Biodegradable Black Phosphorus Nanosheets Mediate Specific

Jun 8, 2018 - †Department of Gastroenterology, Southwest Hospital, ‡Department of ... and §Department of Oncology, Southwest Hospital, Army Medic...
0 downloads 0 Views 13MB Size
Download PDF
Research Article Cite This: ACS Appl. Mater. Interfaces 2018, 10, 21137−21148

www.acsami.org

Biodegradable Black Phosphorus Nanosheets Mediate Specific Delivery of hTERT siRNA for Synergistic Cancer Therapy Lei Chen,†,⊥ Chuan Chen,∥,⊥ Wei Chen,‡,⊥ Ke Li,‡ Xiaozhen Chen,§ Xudong Tang,† Ganfeng Xie,§ Xi Luo,§ Xiaojiao Wang,§ Houjie Liang,*,§ and Songtao Yu*,§ Department of Gastroenterology, Southwest Hospital, ‡Department of Radiology, Southwest Hospital, and §Department of Oncology, Southwest Hospital, Army Medical University, 30 Gaotanyan Street, Chongqing 400038, People’s Republic of China ∥ Cancer Center, Daping Hospital and Research Institute of Surgery, Army Medical University, Chongqing 400042, People’s Republic of China Downloaded via TUFTS UNIV on July 2, 2018 at 08:31:12 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

†

S Supporting Information *

ABSTRACT: Human telomerase reverse transcriptase (hTERT) has been found to be closely related to tumor transformation, growth, and metastasis. Thus, the delivery of hTERT small interfering RNA (siRNA) is an important approach for cancer gene therapy. However, the single anticancer effect of gene silencing is often limited by poor specificity or low efficiency in siRNA delivery and release. In this work, we present small and thin black phosphorus (BP) nanosheets as a biodegradable delivery system for hTERT siRNA. The BP nanosheets prepared with poly(ethylene glycol) (PEG) and polyethylenimine (PEI) modification (PPBP), exhibited high siRNA loading capacity and robust cell uptake. The PPBP nanosheets also exhibited potent photodynamic therapy/photothermal therapy (PDT/ PTT) activities when exposed to different wavelengths of laser irradiation. More importantly, PPBP nanosheets underwent a gradual degradation when presented in a mixture of low pH and reactive oxygen species (ROS)-rich environment. The degradation of PPBP was strengthened especially after local and minimal invasive PDT treatment, because of excessive ROS production. Further delivery and release of siRNA to the cytoplasm for gene silencing was achieved by PEI-aided escape from the acidic lysosome. Thus, PPBP-siRNA efficiently inhibited tumor growth and metastasis by specific delivery of hTERT siRNA and a synergistic combination of targeted gene therapy, PTT and PDT. KEYWORDS: black phosphorus, phototherapy, gene therapy, telomerase, siRNA delivery rapid biodegradation.13 Furthermore, due to the high heterogenicity of different cancers, anticancer efficacy must be enhanced by combining multimodal therapeutic strategies, such as gene therapy, chemotherapy, and phototherapy.14−16 This combination also decreases the risk of drug resistance and cancer recurrence. Thus, the development of new siRNA delivery systems to enhance therapeutic benefits and decrease adverse side effects remains an important issue in cancer treatment. In the past decade, monolayer and few-layered twodimensional (2D) nanomaterials with various distinct chemical and physical properties, such as graphene,17 hexagonal boron nitride (h-BN),18 WS2,19 and MoS2,20 have been utilized to construct drug delivery platforms that have shown outstanding performance in cancer imaging and therapy.21,22 Among the large family of 2D nanomaterials, black phosphorus (BP) has a very high surface to volume ratio due to its puckered lattice configuration.23,24 For instance, Guo and co-workers have introduced BP nanosheets that can hold higher amounts of

1. INTRODUCTION Cancer undoubtedly remains one of the most serious human diseases, forcing researchers to continuously explore new anticancer agents with high efficiency and specificity. Telomerase is a key enzyme in stabilizing chromosomes.1,2 The abnormal activation of telomerase, detected in the majority of malignant tumors but not in most normal somatic cells, is considered critical for cell immortalization.3,4 Human telomerase reverse transcriptase (hTERT), being an essential component of human telomerase, is excessively activated and overexpressed in various cancer cells. It has been found to be closely related to tumor transformation, growth, and metastasis.5 Therefore, the knockdown of hTERT expression represents an attractive approach to cancer-targeted therapy.6−8 Gene silencing using small interfering RNA (siRNA) is a widely known method that can specifically silence the expression of oncogenic regulators. The delivery of hTERT siRNA to cancer cells has also been explored and proved to efficiently suppress the growth of cancer.9,10 However, successful delivery of siRNA to target cells is often challenged by low efficiency of cell uptake or poor specificity of siRNA release into the cytoplasm.11,12 Additionally, many nanoplatform-based siRNA carriers face difficulty in achieving safe and © 2018 American Chemical Society

Received: March 25, 2018 Accepted: June 8, 2018 Published: June 8, 2018 21137

DOI: 10.1021/acsami.8b04807 ACS Appl. Mater. Interfaces 2018, 10, 21137−21148

Research Article

ACS Applied Materials & Interfaces

to the previously published procedure.39 Typically, BP crystal powder (50 mg) was added to deionized (DI) water (100 mL). Then, exfoliation process for BP nanosheets was performed in a sealed conical tube in an ice water bath and continuously sonicated under vacuum for 20 h (amplifier: 30%, on/off cycle: 60/30 s). The constant cold ice bath was realized by keeping it in a circulating low temperature flume (EYELA NCB-3200, Japan). Then, centrifugation at 2000 rpm was performed for 10 min to remove unexfoliated bulk BP. The resulting dispersion was filtrated through a 0.22 μm filter and concentrated by centrifuge filtration through centrifugal filters (30 kDa, Millipore) at 8000 rpm for 10 min to obtain BP nanosheets. 2.3. Preparation of PPBP Nanosheets. Briefly, NH2-PEG (10 mg) was mixed with the as-prepared ultrathin BP nanosheets in aqueous solution (2.5 mg mL−1) under continuous stirring. The pH value was adjusted to approximately 8.0 with ammonia aqueous solution (0.1 × 10−3 M, 25%). The reaction mixture was shaken for 6 h at room temperature, and then PEGylated BP nanosheets were obtained by centrifugation. Next, the as-prepared PEGylated BP nanosheets were dissolved in phosphate-buffered saline (PBS) (pH 7.4, 0.5 mg mL−1, 5 mL), and added with PEI (1.0 mg mL−1, 1.0 mL), according to the previously reported methods.29,39 After another 6 h of vigorous stirring, the mixture was initially purified with a dialysis bag in distilled water for 24 h (10 kDa). Then, the residue in the dialysis bag was further subjected to centrifuge filtration (4500 rpm for 15 min) to obtain both PEG and PEI dual-functionalized PPBP nanosheets. 2.4. Preparation of PPBP-siRNA Nanosheets. For siRNA loading, PPBP nanosheets were dissolved in RNase-free ultrapure DI water at a final concentration of 1 mg mL−1. Then, different volumes of PPBP in aqueous solution were added to Tris−HCl buffer (1 mM, pH 7.4) containing siRNA at 0.5 mg mL−1. After 5 h of stirring, the reaction mixture was purified by centrifuge filtration (4500 rpm for 10 min). The precipitate was rinsed and resuspended in DI water. Electrophoresis (100 V, 15 min) was performed on a 1% agarose gel.30 The PPBP-siRNA nanosheets in the gel were stained with ethidium bromide and visualized under a UV illuminator. The loading efficiency of siRNA was calculated according to the previously reported method.10 Briefly, the reaction mixture was firstly centrifuged (8000 rpm, 20 min) at 4 °C to completely precipitate BP nanosheets. Then, the concentration of nonloaded siRNA in the suspension was determined. Finally, the loading efficiency was calculated based on the total siRNA concentration and nonloaded siRNA concentration. 2.5. Characterization. The morphology and size of BP nanosheets were determined by both atomic force microscopy (AFM) and transmission electron microscopy (TEM). Dynamic light scattering (DLS) and ζ potential of PEG- and PEI-functionalized BP (PPBP) nanosheets were analyzed using a Brookhaven Zeta PALS analyzer. Fourier transform infrared (FT-IR) analysis (NICOLET6700) was performed to verify PEG and PEI chemical groups on the BP nanosheets. X-ray photoelectron spectroscopy (XPS) was performed using a Scientific Escalab 250 (Thermo, U.K.) with a multipurpose surface analysis system. Element mapping images were obtained using an electron microscope (FESEM, Ultra55, Zeiss, Germany) by field-emission scanning. Absorption spectra were recorded using an UV−vis−near-infrared (NIR) spectrometer (Shimadzu, UV-3600, Japan). Fluorescence spectra were recorded using an NIR fluorescence spectrometer (Thermo Fisher). 2.6. Degradation of PPBP in Acidic and H2O2 Environments. The degradation of PPBP-siRNA in PBS (pH 7.4, pH 5.0) or 100 μM H2O2 was evaluated. During 72 h of observation, all samples were stored in sealed tubes and under dark conditions. AFM tests were performed to detect the size of the PPBP-siRNA. The photodynamic and photothermal effects of PPBP-siRNA in aqueous solution were evaluated separately under 660 nm (200 mW cm−2, 5 min) or 808 nm (1 W cm−2, 5 min) NIR laser irradiation. The stability of PPBPsiRNA after laser irradiation was examined and compared using AFM images. 2.7. Determination of Phosphorus Content. To determine the content of phosphorus, the Malachite Green Phosphate Assay kit was used (BioAssay Systems, CA). Briefly, the PPBP suspension before or

