, 3H, J = 7 Hz), 2.92 (q, 2H, J = 7 Hz), 5.23 (s, 2H), 5.25 (s, 2H), 6.97 (d, 1H, J = 8 Hz), 7.42 (m, 12H) ppm); 13C NMR (101 MHz, CDCl3) δ 8.51, 31.34, 70.80, 71.14, 112.93, 113.69, 122.86, 127.11 (2C), 127.42 (2C), 127.97, 128.04, 128.57 (2C), 128.64 (2C), 130.43, 136.54, 136.85, 148.56, 152.94, 199.47 ppm. HRMS m/z for C23H22O3 ([M+H+]+): calcd 347.1647; found 347.1641. Synthesis of compounds 7 and 8. To the stirring solution of 1-(4-(benzyloxy)phenyl)propan-1one (5) (0.96 g, 4.0 mmol) or 1-(3,4-bis(benzyloxy)phenyl)propan-1-one (6) (1.38 g, 4.0 mmol) in glacial acetic acid (14 mL) was added bromine (640 mg, 4.0 mmol) in glacial acetic acid (14 mL) dropwise, during 30 min at room temperature. Concentration of the yellow solution under reduced pressure and recrystallization of the crude product from the mixture of diethyl ether and hexane yielded compound 7 or 8. 1-(4-(Benzyloxy)phenyl)-2-bromopropan-1-one (7). Yield: 1.05 g (82%); white crystals; IR (ATR) ν 1664, 1599, 1566, 1506, 1335, 1238, 1180, 986, 922, 849, 751, 729 cm-1; 1H NMR (400 MHz, CDCl3) δ 1.92 (d, 3H, J = 6.6 Hz, CH3), 5.17 (s, 2H, CH2), 5.28 (q, 1H, J = 6.6 Hz, CH), 7.03-7.08 (m, 2H, 2 x Ar-H), 7.35-7.48 (m, 5H, 5 x Ar-H), 8.01-8.06 (m, 2H, 2 x Ar-H) ppm; (lit.38 1H NMR (300 MHz, CDCl3) δ 1.91 (d, 3H, J = 6.6 Hz), 5.17 (s, 2H), 5.27 (q, 1H, J = 6.6 Hz), 7.05 (d, 2H, J = 9.0 Hz), 7.31-7.50 (m, 5H), 8.03 (d, 2H, J = 9.0 Hz) ppm);13C NMR (101 MHz, CDCl3) δ 20.26, 41.45, 70.24, 114.81 (2C), 127.03, 127.53 (2C), 128.35, 128.76 (2C), 131.36 (2C), 136.02, 163.10, 192.00 ppm. HRMS m/z for C16H15BrO2 ([M+H+]+): calcd 319.0334; found 319.0336. 23 ACS Paragon Plus Environment

Page 25 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1-(3,4-Bis(benzyloxy)phenyl)-2-bromopropan-1-one (8). Yield: 1.21 g (71%); white crystals; IR (ATR) ν 1672, 1579, 1507, 1425, 1381, 1260, 1198, 1137, 996, 917, 875, 752, 725 cm-1; 1

H NMR (400 MHz, CDCl3) δ 1.88 (d, 3H, J = 6.6 Hz, CH3), 5.19-5.26 (m, 3H, CH2, CH),

5.28 (s, 2H, CH2), 6.98 (d, 1H, J = 8.5 Hz, Ar-H), 7.32-7.44 (m, 6H, 6 x Ar-H), 7.45-7.53 (m, 4H, 4 x Ar-H), 7.64 (dd, 1H, J = 2.1, 8.5 Hz, Ar-H), 7.69 (d, 1H, J = 2.1 Hz, Ar-H) ppm (lit.39 1

H NMR (CDCl3) δ 1.87 (d, 3H, J = 7 Hz),5.23 (m, 5H), 6.98 (d, 1H, J = 8 Hz), 7.43 (m,

12H) ppm); 13C NMR (101 MHz, CDCl3) δ 20.33, 41.26, 70.81, 71.20, 112.80, 114.60, 123.82, 127.09 (2C), 127.17, 127.42 (2C), 128.04, 128.12, 128.62 (2C), 128.69 (2C), 136.31, 136.67, 148.71, 153.67, 191.98 ppm. HRMS m/z for C23H21BrO3 ([M+H+]+): calcd 425.0752; found 425.0747. Synthesis of compounds 9 and 10. To the solution of 4-(methoxymethoxy)aniline (3) (1.06 g, 6.9 mmol) and triethylamine (1.75 mL, 12.6 mmol) in absolute ethanol (50 mL) was added 1(4-(benzyloxy)phenyl)-2-bromopropan-1-one (7) (2.01 g, 6.3 mmol) or 1-(3,4bis(benzyloxy)phenyl)-2-bromopropan-1-one (8) (2.68 g, 6.3 mmol) and the mixture was purged with argon for 10 min. The reaction mixture was then refluxed overnight under argon atmosphere. The mixture was then concentrated under reduced pressure and suspended in ethyl acetate (150 mL). The white precipitate was filtered off and the filtrate was washed with water (2 x 80 mL), 1% citric acid (2 x 100 mL) and brine (1 x 100 mL). The organic phase was dried over Na2SO4 and concentrated in vacuo to yield compound 9 or 10. 1-(4-(Benzyloxy)phenyl)-2-((4-(methoxymethoxy)phenyl)amino)propan-1-one (9). Yield: 2.41 g (98%); red solid; IR (ATR) ν 3394, 1670, 1596, 1512, 1254, 1221, 1149, 1078, 972, 921, 839, 819, 747 cm-1; 1H NMR (400 MHz, CDCl3) δ 1.48 (d, 3H, J = 6.9 Hz, CH-CH3), 3.49 (s, 3H, O-CH3), 4.49 (br s, 1H, NH), 5.04 (q, 1H, J = 6.9 Hz, CH), 5.09 (s, 2H,O-CH2-O), 5.18 (s, 2H, Ph-CH2), 6.62-6.67 (m, 2H, 2 x Ar-H), 6.89-6.94 (m, 2H, 2 x Ar-H), 7.05-7.10 (m, 2H, 2 x Ar-H), 7.36-7.49 (m, 5H, 5 x Ar-H), 8.00-8.05 (m, 2H, 2 x Ar-H) ppm; 13C NMR (101 24 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 51

MHz, CDCl3) δ 19.85, 53.90, 55.82, 70.24, 95.52, 114.89 (4C), 117.99 (2C), 127.53 (2C), 127.83, 128.35, 128.77 (2C), 130.80 (2C), 136.04, 141.96, 149.85, 163.06, 199.48 ppm. HRMS m/z for C24H25NO4 ([M+H+]+): calcd 392.1862; found 392.1865. 1-(3,4-Bis(benzyloxy)phenyl)-2-((4-(methoxymethoxy)phenyl)amino)propan-1-one (10). Yield: 3.05 g (97%); red solid; IR (ATR) ν 2931, 1671, 1597, 1508, 1426, 1262, 1226, 1133, 1078, 988, 919, 822, 734 cm-1;1H NMR (400 MHz, CDCl3) δ 1.41 (d, 3H, J = 6.9 Hz, CHCH3), 3.49 (s, 3H, O-CH3), 4.49 (br s, 1H, NH), 4.95 (q, 1H, J = 6.9 Hz, CH), 5.08 (s, 2H, OCH2-O), 5.24 (s, 2H, Ph-CH2), 5.28 (s, 2H, Ph-CH2), 6.58-6.63 (m, 2H, 2 x Ar-H), 6.88-6.93 (m, 2H, 2 x Ar-H), 6.97-7.01 (m, 1H, Ar-H), 7.32-7.51 (m, 10H, 10 x Ar-H), 7.61-7.65 (m, 2H, 2 x Ar-H) ppm; 13C NMR (101 MHz, CDCl3) δ 19.79, 54.14, 55.83, 70.84, 71.24, 95.46, 112.97, 114.24, 115.24 (2C), 117.94 (2C), 123.24, 127.11 (2C), 127.40 (2C), 127.91, 128.06, 128.13, 128.63 (2C), 128.70 (2C), 136.32, 136.70, 141.46, 148.72, 150.14, 153.65, 199.31 ppm. HRMS m/z for C31H31NO5 ([M+H+]+): calcd 498.2280; found 498.2285. Synthesis of compounds 11 and 12. To the solution of 1-(4-(benzyloxy)phenyl)-2-((4(methoxymethoxy)phenyl)amino)propan-1-one (9) (2.19 g, 5.6 mmol) or 1-(3,4bis(benzyloxy)phenyl)-2-((4-(methoxymethoxy)phenyl)amino)propan-1-one (10) (2.80 g, 5.6 mmol) in absolute ethanol (50 mL) was added 4-(methoxymethoxy)benzenaminium chloride (4) (534 mg, 2.8 mmol). The mixture was purged with argon for 10 min and stirred overnight in a sealed reactor, at 115 °C. Reaction mixture was then concentrated in vacuo and suspended in ethyl acetate (100 mL). Suspension was washed with water (1 x 100 mL), 10% citric acid (1 x 100 mL) and brine (1 x 100 mL). Organic phase was dried over Na2SO4 and concentrated under reduced pressure. Crude product was then purified by column chromatography with ethyl acetate/hexane (1:2) as an eluent to afford compound 11 or 12.