doxorubicin on the sheet surface (950% in weight) than any previously reported 2D material system.25 Before this report, Xie and co-workers reported that ultrathin BP nanosheets could efficiently cause massive singlet oxygen generation and be applied as potential photodynamic therapy (PDT) photosensitizers.26 Meanwhile, ultrasmall BP quantum dots,27 nanospheres,28 including the recently reported nanosheets,29 have also been demonstrated to show high extinction coefficients and photothermal conversion efficiency, offering promise for the photothermal therapy (PTT) of cancer. Recently, a few of BP-based nanomaterials as the siRNA delivery system have been reported, which showed a synergistic effect of photothermal and gene therapy.30,31 Therefore, BP has begun to attract great research interest for biomedical applications in the recent years.32 However, a fundamental challenge hampering the practical use of the monolayer or few-layered BP is its vulnerability to ambient degradation.33,34 Although the mechanism of this degradation remains unclear and is an important subject of investigation, recent studies showed that BP nanomaterials were unstable in the presence of oxygen and light,35 particularly UV light.36,37 Vipul Bansal et al. employed imidazolium-based ionic liquids (ILs), which allowed BP to remain stable for over 13 weeks.38 The improved stability is ascribed to ILs as effective quenchers of reactive oxygen species (ROS) on the BP surface. These findings indicate that ROS are among the key factors in the rapid degradation of BP. On the basis of all the previous findings mentioned above, in this study, we present small and thin BP nanosheets with poly(ethylene glycol) (PEG) and polyethylenimine (PEI) modification (PPBP) as a new delivery system for hTERT siRNA. PPBP nanosheets show high siRNA loading capacity and cellular uptake. They also exhibit high photothermal and photodynamic effects under light irradiation with different wavelengths. More importantly, the targeted delivery and release of siRNA into the cancer cell cytoplasm could be realized by the specific degradation of PPBP, which is triggered by the acidic lysosome and photoinduced in situ ROS generation. As expected, the siRNA-loaded PPBP (PPBPsiRNA) displays dramatically enhanced suppression of both tumor growth and metastasis in the mouse model, benefiting from the specific delivery of hTERT siRNA and synergistic combination of targeted gene therapy, PTT and PDT.

2. MATERIALS AND METHODS 2.1. Reagents and Materials. Amine poly(ethylene glycol) (NH2-PEG-COOH, 5 kDa), branched polyethylenimine (PEI, 1.8 kDa), amiloride, chlorpromazine, and nystatin were purchased from Sigma-Aldrich (St. Louis). Black phosphorous (BP) crystal powder was obtained from Nanjing XFNANO materials (Nanjing, China). The calcein-AM kit and cell counting kit-8 (CCK-8) were purchased from Dojindo (Kumamoto, Japan). The Annexin V-FITC apoptosis detection kit was purchased from BD Biosciences (New Jersey). LysoTracker Green and Singlet Oxygen Sensor Green (SOSG) were purchased from Invitrogen Corp. (Carlsbad). 2′,7′-Dichlorodihydrofluorescein diacetate (DCFH-DA), propidium iodide (PI), and Hoechst 33358 were purchased from the Beyotime Institute of Biotechnology (Shanghai, China). Free siRNA and Cy7-labeled siRNA targeting hTERT (sense sequence, 5′-GAGCCAGUCUCACCUUCAAdTdT-3′) were obtained from GenPharm (Shanghai, China).10 Dulbecco’s modified Eagle’s medium was purchased from HyClone (Beijing, China). Dialysis bags and ultrafiltration tubes were purchased from Millipore (MA). 2.2. Preparation of BP Nanosheets. A modified liquid exfoliating method was employed to obtain BP nanosheets according 21138