Page 27 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2-(4-(Benzyloxy)phenyl)-3-methyl-1H-indol-5-ol (11). Yield: 793 mg (43%); yellow crystals; IR (ATR) ν 3423, 1609, 1508, 1486, 1455, 1384, 1239, 1194, 1177, 1020, 939, 830, 800, 733 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 2.29 (s, 3H, CH3), 5.17 (s, 2H, CH2), 6.59 (dd, 1H, J = 2.3, 8.5 Hz, Ar-H), 6.78 (d, 1H, J = 2.3, Ar-H), 7.09-7.17 (m, 3H, 3 x Ar-H), 7.32-7.38 (m, 1H, Ar-H), 7.39-7.45 (m, 2H, 2 x Ar-H), 7.47-7.51 (m, 2H, 2 x Ar-H), 7.53-7.58 (m, 2H, 2 x Ar-H), 8.63 (s, 1H, Ar-OH), 10.71 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.87, 69.21, 102.05, 104.80, 111.16, 111.35, 114.96 (2C), 126.05, 127.71 (2C), 127.84, 128.44 (2C), 128.54 (2C), 130.17, 130.22, 134.22, 137.03, 150.33, 157.26 ppm. HRMS m/z for C22H19NO2 ([M+H+]+): calcd 330.1494; found 330.1495. 2-(3,4-Bis(benzyloxy)phenyl)-3-methyl-1H-indol-5-ol (12).Yield: 1030 mg (42%); off-white solid; IR (ATR) ν 3383, 1506, 1452, 1371, 1240, 1199, 1133, 1001, 942, 797, 733 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 2.22 (s, 3H, CH3), 5.20 (s, 2H, CH2), 5.24 (s, 2H, CH2), 6.60 (dd, 1H, J = 2.3, 8.6 Hz, Ar-H), 6.77 (d, 1H, J = 2.2, Ar-H), 7.10-7.20 (m, 3H, 3 x Ar-H), 7.29 (d, 1H, J = 1.8 Hz, Ar-H), 7.31-7.44 (m, 6H, 6 x Ar-H), 7.47-7.52 (m, 4H, 4 x Ar-H), 8.63 (s, 1H, Ar-OH), 10.71 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.86, 70.03, 70.11, 102.07, 105.04, 111.13, 111.49, 113.71, 114.51, 120.17, 126.51, 127.43 (2C), 127.55 (2C), 127.77 (2C), 128.40 (2C), 128.43 (2C), 130.17 (2C), 134.16, 137.27 (2C), 147.56, 148.09, 150.34 ppm. HRMS m/z for C29H25NO3 ([M+H+]+): calcd 436.1913; found 436.1903. Synthesis of compounds 13 and 14.To the solution of 2-(4-(benzyloxy)phenyl)-3-methyl-1Hindol-5-ol (11) (82 mg, 0.25 mmol) or 2-(3,4-bis(benzyloxy)phenyl)-3-methyl-1H-indol-5-ol (12) (108 mg, 0.25 mmol) in acetone (6 mL) were added potassium carbonate (172 mg, 1.25 mmol) and 3-bromo-1-propanol (34 µl, 0.38 mmol). The mixture was stirred at 60 °C for 90 h. Yellow suspension was filtered and the filtrate concentrated under reduced pressure. Crude product was then purified by column chromatography with dichloromethane/methanol as an eluent to afford compound 13 or 14. 26 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 51

3-((2-(4-(Benzyloxy)phenyl)-3-methyl-1H-indol-5-yl)oxy)propan-1-ol (13).Yield: 80 mg (83%); off-white crystals; IR (ATR) ν 3419, 1506, 1466, 1452, 1381, 1287, 1241, 1208, 1180, 1064, 1024, 964, 830, 807, 741 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 1.89 (p, 2H, J = 6.4 Hz, CH2), 2.36 (s, 3H, CH3), 3.60 (q, 2H,J = 6.3 Hz, CH2), 4.05 (t, 2H, J = 6.4 Hz, CH2), 4.55 (t, 1H, J = 5.2 Hz, OH), 5.18 (s, 2H, Ar-CH2), 6.72 (dd, 1H, J = 2.4, 8.7 Hz, Ar-H), 6.97 (d, 1H, J = 2.4 Hz, Ar-H), 7.13-7.18 (m, 2H, 2 x Ar-H), 7.20 (d, 1H, J = 8.9 Hz, Ar-H), 7.33-7.39 (m, 1H, Ar-H), 7.40-7.45 (m, 2H, 2 x Ar-H), 7.47-7.52 (m, 2H, 2 x Ar-H), 7.55-7.60 (m, 2H, 2 x Ar-H), 10.87 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.87, 32.43, 57.54, 65.01, 69.22, 101.00, 105.47, 111.43, 111.63, 115.00 (2C), 125.91, 127.72 (2C), 127.85, 128.44 (2C), 128.59 (2C), 128.79, 130.81, 134.39, 137.01, 152.43, 157.33 ppm. HRMS m/z for C25H25NO3 ([M+H+]+): calcd 388.1913; found 388.1919. 3-((2-(3,4-Bis(benzyloxy)phenyl)-3-methyl-1H-indol-5-yl)oxy)propan-1-ol (14).Yield: 97 mg (79%); yellow crystals; IR (ATR) ν 3520, 3292, 1540, 1482, 1455, 1379, 1250, 1211, 1052, 992, 824, 804, 742 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 1.89 (p, 2H, J = 6.4 Hz, CH2), 2.71 (s, 3H, CH3), 3.60 (q, 2H,J = 6.2 Hz, CH2), 4.05 (t, 2H,J = 6.4 Hz, CH2), 4.55 (t, 1H,J = 5.1 Hz, OH), 5.21 (s, 2H, Ar-CH2), 5.25 (s, 2H, Ar-CH2), 6.72 (dd, 1H, J = 2.4, 8.7 Hz, ArH), 6.97 (d, 1H, J = 2.3 Hz, Ar-H), 7.15-7.23 (m, 3H, 3 x Ar-H), 7.30-7.37 (m, 3H, 3 x Ar-H), 7.38-7.44 (m, 4H, 4 x Ar-H), 7.48-7.52 (m, 4H, Ar-H), 10.86 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.86, 32.44, 57.53, 64.99, 70.03, 70.13, 100.98, 105.71, 111.40, 111.76, 113.73, 114.52, 120.20, 126.36, 127.43 (2C), 127.56 (2C), 127.78 (2C), 128.40 (2C), 128.43 (2C), 129.80, 130.75, 134.32, 137.26 (2C), 147.33, 148.11, 152.45 ppm. HRMS m/z for C32H31NO4 ([M+H+]+): calcd 494.2331; found 494.2336. Synthesis of compounds 15 and 16. To the solution of 2-(4-(benzyloxy)phenyl)-3-methyl-1Hindol-5-ol (11) (132 mg, 0.4 mmol) or 2-(3,4-bis(benzyloxy)phenyl)-3-methyl-1H-indol-5-ol (12) (192 mg, 0.4 mmol) in acetone (20 mL) were added cesium carbonate (391 mg, 1.2 27 ACS Paragon Plus Environment

Page 29 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mmol) and 2-bromoethyl acetate (66 µl, 0.6 mmol). The mixture was stirred at 60 °C for 20 h, concentrated in vacuo and suspended in ethyl acetate (50 mL). Suspension was washed with water (1 x 50 mL), 10% citric acid (1 x 50 mL), saturated aqueous NaHCO3 solution (1 x 50 mL) and brine (1 x 50 mL). Organic phase was dried over Na2SO4 and concentrated under reduced pressure. Crude product was then purified by column chromatography with ethyl acetate/hexane (1:2) as an eluent to afford compound 15 or 16. 2-((2-(4-(Benzyloxy)phenyl)-3-methyl-1H-indol-5-yl)oxy)ethyl acetate (15). Yield: 76 mg (46%); off-white crystals; IR (ATR) ν 3387, 1736, 1609, 1480, 1446, 1379, 1232, 1209, 1054, 969, 833, 802, 741 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 2.07 (s, 3H, CH3-C=O), 2.35 (s, 3H, Ar-CH3), 4.18-4.22 (m, 2H, CH2), 4.34-4.37 (m, 2H, CH2), 5.18 (s, 2H, Ar-CH2), 6.74 (dd, 1H, J = 2.4, 8.7 Hz, Ar-H), 7.02 (d, 1H, J = 2.4 Hz, Ar-H), 7.13-7.18 (m, 2H, 2 x Ar-H), 7.22 (d, 1H, J = 8.8 Hz, Ar-H), 7.33-7.38 (m, 1H, Ar-H), 7.40-7.45 (m, 2H, 2 x Ar-H), 7.477.52 (m, 2H, 2 x Ar-H), 7.56-7.61 (m, 2H, 2 x Ar-H), 10.91 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.87, 20.71, 62.81, 66.20, 69.22, 101.33, 105.56, 111.51, 111.57, 115.01 (2C), 125.85, 127.72 (2C), 127.85, 128.45 (2C), 128.61 (2C), 129.78, 131.03, 134.55, 137.01, 151.91, 157.37, 170.42 ppm. HRMS m/z for C26H25NO4 ([M+H+]+): calcd 416.1862; found 416.1851. 2-((2-(3,4-bis(Benzyloxy)phenyl)-3-methyl-1H-indol-5-yl)oxy)ethyl acetate (16). Yield: 88 mg (42%); off-white crystals; IR (ATR) ν 3380, 2868, 1732, 1510, 1482, 1448, 1377, 1259, 1215, 1134, 1019, 958, 815, 800, 733 cm-1; 1H NMR (400 MHz, CDCl3) δ 2.15 (s, 3H, CH3-C=O), 2.29 (s, 3H, Ar-CH3), 4.24-4.31 (m, 2H, CH2), 4.45-4.52 (m, 2H, CH2), 5.22-5.29 (m, 4H, 2 x Ar-CH2), 6.86-6.92 (m, 1H, Ar-H), 7.01-7.11 (m, 3H, 3 x Ar-H), 7.14 (s, 1H, Ar-H), 7.24 (d, 1H, J = 8.7 Hz, Ar-H), 7.32-7.45 (m, 6H, 6 x Ar-H), 7.47-7.55 (m, 4H, 4 x Ar-H), 7.82 (s, 1H, NH) ppm; 13C NMR (101 MHz, CDCl3) δ 9.58, 21.03, 63.27, 67.06, 71.28, 71.45, 102.41, 107.80, 111.36, 112.63, 114.95, 115.04, 120.84, 126.76, 127.29 (2C), 127.32 (2C), 127.93 28 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 51

(2C), 128.60 (2C), 128.62 (2C), 130.45, 131.14, 135.03, 137.13 (2C), 148.45, 148.85, 152.91, 171.21 ppm. HRMS m/z for C33H31NO5 ([M+H+]+): calcd 522.2280; found 522.2283. Synthesis of compounds 17 and 18. Compound 2-((2-(4-(benzyloxy)phenyl)-3-methyl-1Hindol-5-yl)oxy)ethyl acetate (15) (112 mg, 0.27 mmol) or 2-((2-(3,4-bis(benzyloxy)phenyl)-3methyl-1H-indol-5-yl)oxy)ethyl acetate (16) (140 mg, 0.27 mmol) was dissolved in 1,4dioxane (6 mL) and cooled to 5 °C. 1M NaOH(aq) (1.08 mL, 1.08 mmol) was added and the mixture was stirred for 5 h at room temperature. Reaction mixture was concentrated in vacuo, dissolved in ethyl acetate (25 mL) and washed with water (1 x 25 mL), saturated aqueous NaHCO3 solution (1 x 25 mL) 10% citric acid (1 x 25 mL), and brine (1 x 25 mL). Organic phase was dried over Na2SO4 and concentrated under reduced pressure. Crude product was then purified by column chromatography with ethyl acetate/hexane (1:1) as an eluent to yield compound 17 or 18. 2-((2-(4-(Benzyloxy)phenyl)-3-methyl-1H-indol-5-yl)oxy)ethanol (17). Yield: 92 mg (85%); yellow crystals; IR (ATR) ν 3491, 3461, 1610, 1511, 1479, 1456, 1259, 1203, 1186, 1079, 1004, 952, 825, 795, 754, 702 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 2.35 (s, 3H, CH3), 3.74 (q, 2H, J = 5.3 Hz, CH2), 4.01 (t, 2H, J = 5.1 Hz, CH2), 4.85 (t, 1H, J = 5.6 Hz, OH), 5.18 (s, 2H, Ar-CH2), 6.74 (dd, 1H, J = 2.4, 8.7 Hz, Ar-H), 6.98 (d, 1H, J = 2.3 Hz, Ar-H), 7.13-7.18 (m, 2H, 2 x Ar-H), 7.21 (d, 1H, J = 8.7 Hz, Ar-H), 7.33-7.39 (m, 1H, Ar-H), 7.40-7.45 (m, 2H, 2 x Ar-H), 7.47-7.52 (m, 2H, 2 x Ar-H), 7.55-7.60 (m, 2H, 2 x Ar-H), 10.88 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.89, 59.83, 69.22, 69.98, 101.05, 105.49, 111.45, 111.67, 115.00 (2C), 125.91 (2C), 127.72 (2C), 127.85, 128.45 (2C), 128.59 (2C), 129.79, 130.85, 134.42, 137.02, 152.42, 157.35 ppm. HRMS m/z for C24H23NO3 ([M+H+]+): calcd 374.1756; found 374.1750.


Page 31 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2-((2-(3,4-Bis(benzyloxy)phenyl)-3-methyl-1H-indol-5-yl)oxy)ethanol (18). Yield: 111 mg (86%); yellow crystals; IR (ATR) ν 3451, 3335, 1509, 1485, 1454, 1249, 1203, 1167, 1064, 1001, 951, 893, 827, 799, 746 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 2.27 (s, 3H, CH3), 3.74 (q, 2H, J = 5.4 Hz, CH2), 4.00 (t, 2H, J = 5.1 Hz, CH2), 4.85 (t, 1H, J = 5.6 Hz, OH), 5.21 (s, 2H, Ar-CH2), 5.25 (s, 2H, Ar-CH2), 6.74 (dd, 1H, J = 2.4, 8.7 Hz, Ar-H), 6.97 (d, 1H, J = 2.3 Hz, Ar-H), 7.17-7.23 (m, 3H, 3 x Ar-H), 7.30-7.44 (m, 7H, 7 x Ar-H), 7.47-7.52 (m, 4H, 4 x Ar-H), 10.87 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.87, 59.82, 69.96, 70.03, 70.13, 101.03, 105.73, 111.42, 111.80, 113.73, 114.52, 120.20, 126.35, 127.43 (2C),127.56 (2C), 127.79 (2C), 128.41 (2C), 128.43 (2C), 129.79, 130.79, 134.34, 137.26 (2C), 147.33, 148.10, 152.43 ppm. HRMS m/z for C31H29NO4 ([M+H+]+): calcd 480.2175; found 480.2171. Synthesis of compounds 19-24 and 34-36. To the solution of O-benzyl protected compound 11, 12, 13, 14, 17, 18, 31, 32 or 33 (0.3 mmol) in a mixture of absolute ethanol (3 mL) and THF (3 mL)was added 10% Pd/C (20 wt%) and the reaction mixture was stirred under hydrogen atmosphere for 15 h. The catalyst was filtered off and the solvent was removed under reduced pressure. The crude product was purified by column chromatography with dichloromethane/methanol as an eluent to afford compounds 19-24 and 34-36. 2-(4-Hydroxyphenyl)-3-methyl-1H-indol-5-ol (19). Prepared from 2-(4-(benzyloxy)phenyl)-3methyl-1H-indol-5-ol (11) (99 mg, 0.3 mmol) according to general procedure. Yield: 59 mg (82%); grey solid; IR (ATR) ν 3301, 1610, 1509, 1463, 1369, 1229, 1174, 939, 827, 796 cm-1; 1