DOI: 10.1021/acsami.8b04807 ACS Appl. Mater. Interfaces 2018, 10, 21137−21148

Research Article

ACS Applied Materials & Interfaces after different treatments was filtered by centrifuge filtration (10 kDa) and mixed with malachite green buffers for 20 min. According to the instructions of the manufacturer, optical density at 650 nm was determined using a UV−vis−NIR spectrometer and a standard curve was obtained. To determine the total content of phosphorus as the reference, PPBP suspension without filtration was straightly mixed with malachite green buffers (containing 0.4 M sulfuric acid) for 20 min. 2.8. Singlet Oxygen Detection. SOSG was used to detect singlet oxygen generation from PPBP nanosheets. Briefly, 1 μL of SOSG (10 μM) was added to 5−15 μg mL−1 PPBP nanosheets in ultrapure water (4 mL). Then, the mixture was irradiated for 5 min respectively with a 660 nm (200 mW cm−2) or 808 nm (1 W cm−2) laser. Fluorescence spectra in a range of 500−600 nm were determined immediately using an NIR fluorescence spectrometer (excitation wavelength: 494 nm). The heat production was monitored in real-time by imaging with an infrared thermal camera (Fluke, Ti32). 2.9. Cell Culture and Cellular Uptake. Human cervical squamous carcinoma (HeLa) and lung cancer (A549) cells were purchased from the American Type Culture Collection. The cells were cultured and incubated using RPMI 1640 medium in a 5% CO2 incubator at 37 °C. For quantitative comparison of cellular uptake, HeLa cells were seeded in 6-well dishes and incubated with PPBPsiRNA or free Cy7-siRNA for 4−24 h. Finally, the cells were rinsed and analyzed by flow cytometry. 2.10. Cellular Entry Mechanism and Subcellular Localization. Briefly, the cells at 4 °C were incubated with 10 μg mL−1 of PPBP-siRNA for 4 h to reveal the cellular uptake of PPBP-siRNA by flow cytometry and confocal microscopy. The cells were preincubated with different inhibitors (10 mg mL−1 chlorpromazine, 2 mg mL−1 amiloride, or 20 mg mL−1 nystatin) at 37 °C for 30 min, and then incubated with 10 μg mL−1 of PPBP-siRNA for another 4 h. Afterwards, the cells were trypsinized, centrifuged, resuspended, and analyzed by Image J Software of the Leica TCS SP5 confocal scanning system. To monitor the subcellular localization of PPBP-siRNA nanosheets in real-time, HeLa cells were incubated with PPBP-siRNA nanosheets (10 μg mL−1) for 4 h or 24 h. Then, different groups of cells were rinsed with PBS and stained with LysoTracker (diluted 1:6000 with Dulbecco’s modified Eagle’s medium culture media) for 20 min. Finally, the cells were rinsed with PBS and imaged by confocal microscopy. 2.11. Cell Viability Test. Cell viability was measured using the CCK-8 assay. First, 5 × 103 cells were seeded in a 96-well plate and incubated overnight with different concentrations of PPBP-siRNA. After being washed with PBS, the cells were irradiated with a 660 nm (200 mW cm−2, 5 min) or 808 nm (1 W cm−2, 5 min) laser, respectively. The cell viability was measured 48 h post laser irradiation. CCK-8 in PBS (v/v, 1:10) was added, and the cells were incubated at 37 °C for 2 h with 5% CO2. The absorbance at 450 nm was determined and the cell viability was calculated by normalizing average absorbance of the sample wells (n = 5) against that of the control wells (without any treatment). 2.12. RNA Isolation and Quantitative Reverse Transcription Polymerase Chain Reaction (RT PCR). The total RNA was extracted using a TRIzol reagent (Invitrogen) from HeLa cells 48 h after transfection. The amount of RNA was determined using a spectrophotometer (Nano-Drop ND-2000). Real-time RT PCR was performed using SuperScript IV Reverse Transcriptase (Thermo Scientific). Total RNA (1 μg) was reverse-transcribed in a 50 μL reaction mixture and subjected to real-time PCR for hTERT and GAPDH amplification. The hTERT forward primer was TGTACTTTGTCAAGG TGGATGTG and the reverse primer was GTACGGCTGGAGGTCTGTCAA, with an annealing temperature of 53 °C. GAPDH was amplified using the forward primer CGGAGTCAACGGATTTGGTCGTAT and the reverse primer TGCTAAGCAGTTGGT GGTGCAGGA. 2.13. Western Blot Analysis. HeLa cells were seeded in 6-well plates and collected after different treatments (48 h post laser irradiation). The cells were washed twice with cold PBS and lysed in

100 mL lysis buffer (50 mM Tris−HCl pH 6.8, 2% sodium dodecyl sulfate (SDS), 1% β-mercaptoethanol, 6% glycerol, 0.004% bromophenol blue) on ice for 30 min. The cell lysates were centrifuged at 4 °C (10 000 rpm, 5 min). The concentration of the total protein was determined using a spectrophotometer (Nano-Drop ND-2000, Thermo Scientific). For the detection of hTERT protein expression, the hTERT protein was analyzed using 10% SDSpolyacrylamide gel electrophoresis. As the loading control, a β-actin protein was also analyzed. The proteins were transferred to a nitrocellulose membrane at 300 mA for 90 min and blocked at 4 °C overnight using bovine serum albumin. The membrane was incubated overnight with a rabbit anti-hTERT primary polyclonal antibody (Epitomics) at 4 °C. Then, secondary antibody was incubated for another 2 h using donkey anti-rabbit HRP-conjugated IgG (Abcam, Cambridge, 1:1000 dilution). For the detection of Hsp70 expression, primary antibodies (Abcam, 1:1000 dilution) were incubated overnight at 4 °C, followed by the incubation of secondary antibody. Finally, the membranes were washed, and the protein bands were visualized using an enhanced chemiluminescent substrate (Abcam) according to the manufacturer’s instructions. 2.14. Tumor Xenografts and Lung Metastasis Model. BALB/ c nude mice (aged 5−6 weeks, weighted 20−25 g) were purchased from the Laboratory Animal Center of Army Medical University. The experimental protocol was approved by the Animal Care and Use Committee of Army Medical University. For HeLa tumor xenografts, 1 × 107 HeLa cancer cells suspended in 100 μL of PBS were subcutaneously implanted into the right flanks of nude mice. For the tumor lung metastasis model, 1 × 107 A549 cells in 100 μL of PBS were injected into nude mice via tail vein. The tumor lung metastasis model was established 42 days after intravenous injection of A549 cells. The lungs from the two groups were collected, and tumor nodules were counted under a dissecting microscope. The excised lung tissues or tumor nodules were fixed in 4% formaldehyde. After being embedded with paraffin, 5 μm tumor sections were subjected to hematoxylin/eosin (H&E) staining or hTERT immunohistochemical staining. 2.15. In Vivo Tumor Targeting and Imaging. After HeLa tumor xenografts were established, 1 mg kg−1 PPBP-siRNA was injected intravenously into mice for tumor-targeted NIR imaging, which was performed after 24 h using an In Vivo FX Professional Imaging System. After sacrifice, the major organs and tumors from the mice were dissected to further confirm the preferential accumulation of PPBP-siRNA in the tumors by ex vivo NIR fluorescence imaging. In addition, thermal imaging of the mice during laser irradiation was performed to evaluate tumor targeting and photothermal activity of PPBP-siRNA. Twenty-four hours after the injection of PPBP-siRNA, the tumors were exposed to 808 nm NIR laser irradiation (0.5 W cm−2) for 5 min. During 5 min of NIR light irradiation, the real-time temperature of mice was recorded. Before irradiation, the mice were anesthetized using 1% pentobarbital sodium before NIR fluorescence or thermal imaging. 2.16. In Vivo Tumor Growth Inhibition. Subcutaneous HeLa tumor xenograft models were established with female BALB/c nude mice and randomly divided into five groups: the saline nonirradiation group, PPBP-siRNA nonirradiation group, PPBP-siRNA plus 660 nm, PPBP-siRNA plus 808 nm, and PPBP-siRNA plus 660 vs 808 nm. The mice in the saline group were intravenously given 200 μL of blank saline. The mice in the drug groups were intravenously injected with 1 mg kg−1 PPBP-siRNA diluted in 200 μL of saline every 2 days. Twenty-four hours after the fourth injection, the tumors in the irradiation groups were exposed to 0.5 W cm−2 of 808 or 660 nm NIR laser light respectively for 5 min. Tumor volumes and body weights were recorded during the treatments. 2.17. Metastasis Inhibition Study. Ten 6 week-old female BALB/c nude mice were divided into two groups: five mice were injected with 0.5 mg kg−1 of PPBP-siRNA every 2 days until sacrifice, and another five mice were not given any treatment (n = 5) and were used as the untreated control group. After the second injection of PPBP-siRNA, each mouse was intravenously injected with 1 × 107 A549 cells. After 42 days, tumor lung metastasis was examined by 21139

DOI: 10.1021/acsami.8b04807 ACS Appl. Mater. Interfaces 2018, 10, 21137−21148

Research Article

ACS Applied Materials & Interfaces

Figure 1. (a) Schematic illustration of the preparation of a BP nanosheet-based platform for siRNA delivery. (b) AFM image, (c) TEM image, and (d) XPS analysis of naked BP nanosheets. (e) FT-IR spectra of BP, PEG, PEI, and PPBP nanosheets. (f) DLS results and (g) ζ potentials of BP, PBP, PPBP, and PPBP-siRNA nanosheets (n = 3). both in vivo and ex vivo NIR fluorescence imaging of the mice, 24 h after being injected with Cy7-labeled PPBP-siRNA. Lung metastasis inhibition was evaluated by counting the metastasis nodes under a dissecting microscope. Metastasis nodules and frozen lung sections were further examined by H&E staining and immunohistochemical staining of hTERT. 2.18. H&E Staining, TdT-Mediated dUTP Nick-End Labeling (TUNEL) Analysis. After 18 days of laser irradiation treatment, the mice were scarified and the tumor from different groups were collected and fixed for 24 h in 4% paraformaldehyde. Then, the tumor slices were stained with H&E or TdT-mediated dUTP nick-end labeling (TUNEL, Roche, Switzerland) that is used to label apoptotic tumor cells. TUNEL-positive cells in the tumor slices were shown in brown by imaging with a Nikon TE2000 microscope (Tokyo Prefecture, Japan).

The size and morphology of the newly developed BP nanosheets were examined by atomic force microscopy (AFM, Figure 1b) and transmission electron microscopy (TEM, Figure 1c). Both AFM and TEM images show free-standing BP nanosheets with an average lateral size of approximately 20 nm. The average thickness of PPBP was determined by AFM to be 3−4 nm. The characteristic peaks of PPBP shown by X-ray photoelectron spectroscopy (XPS, Figure 1d) were almost the same as for the bulk BP, such as the characteristic 2p1/2 and 2p3/2 doublets at 130.3 and 129.6 eV. According to previous reports,40 the subband at 133.5 eV is probably a characteristic peak of oxidized phosphorus (such as PxOy). Then, the positively charged poly(ethylene glycol)-amine (5 kDa) was electrostatically bound to the naked BP nanosheets to improve their biocompatibility and physiological stability.29 The PEGylated BP (PBP) nanosheets were then subjected to electrostatic adsorption of branched PEI (1.8 kDa) to prepare PEG and PEI dual-functionalized BP (PPBP). Notably, naked BP nanosheets were found to be unstable and subjected to aggregation (Figure S1, Supporting Information), when they were directly functionalized with PEI without PEGylation. In contrast, PPBP was stable and well dispersed or redispersed in

3. RESULTS AND DISCUSSION 3.1. Synthesis and Characterization of PPBP and PPBP-siRNA. The synthesis of PPBP and PPBP-siRNA is schematically illustrated in Figure 1a. Briefly, small and thin BP nanosheets were synthesized from bulk BP by a modified mechanical exfoliation method.29 21140

DOI: 10.1021/acsami.8b04807 ACS Appl. Mater. Interfaces 2018, 10, 21137−21148

Research Article

ACS Applied Materials & Interfaces

Figure 2. AFM images of PPBP to examine the stability after 72 h in (a) PBS (pH 7.4), (b) pH 5.0, (c) 100 μM H2O2, and (d) pH 5.0 plus 100 μM H2O2. (e) DLS tests of PPBP after different treatments (n = 3, *p < 0.05, **p < 0.01). (f) The phosphorus content was determined after centrifuge filtration of PPBP aqueous solution (n = 3, **p < 0.01). (g) Photothermal effect of PPBP (10−40 μg mL−1) after 808 nm laser irradiation (1 W cm−2, 5 min). (h) Photodynamic effect of PPBP after 660 nm laser irradiation (200 mW cm−2, 5 min). Ultrapure water was used as the control. (i) Sizes of PPBP in the PBS or PBS containing 10% fetal bovine serum was tested by DLS within 24 h of observation.

aqueous solution throughout the process of reaction and centrifugation. These results demonstrate that PEG modification is essential for BP stability and PEI functionalization. The successful conjugation of PEG and PEI on BP nanosheets was demonstrated by Fourier transform infrared (FT-IR) spectroscopy. PPBP exhibited characteristic peaks of PEG at approximately 3400 and 2900 cm−1 and characteristic peaks of PEI at approximately 2800 and 1500 cm−1 (Figure 1e). Energy dispersive X-ray spectroscopy mapping of PPBP elements, showed the co-localization of different elements (P element from BP, O, and N elements from the surface coating PEG and PEI) for PPBP (Figure S2, Supporting Information). Characterization of PEI successful conjugation was further confirmed by adding Cu2+, which can efficiently chelate with PEI and exhibit blue color with 630 nm absorption spectrum (Figure S3, Supporting Information). After structure characterization, hTERT siRNA was loaded onto PPBP to prepare PPBP-siRNA in DEPC water. The optimized ratio between hTERT siRNA and PPBP was studied by gel retardation quantitative analysis and found to be 1:12 (Figure S4, Supporting Information). The siRNA loading efficiency was calculated based on the concentration of nonloaded siRNA and was found to be above 96%, revealing a high siRNA loading capacity of PPBP. The size distribution

determined by dynamic light scattering (DLS) revealed that the average diameters of the naked BP, PBP, PPBP, and PPBPsiRNA were about 34, 51, 55, and 60 nm, respectively (Figures 1f and S5 in the Supporting Information). The ζ potential values of the naked BP, PBP, PPBP, and PPBP-siRNA were −27.64, −18.66, 19.52, and 10.43 mV, respectively (Figure 1g), further verifying the successful PEG/PEI modification and efficient siRNA loading. 3.2. Stability and Degradation of PPBP. The stability of PPBP was evaluated under different conditions. After 72 h in phosphate buffered solution with pH 7.4 (PBS, Figure 2a) or in PBS with pH 5.0 (Figure 2b), AFM images of PPBP showed a slight decrease in the average size in the acidic environment. AFM images of PPBP after treatment with 100 μM hydrogen peroxide (H2O2, a major type of ROS) for 72 h showed a moderate decrease in size (Figure 2c). More interestingly, the size of PPBP decreased dramatically after treatment with both PBS (pH 5.0) and 100 μM H2O2 (Figure 2d). Similar results were also demonstrated by DLS tests (Figure 2e). After different treatments, PPBP aqueous solution was filtered by centrifuge filtration (10 kDa). The phosphorus content in the filtrate was determined using the Malachite Green Phosphate Assay kit.41 The results further verified that PPBP after treatment with a mixture of PBS (pH 5.0) and 100 μM H2O2 21141

DOI: 10.1021/acsami.8b04807 ACS Appl. Mater. Interfaces 2018, 10, 21137−21148

Research Article

ACS Applied Materials & Interfaces

nm) after UV irradiation for 5 min. Our result is consistent with the previous reports,37 indicating that PPBP degradation is mainly induced by ROS. Compared to UV light irradiation, however, the slower degradation of PPBP under 660 nm would be useful for the controlled release of siRNA loaded on BP sheets. Because phototherapy is performed by irradiating directly on solid tumors in a target and in a local manner, photoinduced degradation of PPBP would be achieved more specifically. The degree of degradation would be strengthened if PPBP is taken up by greedy cancer cells and initially accumulates at acidic and ROS-rich lysosomes. The kinetic profiles of the siRNA release triggered by pH, H2O2, or NIR irradiation with different wavelengths were determined (Figure S9). The results showed that siRNA was released efficiently only after the treatment with a mixture of PBS (pH 5.0) and 100 μM H2O2, and especially enhanced significantly after being exposed to 660 nm irradiation. 3.3. Cellular Uptake and Lysosome Escape of PPBPsiRNA. To investigate the cellular uptake, Cy7-labeled free siRNA and PPBP-siRNA were prepared and examined initially by flow cytometry analysis (Figure 4a). The results showed that the cellular uptake of PPBP-siRNA increased significantly with incubation time, whereas the free siRNA hardly entered the cells even after 24 h of incubation (Figure 4b,c). The significant difference in the cellular uptake between the free siRNA and PPBP-siRNA was also verified by fluorescence confocal microscopy. Cy7-labeled (red) hTERT siRNA was used to track free siRNA or PPBP nanosheets 4 h after incubation in HeLa cells. The results showed that the cellular uptake of PPBP-siRNA was more robust than free siRNA (Figure 4d), indicating high cell penetration and efficient uptake of hTERT siRNA mediated by PPBP. The subcellular localization of PPBP-siRNA was determined by co-staining with a lysosome probe (LysoTracker Green). After 4 h of incubation, fluorescence confocal microscopy images showed that the red fluorescence from PPBP-siRNA overlapped the green fluorescence from the lysosome probe (Figure 4d), suggesting that PPBP-siRNA is located in endosomes or early lysosomes. We then investigated whether Cy7-siRNA loaded in PPBP-siRNA could escape from the endosome/lysosome after extended incubation, because subsequent posttranscriptional gene silencing needs to occur in the cytoplasm. The results showed that the two fluorescent signals were obviously separated when the incubation time was extended to 24 h, indicating that PPBP-siRNA could efficiently escape from lysosomal vesicles. The mechanism of lysosomal escape is considered due to acid sensitivity of PEI-functionalized BP nanosheets.42,43 The protonation of amino groups of PPBPsiRNA in the acidic environment of the endosome disturbed electrostatic adsorption between PEG-NH2 and BP, possibly leading to the dissociation of siRNA from the BP nanosheets. Moreover, PPBP could gradually degrade at acidic pH combined with abounding ROS in cancer cells to generate phosphate ions and strengthen the acidity of the environment. The degradation products in turn increased the osmotic pressure and endosome swelling, facilitating siRNA release from endosomes to the cytoplasm.10,44 The cellular uptake mechanism was studied by different interventions (Figure S10, Supporting Information). The incubation of cells at 4 °C showed a significantly decreased fluorescence intensity, suggesting the cellular uptake of PPBPsiRNA via an energy-dependent process. Studies on different endocytosis mechanisms were further investigated by pretreat-