H NMR (400 MHz, DMSO-d6) δ 2.27 (s, 3H, CH3), 6.58 (dd, 1H, J = 2.3, 8.5 Hz, Ar-H),

6.77 (d, 1H, J = 2.3 Hz, Ar-H), 6.86-6.91 (m, 2H, 2 x Ar-H), 7.10 (d, 1H, J = 8.2 Hz, Ar-H), 7.42-7.47 (m, 2H, 2 x Ar-H), 8.60 (br s, 1H, OH), 9.58 (br s, 1H, OH), 10.63 (s, 1H, NH) ppm (lit.40 1H NMR (CDCl3) δ 2.33 (s, 3H), 6.67 (dd, 1H, J = 2.0, 8.5 Hz), 6.92 (d, 1H, J = 2.0 Hz), 6.92, 7.48 (AB, 4H, J = 8.5 Hz), 7.20 (d, 1H, J = 8.5 Hz) ppm); 13C NMR (101 MHz, DMSO-d6) δ 9.87, 101.99, 104.21, 111.06 (2C: 2 signals overlapped), 115.41 (2C), 124.25, 30 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 51

128.65 (2C), 130.12, 130.24, 134.78, 150.27, 156.45 ppm. HRMS m/z for C15H13NO2 ([M+H+]+): calcd 240.1025; found 240.1022. HPLC: Method A, retention time: 13.99 min (96.6% at 254 nm). 4-(5-Hydroxy-3-methyl-1H-indol-2-yl)benzene-1,2-diol (20). Prepared from 2-(3,4bis(benzyloxy)phenyl)-3-methyl-1H-indol-5-ol (12) (131 mg, 0.3 mmol) according to general procedure. Yield: 74 mg (96%); brown crystals; IR (ATR) ν 3517, 3384, 3207, 1617, 1491, 1460, 1433, 1372, 1240, 1189, 1149, 1113, 1057, 943, 874, 795, 773 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 2.27 (s, 3H, CH3), 6.57 (dd, 1H, J = 2.3, 8.5 Hz, Ar-H), 6.76 (d, 1H, J = 2.1 Hz, Ar-H), 6.82-6.86 (m, 1H, Ar-H), 6.88-6.92(m, 1H, Ar-H), 7.04 (d, 1H, J = 2.1 Hz, ArH), 7.09 (d, 1H, J = 8.8 Hz, Ar-H), 8.59 (br s, 1H, OH), 9.07 (br s, 2H, 2 x OH), 10.58 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.93, 101.95, 104.11, 110.96, 111.06, 114.96, 115.72, 118.72, 124.75, 130.07, 130.25, 134.99, 144.59, 145.22, 150.24 ppm. HRMS m/z for C15H13NO3 ([M+H+]+): calcd 256.0974; found 256.0971. HPLC: Method A, retention time: 15.80 min (99.9% at 254 nm). 4-(5-(2-Hydroxyethoxy)-3-methyl-1H-indol-2-yl)phenol (21). Prepared from 2-((2-(4(benzyloxy)phenyl)-3-methyl-1H-indol-5-yl)oxy)ethanol (17) (112 mg, 0.3 mmol) according to general procedure. Yield: 82 mg (97%); off-white crystals; IR (ATR) ν 3463, 3159, 1610, 1509, 1480, 1452, 1209, 1056, 1042, 955, 893, 815, 789 cm-1; 1H NMR (400 MHz, DMSOd6) δ 2.32 (s, 3H, CH3), 3.74 (q, 2H, J = 5.4 Hz, CH2), 4.00 (t, 2H, J = 5.2 Hz, CH2), 4.84 (t, 1H, J = 5.6, OH), 6.71 (dd, 1H, J = 2.4, 8.7 Hz, Ar-H), 6.86-6.91 (m, 2H, 2 x Ar-H), 6.96 (d, 1H, J = 2.4 Hz, Ar-H), 7.19 (d, 1H, J = 8.8 Hz, Ar-H), 7.43-7.48 (m, 2H, 2 x Ar-H), 9.60 (s, 1H, Ar-OH), 10.79 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.88, 59.83, 69.98, 101.00, 104.87, 111.34 (2C: 2 signals overlapped), 115.44 (2C), 124.11, 128.96 (2C), 129.85, 130.75, 134.98, 152.36, 156.53 ppm. HRMS m/z for C17H17NO3 ([M+H+]+): calcd 284.1287; found 284.1283. HPLC: Method A, retention time: 19.87 min (99.8% at 254 nm). 31 ACS Paragon Plus Environment

Page 33 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4-(5-(2-Hydroxyethoxy)-3-methyl-1H-indol-2-yl)benzene-1,2-diol (22). Prepared from 2-((2(3,4-bis(benzyloxy)phenyl)-3-methyl-1H-indol-5-yl)oxy)ethanol (18) (144 mg, 0.3 mmol) according to general procedure. Yield: 86 mg (96%); yellow crystals; IR (ATR) ν 3397, 1616, 1509, 1481, 1452, 1276, 1201, 1058, 953, 827, 806, 772 cm-1; 1H NMR (400 MHz, DMSOd6) δ 2.32 (s, 3H, CH3), 3.74 (t, 2H, J = 5.1 Hz, CH2), 4.00 (t, 2H, J = 5.2 Hz, CH2), 4.84 (br s, 1H, OH), 6.70 (dd, 1H, J = 2.4, 8.7 Hz, Ar-H), 6.83-6.86 (m, 1H, Ar-H), 6.89-6.96 (m, 2H, 2 x Ar-H), 7.05 (d, 1H, J = 2.1 Hz, Ar-H), 7.18 (d, 1H, J = 8.6 Hz, Ar-H), 9.08 (br s, 2H, ArOH), 10.74 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.94, 59.83, 69.99, 100.96, 104.77, 111.27, 111.34, 114.98, 115.74, 118.75, 124.59, 129.85, 130.70, 135.18, 144.68, 145.25, 152.34 ppm. HRMS m/z for C17H17NO4 ([M+H+]+): calcd 300.1236; found 300.1242. HPLC: Method A, retention time: 17.88 min (98.8% at 254 nm). 4-(5-(3-Hydroxypropoxy)-3-methyl-1H-indol-2-yl)phenol (23). Prepared from 3-((2-(4(benzyloxy)phenyl)-3-methyl-1H-indol-5-yl)oxy)propan-1-ol (13) (116 mg, 0.3 mmol) according to general procedure. Yield: 79 mg (89%); off-white crystals; IR (ATR) ν 3388, 1609, 1508, 1458, 1237, 1209, 1067, 1030, 958, 825, 804 cm-1; 1H NMR (400 MHz, DMSOd6) δ 1.89 (p, 2H, J = 6.3 Hz, CH2),2.32 (s, 3H, CH3), 3.60 (q, 2H, J = 6.2 Hz, CH2), 4.05 (t, 2H, J = 6.5 Hz, CH2), 4.55 (t, 1H, J = 5.2 Hz, OH), 6.69 (dd, 1H, J = 2.4, 8.6 Hz, Ar-H), 6.866.91 (m, 2H, 2 x Ar-H), 6.95 (d, 1H, J = 2.4 Hz, Ar-H), 7.18 (d, 1H, J = 8.7 Hz, Ar-H), 7.437.48 (m, 2H, 2 x Ar-H), 9.60 (s, 1H, Ar-OH), 10.78 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.87, 32.45, 57.54, 65.01, 100.95, 104.87, 111.31 (2C: 2 signals overlapped), 115.44 (2C), 124.11, 128.69 (2C), 129.85, 130.71, 134.95, 152.38, 156.52 ppm. HRMS m/z for C18H19NO3 ([M+H+]+): calcd 298.1443; found 298.1442. HPLC: Method B, retention time: 21.10 min (95.1% at 254 nm). 4-(5-(3-Hydroxypropoxy)-3-methyl-1H-indol-2-yl)benzene-1,2-diol (24). Prepared from 3-((2(3,4-bis(benzyloxy)phenyl)-3-methyl-1H-indol-5-yl)oxy)propan-1-ol (14) (148 mg, 0.3 32 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 51