was subjected to degradation significantly (Figure 2f, about 70%). In contrast, PPBP and PPBP-siRNA showed better stability in the PBS or PBS containing 10% fetal bovine serum (Figures 2i and S6 in the Supporting Information). These results indicated that BP nanosheets might have the potential of specific degradation in acidic lysosomes and high-ROS tumor microenvironment. The final degradation products of PPBP are nontoxic phosphate and phosphonate, both of which are commonly found in the human body.28 The photothermal and photodynamic effects of PPBP were evaluated under 808 and 660 nm laser irradiation, respectively. PPBP nanosheets caused hyperthermia and increased aqueous solution temperature from 25.0 to 42.8 °C after 808 nm laser irradiation for 5 min (Figure 2g). PPBP also produced singlet oxygen (1O2) remarkably, which increased gradually with the increasing BP concentration (Figure 2h). These results show the potential of PPBP as a photosensitizer for both PTT and PDT applications. Changes in size, 24 h after laser irradiation of PPBP, were also examined by AFM images (Figure 3a,b)

Figure 3. Representative AFM images of PPBP after being exposed to (a) 808 nm laser light irradiation (1 W cm−2, 5 min), (b) 660 nm (200 mW cm−2, 5 min). (c) DLS tests of PPBP after laser irradiation with different laser light wavelengths. (d) The phosphorus content was determined after laser light irradiation and centrifuge filtration. n = 3, **p < 0.01. The results demonstrate that the degradation of PPBP was accelerated especially after treatment with 660 nm laser irradiation.

and DLS tests (Figure 3c) for photostability study. Both AFM images and DLS tests of PPBP showed that PPBP suffered more severe structural degradation under 660 nm irradiation than that under 808 nm irradiation. The same trend of size change in PPBP-siRNA plus 660 nm irradiation was also found based on DLS results (Figure S7). After light irradiation and centrifuge filtration of PPBP, the phosphorus content in the residual solution was determined and further demonstrated that over half of PPBP degraded after being exposed to 660 nm light irradiation (Figure 3d). PBPP degradation under UV light irradiation was also evaluated. According to AFM (Figure S8), the size of PBPP decreased significantly (from ∼55 to ∼10 21142

DOI: 10.1021/acsami.8b04807 ACS Appl. Mater. Interfaces 2018, 10, 21137−21148

Research Article

ACS Applied Materials & Interfaces

Figure 4. Flow cytometry analysis of cell uptake at different times after being incubated with Cy7-labeled (a) free siRNA, or (b) PPBP-siRNA. (c) Quantification of cell internalization of free siRNA or PPBP-siRNA by mean fluorescence intensity (MFI). (d) Fluorescence confocal microscopy images of cells for investigation of cellular uptake, subcellular localization, and endosome escape. Cy7-labeled free siRNA or PPBP-siRNA was stained red, and endosomes/lysosomes were stained with LysoTracker (Green). Scale bar: 25 μm.

However, PPBP-siRNA irradiated initially at 660 nm and subsequently at 808 nm exhibited the lower anticancer activity than that in the 808 vs 660 nm group. Despite the fact that its PTT effect was influenced after PDT treatment, the results further support our design for ROS-induced PPBP degradation and synergistically enhanced combination therapy if we perform the treatment according to a specific order. Third, the synergistic anticancer effect was further confirmed by co-staining of HeLa cells with calcein-AM and propidium iodide (PI) after different treatments (Figure 5b). The red fluorescence from PI and the green fluorescence from calceinAM represent dead and live cells, respectively. PPBP-siRNA subjected to laser irradiation at 808 nm followed by 660 nm exhibited nearly no live cells. Increasing degrees of dead cells were observed in the PPBP-siRNA, PPBP-siRNA (808 nm only), and PPBP-siRNA (660 nm only) groups, compared with the PBS irradiation control group (Figure S12a, Supporting Information). Fourth, the apoptosis rates in different groups, 24 h after light irradiation, were evaluated by flow cytometry using Annexin V-Fluor 488. The results showed a trend similar to the tests described above (Figure 5c), that is, PPBP-siRNA treated with both 808 and 660 nm irradiation induced the highest apoptotic ratio, exceeding that of other irradiation groups and the PBS irradiation control group (Figure S12b, Supporting Information).

ment with various endocytotic inhibitors. The results showed that a sharp reduction in the cellular uptake of PPBP-siRNA was observed after preincubation of amiloride, whereas a moderate reduction was observed after the preincubation of chlorpromazine and nystatin respectively. These results suggest that macropinocytosis may be the major route for the internalization of PPBP-siRNA, but both clathrin and caveolae associated pathways also participate in endocytosis.45 3.4. Synergistic Effects of PPBP-siRNA in Vitro. The synergistic PDT, PTT, and gene silencing effects of PPBPsiRNA were verified in vitro on HeLa cells. First, the cytotoxicity of PPBP was examined by the CCK-8 assay after 48 h of incubation. The nonsiRNA-loaded PPBP exhibited good safety even at 50 μg mL−1 BP (Figure S11, Supporting Information). Second, the cell viability was evaluated after exposure to PPBP-siRNA, PPBP-siRNA (808 nm), PPBPsiRNA (660 nm), PPBP-siRNA (808 and 660 nm), or PPBPsiRNA (660 and 808 nm) at varying PPBP concentrations (10−40 μg mL−1). PPBP-siRNA without laser irradiation showed slight inhibition of cell growth (Figure 5a). As expected, PPBP-siRNA plus 808 or 660 nm laser irradiation exhibited much higher cytotoxicity than the PPBP-siRNA group without irradiation. More impressively, PPBP-siRNA irradiated initially at 808 nm and subsequently at 660 nm exhibited the highest anticancer activity in all the groups. 21143

DOI: 10.1021/acsami.8b04807 ACS Appl. Mater. Interfaces 2018, 10, 21137−21148

Research Article

ACS Applied Materials & Interfaces

Figure 5. (a) Relative viability of HeLa cells, 48 h after treatment with different concentrations of PPBP-siRNA with or without laser irradiation (660 nm, 200 mW cm−2; 808 nm, 1 W cm−2). (b) Confocal fluorescence images of calcein-AM/PI co-stained HeLa cells after different treatments. (c) Induction of cell apoptosis, 24 h after different treatments. The lower and upper right quadrants represent the percentages of early and late apoptotic cells among every 10 000 cells, respectively. (d) Expression of hTERT and Hsp70 proteins in HeLa cells tested by western blot, 48 h after different treatments. (c) Blank control without irradiation; 1, 2, 3, and 4 represent treatment with PPBP-siRNA at concentrations of 5, 10, 20, and 30 μg mL−1 respectively, followed by 808 and 660 nm irradiation. Changes in hTERT and Hsp70 protein expression indicate the anticancer effects of PPBP-siRNA through gene silencing and PTT, respectively. (e) Fluorescence confocal microscopy images of HeLa cells, 4 h after 808 or 660 nm laser irradiation and immediate staining with an ROS probe (DCFH solution). The results verified the PDT effect of PPBP-siRNA induced by 660 nm.

observed after 808 nm irradiation (Figure 5e). More impressively, it seems that many apoptosis bodies were induced in the PPBP-siRNA plus 660 nm irradiation group. 3.5. Tumor Targeting and Synergistic Therapeutic Effects of PPBP-siRNA in Vivo. Biodistribution of PPBPsiRNA was investigated in a tumor-bearing animal model. Mice were injected with 1 mg kg−1 of Cy7-labeled PPBP-siRNA or free Cy7-siRNA. In vivo NIR fluorescence imaging revealed an increase in fluorescence intensity in the tumor 24 h after administration of PPBP-siRNA (Figure 6a). In addition, the main organs and tumors were harvested, and ex vivo NIR imaging was performed. The results revealed that PPBP-siRNA robustly accumulated in the lungs and tumor, whereas free Cy7-siRNA did not show obvious selectivity towards the tumor (Figure 6b). Quantitative analysis of mean fluorescence intensity (MFI) further confirmed that PPBP-siRNA was more effectively distributed in the tumor (Figure 6c). Considering the exciting in vitro results, the triple-modal therapeutic effects of PPBP-siRNA were evaluated in HeLa tumor-bearing BALB/c nude mice. The mice were divided into six groups: (a) saline alone as the nonirradiation control group, (b) saline with both 808 and 660 nm irradiation as the irradiation control group, (c) PPBP-siRNA, (d) PPBP-siRNA with 808 nm laser irradiation, (e) PPBP-siRNA with 660 nm laser irradiation, and (f) PPBP-siRNA with both 808 and 660

To further verify the enhanced suppression effect resulting from the synergistic combination of gene therapy, PTT and PDT, each individual therapeutic effect was examined. First, PPBP-siRNA was transfected into HeLa cells to ascertain whether the PPBP-siRNA could silence hTERT gene expression. Forty-eight hours after the treatment of HeLa cells with PPBP-siRNA (0−30 μg mL−1), followed by 808 and 660 nm irradiation, hTERT mRNA was determined by realtime RT PCR. PPBP-siRNA downregulated the mRNA expression of hTERT in a concentration-dependent manner (0, 5, 10, 20, and 30 μg mL−1, Figure S13a, Supporting Information). The hTERT protein expression level detected by western blot analysis was also downregulated in a concentration-dependent manner, further verifying the successful transfection of hTERT siRNA in the PPBP delivery system (Figure 5d). Second, heat shock protein 70 (Hsp70) expression was tested after exposure to 808 nm laser irradiation. The results showed that Hsp70 expression gradually increased after the treatment with 0−30 μg mL−1 of PPBP-siRNA, followed by exposure to 808 nm, verifying the heat stress of cells and PTT effect of this treatment (Figure 5d). Third, PPBP-induced intracellular ROS generation was determined. Fluorescence confocal microscopy showed that significant intracellular ROS generated after 660 nm irradiation, whereas only a fraction of ROS generation was 21144

DOI: 10.1021/acsami.8b04807 ACS Appl. Mater. Interfaces 2018, 10, 21137−21148

Research Article

ACS Applied Materials & Interfaces

Figure 6. (a) In vivo NIR fluorescence imaging of whole mice bearing subcutaneous HeLa tumor 24 h after injection of PPBP-siRNA (white circle: tumor region). (b) Ex vivo fluorescence images of tumors and organs 48 h after PPBP-siRNA injection. (c) Quantification of the MFI of Cy7labeled free siRNA or PPBP-siRNA in tumors and organs (n = 3). Lu, Li, Ki, In, Sp, He, Mu, and Tu are short forms for lungs, liver, kidneys, intestine, spleen, heart, muscle, and tumor, respectively. (d) Thermal images of HeLa tumor xenograft mice when exposed to 808 nm irradiation. (e) ROS production at the tumor site after different treatments (n = 3). (f) Tumor growth curves of subcutaneous HeLa xenograft in the different groups were measured. Compared with the curves in the 808 nm group and the two PBS groups, the tumor growth curve in the trimodal combined treatment group shows a significant difference (*p < 0.05, **p < 0.01, n = 5, respectively). (g) TUNEL staining (brown) of HeLa tumor sections from xenograft mice in different groups.

nm laser irradiation. PPBP-siRNA containing 1 mg kg−1 of PPBP was intravenously injected every 2 days and totally 4 times. At 24 h after the fourth administration, the photothermal ability of PPBP-siRNA during 808 nm irradiation was monitored using a thermal camera. The temperature of the tumor increased from ≈34.2 to ≈49.7 °C after 5 min of irradiation (Figure 6d). In contrast, the temperature of the tumor in the control group increased by only 4 °C after 5 min of laser irradiation. After 4 h of laser light irradiation at different wavelengths, the tumors were collected, and the ROS production in tumor tissue was also determined. ROS production from the group of PPBP-siRNA plus 808 and 660 nm was significantly higher than that from the saline control group, which was also much higher than the groups receiving PPBP-siRNA plus irradiation at 808 or 660 nm alone (Figure 6e). Tumor volumes were measured by a caliper for 18 days and relative tumor volumes were obtained by normalizing their initial sizes (0 day). The tumors of mice from the saline laser irradiation group and in the saline nonirradiation group grew rapidly (Figure 6f). The gene therapy using PPBP-siRNA slowed the tumor growth slightly compared to that in the saline groups. PPBP-siRNA with only 808 or 660 nm laser irradiation showed a potent growth inhibition effect. Remarkably, tumors from mice treated with PPBP-siRNA

plus 808 and 660 nm laser irradiation were significantly inhibited. TdT-mediated dUTP nick-end labeling (TUNEL) staining of the tumor slices collected 18 days postirradiation, revealed large apoptotic areas in the PPBP-siRNA plus 808 and 660 nm group, whereas partial apoptotic areas in the groups receiving only PDT or PTT (Figure 6g). The in vivo experiments demonstrated a significantly enhanced antitumor effect of PPBP-siRNA resulting from the multimodal synergistic therapies. To verify that the retardation of tumor growth by PPBPsiRNA was related to hTERT downregulation, three representative tumors from the saline nonirradiation group and three from the PPBP-siRNA nonirradiation group were excised 18 days after the first administration. As shown in Figure S13b (Supporting Information), the hTERT mRNA level in the PPBP-siRNA group was reduced significantly compared with the saline control group (p < 0.01). During treatment, the body weight in each mouse was monitored, and no significant difference was observed across all groups (Figure S14, Supporting Information). The main organs from representative mice in the PPBP-siRNA plus 660 and 808 nm laser irradiation group were collected 18 days after injection. The hematoxylin/eosin (H&E) stained images showed no significant morphological changes in the vital 21145