mmol) according to general procedure. Yield 86 mg (91%); brown solid; IR (ATR) ν 3378, 2952, 1616, 1509, 1455, 1382, 1274, 1194, 1063, 957, 826, 804, 779 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 1.88 (p, 2H, J = 6.4 Hz, CH2), 2.31 (s, 3H, CH3), 3.59 (t, 2H, J = 6.0 Hz, CH2), 4.04 (t, 2H, J = 6.4 Hz, CH2), 4.55 (br s, 1H, OH), 6.68 (dd, 1H, J = 2.4, 8.6 Hz, Ar-H), 6.82-6.86 (m, 1H, Ar-H), 6.89-6.93 (m, 1H, Ar-H), 6.94 (d, 1H, J = 2.4 Hz, Ar-H), 7.05 (d, 1H, J = 2.1 Hz, Ar-H), 7.17 (d, 1H, J = 8.6 Hz, Ar-H), 9.06 (br s, 1H, Ar-OH), 9.09 (br s, 1H, Ar-OH), 10.73 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.93, 32.45, 57.54, 65.02, 100.91, 104.74, 111.22, 111.31, 114.98, 115.73, 118.74, 124.60, 129.85, 130.66, 135.15, 144.67, 145.24, 152.36 ppm. HRMS m/z for C18H19NO4 ([M+H+]+): calcd 314.1392; found 314.1392. HPLC: Method A, retention time: 19.38 min (96.2% at 254 nm). 4-(5-Hydroxy-1,3-dimethyl-1H-indol-2-yl)benzene-1,2-diol (34). Prepared from 5(benzyloxy)-2-(3,4-bis(benzyloxy)phenyl)-1,3-dimethyl-1H-indole (31) (162 mg, 0.3 mmol) according to general procedure. Yield: 80 mg (99%); brown solid; IR (ATR) 3254, 2936, 1693, 1620, 1470, 1426, 1377, 1191, 1111, 1047, 926, 905, 793, 778, 743 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 2.10 (s, 3H, CH3), 3.49 (s, 3H, N-CH3), 6.64-6.68 (m, 2H, 2 x Ar-H), 6.76-6.80 (m, 2H, 2 x Ar-H), 6.87 (d, 1H, J = 8.1 Hz, Ar-H), 7.18 (d, 1H, J = 8.5 Hz, Ar-H), 8.68 (br s, 1H, OH), 9.10-9.19 (m, 2H, 2 x OH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.45, 30.69, 102.23, 105.32, 109.88, 111.00, 115.54, 117.52, 121.47, 122.48, 128.61, 131.34, 138.11, 145.01, 145.14, 150.60 ppm. HRMS m/z for C16H15NO3 ([M+H+]+): calcd 270.1130; found 270.1125. HPLC: Method A, retention time: 18.60 min (98.5% at 254 nm). 4-(5-Hydroxy-3-methyl-1-propyl-1H-indol-2-yl)benzene-1,2-diol (35). Prepared from 5(benzyloxy)-2-(3,4-bis(benzyloxy)phenyl)-3-methyl-1-propyl-1H-indole (32) (170 mg, 0.3 mmol) according to general procedure. Yield: 88 mg (99%); brown solid; IR (ATR) 3307, 2964, 2929, 1618, 1459, 1353, 1279, 1165, 1109, 932, 915, 819, 784 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 0.65 (t, 3H, J = 7.4 Hz, CH3), 1.42-1.54 (m, 2H, CH2), 2.06 (s, 3H, Ar33 ACS Paragon Plus Environment

Page 35 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CH3), 3.90 (t, 2H, J = 7.4 Hz, CH2), 6.62 (dd, 1H, J = 1.6, 2.1 Hz, Ar-H), 6.64 (t, 1H, J = 2.2 Hz, Ar-H), 6.74 (d, 1H, J = 2.1 Hz, Ar-H), 6.78 (d, 1H, J = 2.2 Hz, Ar-H), 6.86 (d, 1H, J = 8.0 Hz, Ar-H), 7.21 (d, 1H, J = 8.7 Hz, Ar-H), 8.67 (br s, 1H, OH), 9.13 (br s, 2H, 2 x OH) ppm; 13

C NMR (101 MHz, DMSO-d6) δ 9.34, 11.09, 22.87, 44.75, 102.31, 105.68, 110.22, 110.93,

115.60, 117.41, 121.33, 122.87, 128.75, 130.50, 138.03, 145.01, 145.10, 150.51 ppm. HRMS m/z for C18H19NO3 ([M+H+]+): calcd 298.1443; found 298.1441. HPLC: Method B, 22.07 min (100.0% at 254 nm). 4-(1-Benzyl-5-hydroxy-3-methyl-1H-indol-2-yl)benzene-1,2-diol (36). Prepared from 1benzyl-5-(benzyloxy)-2-(3,4-bis(benzyloxy)phenyl)-3-methyl-1H-indole (33) (185 mg, 0.3 mmol) according to general procedure. Yield: 99 mg (96%); brown solid; IR (ATR) 3192, 2921, 1597, 1451, 1352, 1255, 1191, 1114, 1081, 922, 822, 783, 729 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 2.13 (s, 3H, CH3), 5.20 (s, 2H, CH2), 6.57 (dd, 1H, J = 2.3, 8.6 Hz, Ar-H), 6.62 (dd, 1H, J = 2.1, 8.1 Hz, Ar-H), 6.76 (d, 1H, J = 2.0 Hz, Ar-H), 6.80-6.88 (m, 4H, 4 x Ar-H), 7.03 (d, 1H, J = 8.7 Hz, Ar-H), 7.12-7.24 (m, 3H, 3 x Ar-H), 8.72 (br s, 1H, OH), 9.06-9.23 (m, 2H, 2 x OH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.48, 46.55, 102.45, 106.31, 110.73, 111.19, 115.60, 117.51, 121.34, 122.44, 126.01 (2C), 126.76, 128.29 (2C), 129.15, 130.58, 138.33, 138.83, 145.09, 145.27, 150.84 ppm. HRMS m/z for C22H19NO3 ([M+H+]+): calcd 346.1443; found 346.1437. HPLC: Method B, retention time: 22.52 min (100.0% at 254 nm). Synthesis of compounds25-29. Compound 19, 20, 21, 23 or 24 (0.19 mmol) was dissolved in anhydrous pyridine (10 mL) under argon atmosphere and the solution was cooled to -16 °C. Chlorosulfonic acid (255 µl, 1.90 mmol) was added dropwise and the yellow suspension was stirred at room temperature for 24 h. The suspension was cooled to 0 °C and the pH was adjusted to 10 with 5M NaOH(aq). Reaction mixture was then stirred for 24 h at room temperature and concentrated under reduced pressure. The solid residue was washed with the 34 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 51