DOI: 10.1021/acsami.8b04807 ACS Appl. Mater. Interfaces 2018, 10, 21137−21148

Research Article

ACS Applied Materials & Interfaces

Figure 7. (a) In vivo NIR fluorescence imaging of mice bearing lung metastases, 42 days after the intravenous injection of A549 cancer cells (Upper). Ex vivo NIR fluorescence imaging of organs after sacrifice (Lower). During 42 days, the mice in the treated group were administered 0.5 mg kg−1 of PPBP-siRNA every 2 days until sacrifice. The mice in the untreated group were administered saline (n = 5). (b) The number of tumor nodules on each lung was counted under a dissecting microscope, showing a significant difference (*p < 0.05) between treatment and nontreatment groups. Fluorescence confocal microscopy images of lung slices (NIR, 780/800 nm ex/em) or DAPI incubated lung slices (DAPI, 358/ 461 nm ex/em) from treated mice. (c) H&E staining of representative lung slices from treated or untreated mice. (d) hTERT immunohistochemical staining of representative lung slices from treated or untreated mice. The results suggest that PPBP can efficiently carry hTERT siRNA into tumor cells and inhibit tumor metastasis.

organs between the PPBP-siRNA group and the saline control group (Figure S15, Supporting Information). The preliminary results suggested that the treatment was reasonably well tolerated, and no obvious side effects were observed. 3.6. Tumor Metastasis Inhibition of PPBP-siRNA. Considering the close relationship of hTERT to tumor metastasis,46 whether PPBP-siRNA could inhibit tumor metastasis was investigated. Ten nude mice were divided into two groups: five mice were injected with PPBP-siRNA every 2 days until sacrifice, and another five mice remained untreated as the control. Twenty-four hours after the first injection of PPBP-siRNA, A549 cells were intravenously injected, a procedure utilized to establish tumor lung metastasis within 42 days, according to previously reported methods.47 Then, the mice were administered Cy7-labeled PPBP-siRNA intravenously, and in vivo and ex vivo NIR fluorescence imaging were performed (Figure 7a). A stronger fluorescence intensity was observed in the lung tissues in the untreated control group compared with that in the PPBPsiRNA group. The lungs from the two different groups were collected 42 days after the intravenous injection of A549 cells. The number of tumor nodules on each lung was counted, and obviously decreased in the mice from the PPBP-treated group compared with the untreated group (Figure 7b). Frozen sections of the lung tumor nodules were prepared and incubated with 4′,6-diamidino-2-phenylindole (DAPI) to stain the cell nuclei. Fluorescence confocal microscopy images of the lung slices revealed that a large amount of PPBP-siRNA

penetrated into tumor tissues and retained in tumor cells. H&E staining revealed that a large number of tumor cells were found in the lung slices from untreated mice, whereas a relatively normal lung structure was maintained in the PPBP-siRNA treated mice (Figure 7c). Immunohistochemical staining showed high expression of hTERT in the untreated group, whereas a clear decrease was observed in the group treated with PPBP-siRNA (Figure 7d). All of the differences above suggest that PPBP can efficiently carry hTERT siRNA into the tumor cells, and inhibit tumor growth and metastasis.

4. CONCLUSIONS In summary, PEG and PEI dual-functionalized BP nanosheets were prepared for the first time and used as a new carrier of siRNA for cancer-targeted synergistic therapy. The PEGylation of BP was expected to improve its biocompatibility and physiological stability. PPBP nanosheets functionalized with positively charged PEI exhibited high efficiency in siRNA loading and robust cellular uptake. The PPBP nanosheets also exhibited PDT and PTT activities when exposed to different wavelengths of laser irradiation. More importantly, the vulnerability of PPBP to a combination of the acidic and high-ROS ambient environment enabled the targeted delivery and release of siRNA to cancer cells through the specific degradation of PPBP, which was mediated by the acidic lysosome and locally photoinduced ROS production. Furthermore, PEI-functionalized PPBP enabled siRNA to escape from the lysosome for targeted delivery to the cancer cell 21146

DOI: 10.1021/acsami.8b04807 ACS Appl. Mater. Interfaces 2018, 10, 21137−21148

Research Article

ACS Applied Materials & Interfaces

(10) Xie, Y.; Qiao, H.; Su, Z.; Chen, M.; Ping, Q.; Sun, M. PEGylated Carboxymethyl Chitosan/Calcium Phosphate Hybrid Anionic Nanoparticles Mediated hTERT siRNA Delivery for Anticancer Therapy. Biomaterials 2014, 35, 7978−7991. (11) Whitehead, K. A.; Langer, R.; Anderson, D. G. Knocking Down Barriers: Advances in siRNA Delivery. Nat. Rev. Drug Discovery 2009, 8, 129−138. (12) Scholz, C.; Wagner, E. Therapeutic Plasmid DNA Versus siRNA Delivery: Common and Different Tasks for Synthetic Carriers. J. Control. Release 2012, 161, 554−565. (13) Riley, M. K.; Vermerris, W. Recent Advances in Nanomaterials for Gene Delivery-A Review. Nanomaterials 2017, 7, 94. (14) Conde, J.; Oliva, N.; Zhang, Y.; Artzi, N. Local TripleCombination Therapy Results in Tumour Regression and Prevents Recurrence in a Colon Cancer Model. Nat. Mater. 2016, 15, 1128− 1138. (15) Zhang, R.; Gao, S.; Wang, Z.; Han, D.; Liu, L.; Ma, Q.; Tan, W.; Tian, J.; Chen, X. Multifunctional Molecular Beacon Micelles for Intracellular mRNA Imaging and Synergistic Therapy in MultidrugResistant Cancer Cells. Adv. Funct. Mater. 2017, 27, No. 1701027. (16) Du, X.; Zhao, C.; Zhou, M.; Ma, T.; Huang, H.; Jaroniec, M.; Zhang, X.; Qiao, S. Z. Hollow Carbon Nanospheres with Tunable Hierarchical Pores for Drug, Gene, and Photothermal Synergistic Treatment. Small 2017, 13, No. 1602592. (17) Allen, M. J.; Tung, V. C.; Kaner, R. B. Honeycomb Carbon: a Review of Graphene. Chem. Rev. 2010, 110, 132−145. (18) Song, L.; Ci, L.; Lu, H.; Sorokin, P. B.; Jin, C.; Ni, J.; Kvashnin, A. G.; Kvashnin, D. G.; Lou, J.; Yakobson, B. I.; Ajayan, P. M. Large Scale Growth and Characterization of Atomic Hexagonal Boron Nitride Layers. Nano Lett. 2010, 10, 3209−3215. (19) Fang, L.; Liu, D. M.; Guo, Y.; Liao, Z. M.; Luo, J. B.; Wen, S. Z. Thickness Dependent friction on few-layer MoS2, WS2, and WSe2. Nanotechnology 2017, 28, No. 245703. (20) Yu, F.; Liu, Q.; Gan, X.; Hu, M.; Zhang, T.; Li, C.; Kang, F.; Terrones, M.; Lv, R. Ultrasensitive Pressure Detection of Few-Layer MoS2. Adv. Mater. 2017, 29, No. 1603266. (21) Zhang, H. Ultrathin Two-Dimensional Nanomaterials. ACS Nano 2015, 9, 9451−9469. (22) Tan, C.; Cao, X.; Wu, X. J.; He, Q.; Yang, J.; Zhang, X.; Chen, J.; Zhao, W.; Han, S.; Nam, G. H.; Sindoro, M.; Zhang, H. Recent Advances in Ultrathin Two-Dimensional Nanomaterials. Chem. Rev. 2017, 117, 6225−6331. (23) Ma, Y.; Shen, C.; Zhang, A.; Chen, L.; Liu, Y.; Chen, J.; Liu, Q.; Li, Z.; Amer, M. R.; Nilges, T.; Abbas, A. N.; Zhou, C. Black Phosphorus Field-Effect Transistors with Work Function Tunable Contacts. ACS Nano 2017, 11, 7126−7133. (24) Batmunkh, M.; Bat-Erdene, M.; Shapter, J. G. Phosphorene and Phosphorene-Based Materials - Prospects for Future Applications. Adv. Mater. 2016, 28, 8586−8617. (25) Chen, W.; Ouyang, J.; Liu, H.; Chen, M.; Zeng, K.; Sheng, J.; Liu, Z.; Han, Y.; Wang, L.; Li, J.; Deng, L.; Liu, Y. N.; Guo, S. Black Phosphorus Nanosheet-Based Drug Delivery System for Synergistic Photodynamic/Photothermal/Chemotherapy of Cancer. Adv. Mater. 2017, 29, No. 1603864. (26) Wang, H.; Yang, X.; Shao, W.; Chen, S.; Xie, J.; Zhang, X.; Wang, J.; Xie, Y. Ultrathin Black Phosphorus Nanosheets for Efficient Singlet Oxygen Generation. J. Am. Chem. Soc. 2015, 137, 11376− 11382. (27) Sun, Z.; Xie, H.; Tang, S.; Yu, X. F.; Guo, Z.; Shao, J.; Zhang, H.; Huang, H.; Wang, H.; Chu, P. K. Ultrasmall Black Phosphorus Quantum Dots: Synthesis and Use as Photothermal Agents. Angew. Chem., Int. Ed. 2015, 54, 11526−11530. (28) Shao, J.; Xie, H.; Huang, H.; Li, Z.; Sun, Z.; Xu, Y.; Xiao, Q.; Yu, X. F.; Zhao, Y.; Zhang, H.; Wang, H.; Chu, P. K. Biodegradable Black Phosphorus-Based Nanospheres for in Vivo Photothermal Cancer Therapy. Nat. Commun. 2016, 7, No. 12967. (29) Tao, W.; Zhu, X.; Yu, X.; Zeng, X.; Xiao, Q.; Zhang, X.; Ji, X.; Wang, X.; Shi, J.; Zhang, H.; Mei, L. Black Phosphorus Nanosheets as