mixture of methanol and ethanol (1:1) (4 x 25 mL) and the combined organic phases were concentrated in vacuo. The crude product was purified by reversed-phase column chromatography with methanol/water as an eluent to afford compounds 25-29. Disodium 4-[3-methyl-5-(sulfonatooxy)-1H-indol-2-yl]phenyl sulfate(25). Prepared from 2-(4hydroxyphenyl)-3-methyl-1H-indol-5-ol (19) (45 mg, 0.19 mmol) according to general procedure. Yield: 60 mg (71%); off-white crystals; IR (ATR) ν 3606, 3453, 3316, 1621, 1485, 1235, 1169, 1050, 939, 858, 800, 763, 702 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 2.34 (s, 3H, CH3), 6.92 (dd, 1H, J = 2.2, 8.6 Hz, Ar-H), 7.20 (d, 1H, J = 8.6 Hz, Ar-H), 7.26 (d, 1H, J = 2.2 Hz, Ar-H), 7.27-7.31 (m, 2H, 2 x Ar-H), 7.53-7.58 (m, 2H, 2 x Ar-H), 10.95 (s, 1H, NH) ppm (lit.41 1H NMR (60 MHz, D2O) δ 2.1 (s, 3H), 6.9-7.5 (m, 8H) ppm); 13C NMR (101 MHz, DMSO-d6) δ 9.83, 105.94, 109.89, 110.34, 116.41, 120.56 (2C), 127.93 (3C: 2 signals overlapped), 129.32, 132.60, 134.40, 146.34, 152.55 ppm. HRMS m/z for C15H11NNa2O8S2 ([M+H+]+): calcd 443.9800; found 443.9806. HPLC: Method A, retention time: 10.96 min (96.6% at 254 nm). Trisodium 4-[3-methyl-5-(sulfonatooxy)-1H-indol-2-yl]benzene-1,2-diyl disulfate (26). Prepared from 4-(5-hydroxy-3-methyl-1H-indol-2-yl)benzene-1,2-diol (20) (49 mg, 0.19 mmol) according to general procedure. Yield: 69 mg (65%); yellow crystals; IR (ATR) ν 3406, 1508, 1482, 1261, 1213, 1066, 1040, 946, 871, 845, 801, 726 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 2.32 (s, 3H, CH3), 6.91 (dd, 1H, J = 2.2, 8.6 Hz, Ar-H), 7.16-7.21 (m, 2H, 2 x Ar-H), 7.25 (d, 1H, J = 2.1 Hz, Ar-H), 7.64 (d, 1H, J = 8.6 Hz, Ar-H), 7.89 (d, 1H, J = 2.2 Hz, Ar-H), 10.88 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.72, 105.79, 109.79, 110.36, 116.22, 119.79, 119.90, 121.21, 127.03, 129.31, 132.59, 134.65, 143.24, 143.67, 146.28 ppm. HRMS m/z for C15H10NNa3O12S3 ([M+Na+]+): calcd 583.8956; found 583.8965. HPLC: Method C, retention time: 6.56 min (97.3% at 254 nm).


Page 37 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Disodium 4-{3-methyl-5-[2-(sulfonatooxy)ethoxy]-1H-indol-2-yl}phenyl sulfate (27). Prepared from 4-(5-(2-hydroxyethoxy)-3-methyl-1H-indol-2-yl)phenol(21) (54 mg, 0.19 mmol) according to general procedure. Yield: 54 mg (58%); off-white crystals; IR (ATR) ν 3475, 1628, 1481, 1259, 1223, 1203, 1168, 1061, 1033, 937, 882, 801, 760, 730 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 2.36 (s, 3H, CH3), 4.03-4.08 (m, 2H, CH2), 4.12-4.16 (m, 2H, CH2), 6.75 (dd, 1H, J = 2.3, 8.7 Hz, Ar-H), 7.00 (d, 1H, J = 2.2 Hz, Ar-H), 7.23 (d, 1H, J = 8.7 Hz, Ar-H), 7.26-7.31 (m, 2H, 2 x Ar-H), 7.53-7.58 (m, 2H, 2 x Ar-H), 10.91 (s, 1H, NH)ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.85, 64.47, 67.11, 101.08, 105.88, 111.55, 111.71, 120.58 (2C), 127.89 (2C), 128.05, 129.75, 130.95, 134.46, 152.18, 152.80 ppm. HRMS m/z for C17H15NNa2O9S2 ([M+Na+]+): calcd 509.9881; found 509.9877. HPLC: Method A, retention time: 12.77 min (96.4% at 254 nm). Disodium 3-({3-methyl-2-[4-(sulfonatooxy)phenyl]-1H-indol-5-yl}oxy)propyl sulfate (28). Prepared from 4-(5-(3-hydroxypropoxy)-3-methyl-1H-indol-2-yl)phenol (23) (56 mg, 0.19 mmol) according to general procedure. Yield: 59 mg (62%); off-white crystals; IR (ATR) ν 3476, 1622, 1482, 1204, 1166, 1051, 997, 955, 876, 845, 789, 729 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 1.99 (p, 2H, J = 6.5 Hz, CH2), 2.35 (s, 3H, CH3), 3.91 (t, 2H, J = 6.5 Hz, CH2), 4.03 (t, 2H, J = 6.4 Hz, CH2), 6.73 (dd, 1H, J = 2.4, 8.7 Hz, Ar-H), 6.99 (d, 1H, J = 2.3 Hz, Ar-H), 7.22 (d, 1H, J = 8.6 Hz, Ar-H), 7.26-7.31 (m, 2H, 2 x Ar-H), 7.52-7.57 (m, 2H, 2 x ArH), 10.89(s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.84, 29.34, 62.68, 65.02, 101.17, 105.86, 111.49, 111.73, 120.56 (2C), 127.89 (2C), 128.04, 129.77, 130.93, 134.44, 152.34, 152.51 ppm. HRMS m/z for C18H17NNa2O9S2 ([M+Na+]+): calcd 524.0038; found 524.0036. HPLC: Method A, retention time: 14.41 min (95.6% at 254 nm). Trisodium 3-({3-methyl-2-[3,4-bis(sulfonatooxy)phenyl]-1H-indol-5-yl}oxy)propyl sulfate (29). Prepared from 4-(5-(3-hydroxypropoxy)-3-methyl-1H-indol-2-yl)benzene-1,2-diol (24) (60 mg, 0.19 mmol) according to general procedure. Yield: 78 mg (66%); yellow solid; IR 36 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 51

(ATR) ν 3475, 1624, 1485, 1207 1059, 1038, 986, 960, 917, 850, 737 cm-1;1H NMR (400 MHz, DMSO-d6) δ 1.99 (p, 2H, J = 6.5 Hz, CH2), 2.33 (s, 3H, CH3), 3.91 (t, 2H, J = 6.5 Hz, CH2), 4.03 (t, 2H, J = 6.4 Hz, CH2), 6.72 (dd, 1H, J = 2.4, 8.7 Hz, Ar-H), 6.97 (d, 1H, J = 2.3 Hz, Ar-H), 7.17 (dd, 1H, J = 2.2, 8.6 Hz, Ar-H), 7.22 (d, 1H, J = 8.7 Hz, Ar-H), 7.64 (d, 1H, J = 8.6 Hz, Ar-H), 7.88 (d, 1H, J = 2.2 Hz, Ar-H), 10.83 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.72, 29.36, 62.75, 64.99, 101.09, 105.72, 111.52, 111.55, 119.77, 119.92, 121.18, 127.13, 129.76, 130.93, 134.68, 143.18, 143.66, 152.29 ppm. HRMS m/z for C18H16NNa3O13S3 ([M+Na+]+): calcd 641.9375; found 641.9389. HPLC: Method C, retention time: 9.26 min (97.2% at 254 nm). 5-(Benzyloxy)-2-(3,4-bis(benzyloxy)phenyl)-3-methyl-1H-indole (30). To the solution of 2(3,4-bis(benzyloxy)phenyl)-3-methyl-1H-indol-5-ol (12) (523 mg, 1.2 mmol) in acetone (7 mL) was added K2CO3 (332 mg, 2.4 mmol) and the mixture was stirred for 30 min at room temperature. Benzyl bromide (154 µl, 1.3 mmol) was added and the mixture was refluxed overnight. Solvent was removed in vacuo and the residue was suspended in ethyl acetate (40 mL). The suspension was washed with water (1 x 20 mL), brine (1 x 20 mL), dried over Na2SO4 and concentrated under reduced pressure. The crude product was purified by column chromatography with ethyl acetate/hexane as an eluent to afford 30 as orange crystals. Yield: 517 mg (82%); IR (ATR) ν 3433, 1508, 1453, 1381, 1247, 1219, 1198, 1135, 999, 948, 845, 796, 742 cm-1; 1H NMR (400 MHz, CDCl3) δ 2.29 (s, 3H, CH3), 5.16 (s, 2H, CH2), 5.25 (s, 2H, CH2), 5.26 (s, 2H, CH2), 6.94 (dd, 1H, J = 2.4, 8.7 Hz, Ar-H), 7.02-7.06 (m, 1H, Ar-H), 7.06-7.10 (m, 1H, Ar-H), 7.11 (d, 1H, J = 2.4 Hz, Ar-H), 7.14 (d, 1H, J = 1.9 Hz, Ar-H), 7.25 (d, 1H, J = 8.7 Hz, Ar-H), 7.32-7.45 (m, 9H, 9 x Ar-H), 7.48-7.54 (m, 6H, 6 x Ar-H), 7.78 (s, 1H, NH) ppm; 13C NMR (101 MHz, CDCl3) δ 9.59, 71.01, 71.29, 71.45, 102.45, 107.84, 111.28, 112.79, 114.96, 115.06, 120.82, 126.84, 127.28 (2C), 127.31 (2C), 127.63 (2C), 127.78, 127.92 (2C), 128.53 (2C), 128.59 (2C), 128.61 (2C), 130.46, 130.99, 134.91, 137.15 37 ACS Paragon Plus Environment

Page 39 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(2C), 137.75, 148.43, 148.85, 153.31 ppm. HRMS m/z for C36H31NO3 ([M+H+]+): calcd 526.2382; found 526.2386. Synthesis of compounds 31-33.5-(Benzyloxy)-2-(3,4-bis(benzyloxy)phenyl)-3-methyl-1Hindole (30) (158 mg, 0.3 mmol) was dissolved in DMF (3 mL) and cooled to 0 °C. 95% sodium hydride (11 mg, 0.45 mmol) was added and the orange solution was stirred for 30 min at room temperature. Reaction mixture was cooled to 0 °C again and 0.45 mmol of methyl iodide, 1-bromopropane or benzyl bromide was added. The mixture was stirred for 1 h at room temperature, diluted with water (25 mL) and extracted with ethyl acetate (1 x 25 mL). The organic phase was washed with 10% citric acid (2 x 20 mL), brine (1 x 20 mL) and dried over Na2SO4. The solvent was removed under reduced pressure and the crude product was purified by column chromatography with ethyl acetate/hexane as an eluent to yield compounds 31-33. 5-(Benzyloxy)-2-(3,4-bis(benzyloxy)phenyl)-1,3-dimethyl-1H-indole (31). Prepared from 5(benzyloxy)-2-(3,4-bis(benzyloxy)phenyl)-3-methyl-1H-indole (30) (158 mg, 0.3 mmol) and methyl iodide (28 µl, 0.45 mmol) according to general procedure. Yield: 112 mg (69%); yellow solidified oil; IR (ATR) ν 2913, 1617, 1481, 1453, 1380, 1259, 1204, 1133, 1017, 929, 795, 732 cm-1;1H NMR (400 MHz, DMSO-d6) δ 2.07 (s, 3H, CH3), 3.45 (s, 3H, N-CH3), 5.14 (s, 2H, CH2), 5.22 (s, 2H, CH2), 5.23 (s, 2H, CH2), 6.88 (dd, 1H, J = 2.4, 8.8 Hz, Ar-H), 6.95 (dd, 1H, J = 2.0, 8.2 Hz, Ar-H), 7.03 (d, 1H, J = 2.0 Hz, Ar-H), 7.10 (d, 1H, J = 2.4 Hz, ArH), 7.21 (d, 1H, J = 8.4 Hz, Ar-H), 7.30-7.55 (m, 16H, 16 x Ar-H) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.30, 30.71, 69.77, 69.86, 69.98, 101.90, 106.64, 110.31, 111.77, 113.88, 116.51, 123.12, 124.10, 127.37 (2C), 127.59 (3C: 2 signals overlapped), 127.65 (2C), 127.70, 127.85, 128.11, 128.32 (2C), 128.40 (2C), 128.45 (2C), 132.13, 137.20, 137.27, 137.68, 137.77, 147.53, 148.00, 152.32 ppm. HRMS m/z for C37H33NO3 ([M+H+]+): calcd 540.2539; found 540.2543. 38 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 51

5-(Benzyloxy)-2-(3,4-bis(benzyloxy)phenyl)-3-methyl-1-propyl-1H-indole (32). Prepared from 5-(benzyloxy)-2-(3,4-bis(benzyloxy)phenyl)-3-methyl-1H-indole (30) (158 mg, 0.3 mmol) and 1-bromopropane (41 µl, 0.45 mmol) according to general procedure. Yield: 120 mg (70%); colorless solidified oil; IR (ATR) ν 2928, 2972, 1616, 1506, 1453, 1380, 1260, 1205, 1172, 1134, 1019, 933, 795, 732 cm-1 ;1H NMR (400 MHz, DMSO-d6) δ 0.55 (t, 3H, J = 8.4 Hz, CH2-CH2-CH3), 1.31-1.42 (m, 2H, CH2-CH2-CH3), 2.04 (s, 3H, Ar-CH3), 3.86 (t, 2H, CH2-CH2-CH3), 5.13 (s, 2H, CH2), 5.21 (s, 2H, CH2), 5.22 (s, 2H, CH2), 6.86 (dd, 1H, J = 2.4, 8.8 Hz, Ar-H), 6.91 (dd, 1H, J = 1.9, 8.2 Hz, Ar-H), 6.99 (d, 1H, J = 2.0 Hz, Ar-H), 7.09 (d, 1H, J = 2.4 Hz, Ar-H), 7.21 (d, 1H, J = 8.3 Hz, Ar-H), 7.28-7.55 (m, 16H, 16 x Ar-H) ppm; 13

C NMR (101 MHz, DMSO-d6) δ 9.20, 11.02, 22.81, 44.72, 69.77, 69.79, 69.97, 101.96,

107.04, 110.64, 111.66, 113.87, 116.44, 123.03, 124.49, 127.30 (2C), 127.57 (3C: 2 signals overlapped), 127.66, 127.72 (2C), 127.86, 128.27, 128.33 (2C), 128.38 (2C), 128.43 (2C), 131.38, 137.16, 137.22, 137.57, 137.81, 147.45, 148.03, 152.26 ppm. HRMS m/z for C39H37NO3 ([M+H+]+): calcd 568.2852; found 568.2855. 1-Benzyl-5-(benzyloxy)-2-(3,4-bis(benzyloxy)phenyl)-3-methyl-1H-indole (33). Prepared from 5-(benzyloxy)-2-(3,4-bis(benzyloxy)phenyl)-3-methyl-1H-indole (30) (158 mg, 0.3 mmol) and benzyl bromide (54 µl, 0.45 mmol) according to general procedure. Yield: 110 mg (60%); off-white crystals; IR (ATR) ν 1612, 1515, 1480, 1452, 1379, 1258, 1222, 1212, 1172, 1138, 1022, 936, 848, 812, 726 cm-1;1H NMR (400 MHz, DMSO-d6) δ 2.12 (s, 3H, CH3), 5.00 (s, 2H, CH2), 5.13 (s, 2H, CH2), 5.17 (s, 4H, 2 x CH2), 6.80-6.84 (m, 3H, 3 x Ar-H), 6.90 (dd, 1H, J = 2.0, 8.2 Hz, Ar-H), 6.94 (d, 1H, J = 2.0 Hz, Ar-H), 7.13-7.23 (m, 5H, 5 x Ar-H), 7.307.44 (m, 12H, 12 x Ar-H) 7.47-7.51 (m, 4H, 4 x Ar-H) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.36, 46.66, 69.59, 69.75, 69.93, 102.06, 107.59, 111.00, 111.97, 113.90, 116.12, 123.01, 124.01, 125.91 (2C), 126.81, 127.33 (2C), 127.59 (3C: 2 signals overlapped), 127.64 (2C), 127.72, 127.84, 128.34 (2C), 128.39 (6C: multiple signals overlapped), 128.61, 131.60, 39 ACS Paragon Plus Environment

Page 41 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


137.06, 137.12, 137.74, 137.82, 138.75, 147.50, 148.04, 152.58 ppm. HRMS m/z for C43H37NO3 ([M+H+]+): calcd 616.2852; found 616.2850. 2-(3,4-Dimethoxyphenyl)-5-methoxy-3-methyl-1H-indole (37). To the solution of 4-(5hydroxy-3-methyl-1H-indol-2-yl)benzene-1,2-diol (20) (136 mg, 0.6 mmol) in acetone (4 mL) were added Cs2CO3 (1.17 mg, 3.6 mmol) and methyl iodide (187 µl, 3.0 mmol). The mixture was refluxed for 2.5 h, solvent was removed under reduced pressure and the residue was suspended in water (25 mL). The suspension was then extracted with ethyl acetate (2 x 20 mL). Combined organic phases were dried over Na2SO4 and concentrated under reduced pressure. The crude product was purified by column chromatography with dichloromethane/methanol (20:1) as an eluent to yield 37 as yellow crystals. Yield: 86 mg (48%); IR (ATR) ν 3340, 1581, 1513, 1486, 1435, 1264, 1238, 1213, 1174, 1132, 1065, 1022, 933, 857, 827, 796, 766 cm-1;1H NMR (400 MHz, DMSO-d6) δ 2.39 (s, 3H, CH3), 3.79 (s, 3H, O-CH3), 3.82 (s, 3H, O-CH3), 3.86 (s, 3H, O-CH3), 6.73 (dd, 1H, J = 2.0, 8.3 Hz, Ar-H), 6.99 (1H, J = 1.9 Hz, Ar-H), 7.08 (1H, J = 8.4 Hz, Ar-H), 7.16-7.26 (m, 3H, 3 x Ar-H), 10.89 (s, 1H, NH) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.99, 55.29, 55.49, 55.53, 99.94, 105.61, 111.05, 111.20, 111.44, 111.94, 119.80, 125.89, 129.82, 130.74, 134.60, 147.91, 148.71, 153.12 ppm .HRMS m/z for C18H19NO3 ([M+H+]+): calcd 298.1443; found 298.1438. HPLC: Method B, retention time: 26.00 min (96.5% at 254 nm). 2-(3,4-Dimethoxyphenyl)-5-methoxy-1,3-dimethyl-1H-indole (38). 2-(3,4-Dimethoxyphenyl)5-methoxy-3-methyl-1H-indole (37) (59 mg, 0.2 mmol) was dissolved in DMF (3 mL) and cooled to 0 °C. 95% sodium hydride (8 mg, 0.3 mmol) was added and the orange solution was stirred for 30 min at room temperature. Reaction mixture was cooled to 0 °C again and methyl iodide (19 µl, 0.3 mmol) was added. The mixture was stirred for 30 min at room temperature, diluted with water (25 mL) and extracted with ethyl acetate (1 x 25 mL). The organic phase was washed with 10% citric acid (2 x 20 mL), brine (1 x 20 mL) and dried over Na2SO4. The 40 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 42 of 51

solvent was removed under reduced pressure and the crude product was purified by column chromatography with ethyl acetate/hexane (1:3) as an eluent to afford 38 as off-white crystals.Yield: 47 mg (76%); IR (ATR) ν 2916, 1582, 1507, 1484, 1465, 1321, 1222, 1201, 1116, 1135, 1068, 1021, 908, 866, 810, 787, 764 cm-1; 1H NMR (400 MHz, DMSO-d6) δ 2.19 (s, 3H, CH3), 3.57 (s, 3H, N-CH3), 3.80 (s, 3H, O-CH3), 3.81 (s, 3H, O-CH3), 3.84 (s, 3H, OCH3), 6.81 (dd, 1H, J = 2.5, 8.8 Hz, Ar-H), 6.96 (dd, 1H, J = 2.0, 8.1 Hz, Ar-H), 6.99 (d, 1H, J = 1.9 Hz, Ar-H), 7.01 (d, 1H, J = 2.4 Hz, Ar-H), 7.11 (d, 1H, J = 8.2 Hz, Ar-H), 7.33 (d, 1H, J = 8.7 Hz, Ar-H) ppm; 13C NMR (101 MHz, DMSO-d6) δ 9.44, 30.85, 55.36, 55.48, 55.59, 100.18, 106.57, 110.32, 111.07, 111.63, 113.77, 122.76, 123.83, 128.16, 131.99, 137.86, 148.45 (2C: 2 signals overlapped), 153.36 ppm.HRMS m/z for C19H21NO3 ([M+H+]+): calcd 312.1600; found 312.1597. HPLC: Method B, retention time: 22.48 min (95.9% at 254 nm). Transactivation assay. HepG2 cells were seeded in 24-wells plates at density of 5x104 cells/well in Minimum Essential Medium with Earl’s salts containing 10% fetal bovine serum (FBS), 1% L-glutamine and 1% penicillin/streptomycin. The transfection experiments were performed using Fugene HD (Promega, Milan, Italy) according to manufacturer specifications. For PXR mediated transactivation, cells were transfected with 75 ng pSG5hPXRT1, 75 ng pSG5-RXR, 100 ng pCMV-βgalactosidase and with 250 ng of the reporter vector pGL3(henance)PXRE. At 24 h post-transfection, cells were treated for 18 hours with rifaximin (10 µM), s olomonsterol A (10 µM) and compounds 19-29 (10 µM) or with the combination rifaximin (10 µM) plus compounds 19-29 and 34-38 (50 µM). In another experimental setting cells were primed for 18 hours with rifaximin (10 µM) in combination with rising doses of 20 (10, 25 and 50 µM). After treatments 20 µL of cellular lysate were assayed for luciferase activity using the Luciferase Assay System (Promega). Luminescence was measured using GloMax™ 20/20 Luminometer (Promega). Luciferase activities were


Page 43 of 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


normalized for transfection efficiencies by dividing the relative light units by β-galactosidase activity expressed from cells co-transfected with pCMV-βgal. Quantitative Real-time PCR. HepG2 cells were seeded in a 6-well plate at 5x105 cells/well in Minimum Essential Medium with Earl’s salts containing 10% fetal bovine serum (FBS), 1% L-glutamine and 1% penicillin/streptomycin. After growing to approximately 70% confluence, cells were serum starved for 24 hours and then primed with rifaximin (10 µM) or with the combination of rifaximin (10 µM) plus compounds 20 and 24 (50 µM) for 18 hours. Total RNA was isolated with TRIzol Reagent (Invitrogen), incubated with DNase I (Invitrogen) and random reverse-transcribed with Superscript II (Invitrogen) according to manufacturer specifications. For quantitative RT-PCR, 10 ng of template was dissolved in a 20 µL solution containing 200 nM of each primer and 10 µL of KAPA SYBR FAST Universal qPCR Kit (KAPA BIOSYSTEMS). All reactions were performed in triplicate on iCycler instrument (Biorad); the thermal cycling conditions were as follows: 3 min at 95 °C, followed by 40 cycles of 95 °C for 15 s, 58 °C for 20 s and 72 °C for 30 s. The relative mRNA expression was calculated and expressed as 2-(∆∆Ct). PCR primers were designed using the software PRIMER3 (http://frodo.wi.mit.edu/primer3/) using published sequence data obtained from the NCBI database. Primers were as follow: hGAPDH: GAAGGTGAAGGTCGGAGT and CATGGGTGGAATCATATTGGAA; hPXR: AGCTGGAACCATGCTGACTT and CACATACACGGCAGATTTG; hCYP3a4: CAAGACCCCTTTGTGGAAAA and CGAGGCGACTTTCTTTCATC.

Statistical analysis. Computation of IC50 values and statistics were performed using Graph Pad Prism 3 software. All values are expressed as the mean ± SD. Comparisons of more than 2 groups were made with a one-way analysis of variance with post-hoc Tukey tests. Differences were considered statistically significant if p was

Bazedoxifene-Scaffold-Based Mimetics of Solomonsterols A and B as

Recommend Documents