cytoplasm. Hence, the hTERT siRNA-loaded PPBP displayed notable suppression of tumor growth and metastasis. PEG and PEI dual-functionalized BP nanosheets reported in this work may also provide a new promising platform to deliver other siRNA for cancer-targeted gene therapy.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsami.8b04807. Schematic illustration for the preparation of PPBP; elemental mapping images of PPBP nanosheets; absorption spectra of PBP and PPBP; DLS analysis; AFM image of PPBP; relative cell viabilities of HeLa cells (PDF)

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected] (H.L.). *E-mail: [email protected] (S.Y.). ORCID

Songtao Yu: 0000-0002-2804-9581 Author Contributions ⊥

L.C., C.C., and W.C. contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors acknowledge the financial support from the National Natural Science Foundation of China (81773142 and 81472554) and from Southwest Hospital Research (SWH2016LCZD-03 and SWH2016JCYB-28).

■

REFERENCES

(1) Marciniak, R.; Guarente, L. Human Genetics: Testing Telomerase. Nature 2001, 413, 370−373. (2) Marx, J. Tackling Cancer at The Telomeres. Science 2002, 295, 2350. (3) Hanahan, D.; Weinberg, R. A. Hallmarks of Cancer: The Next Generation. Cell 2011, 144, 646−674. (4) Barthel, F. P.; Wei, W.; Tang, M.; Martinez-Ledesma, E.; Hu, X.; Amin, S. B.; Akdemir, K. C.; Seth, S.; Song, X.; Wang, Q.; Lichtenberg, T.; Hu, J.; Zhang, J.; Zheng, S.; Verhaak, R. G. Systematic Analysis of Telomere Length and Somatic Alterations in 31 Cancer Types. Nat. Genet. 2017, 49, 349−357. (5) Flynn, R. L.; Cox, K. E.; Jeitany, M.; Wakimoto, H.; Bryll, A. R.; Ganem, N. J.; Bersani, F.; Pineda, J. R.; Suva, M. L.; Benes, C. H.; Haber, D. A.; Boussin, F. D.; Zou, L. Alternative Lengthening of Tomeres Renders Cancer Cells Hypersensitive to ATR Inhibitors. Science 2015, 347, 273−277. (6) Komata, T.; Kanzawa, T.; Kondo, Y.; Kondo, S. Telomerase as a Therapeutic Target for Malignant Gliomas. Oncogene 2002, 21, 656− 663. (7) Liu, T.; Li, W.; Lu, W.; Chen, M.; Luo, M.; Zhang, C.; Li, Y.; Qin, G.; Shi, D.; Xiao, B.; Qiu, H.; Yu, W.; Kang, L.; Kang, T.; Huang, W.; Yu, X.; Wu, X.; Deng, W. RBFOX3 Promotes Tumor Growth and Progression via hTERT Signaling and Predicts a Poor Prognosis in Hepatocellular Carcinoma. Theranostics 2017, 7, 3138−3154. (8) Shi, Y. A.; Zhao, Q.; Zhang, L. H.; Du, W.; Wang, X. Y.; He, X.; Wu, S.; Li, Y. L. Knockdown of hTERT by siRNA Inhibits Cervical Cancer Cell Growth in Vitro and in Vivo. Int. J. Oncol. 2014, 45, 1216−1224. (9) Shay, J. W.; Wright, W. E. Telomerase: a Target for Cancer Therapeutics. Cancer Cell 2002, 2, 257−265. 21147

DOI: 10.1021/acsami.8b04807 ACS Appl. Mater. Interfaces 2018, 10, 21137−21148

Research Article

ACS Applied Materials & Interfaces a Robust Delivery Platform for Cancer Theranostics. Adv. Mater. 2017, 29, No. 1603276. (30) Yin, F.; Hu, K.; Chen, S.; Wang, D.; Zhang, J.; Xie, M.; Yang, D.; Qiu, M.; Zhang, H.; Li, Z. Black Phosphorus Quantum Dot Based Novel siRNA Delivery Systems in Human Pluripotent Teratoma PA-1 Cells. J. Mater. Chem. B 2017, 5, 5433−5440. (31) Wang, H.; Zhong, L.; Liu, Y.; Xu, X.; Xing, C.; Wang, M.; Bai, S. M.; Lu, C. H.; Yang, H. H. A Black Phosphorus Nanosheet-Based siRNA Delivery System for Synergistic Photothermal and Gene Therapy. Chem. Commun. 2018, 54, 3142−3145. (32) Lei, W.; Liu, G.; Zhang, J.; Liu, M. Black Phosphorus Nanostructures: Recent Advances in Hybridization, Doping and Functionalization. Chem. Soc. Rev. 2017, 46, 3492−3509. (33) Island, J. O.; Steele, G. A.; van der Zant, H. S.; CastellanosGomez, A. Environmental Instability of Few-Layer Black Phosphorus. 2D Mater. 2015, 2, No. 011002. (34) Kou, L.; Chen, C.; Smith, S. C. Phosphorene: Fabrication, Properties, and Applications. J. Phys. Chem. Lett. 2015, 6, 2794−2805. (35) Favron, A.; Gaufres, E.; Fossard, F.; Phaneuf-L’Heureux, A. L.; Tang, N. Y.; Levesque, P. L.; Loiseau, A.; Leonelli, R.; Francoeur, S.; Martel, R. Photooxidation and Quantum Confinement Effects in Exfoliated Black Phosphorus. Nat. Mater. 2015, 14, 826−832. (36) Kuriakose, S.; Ahmed, T.; Balendhran, S.; Bansal, V.; Sriram, S.; Bhaskaran, M.; Walia, S. Black phosphorus: Ambient degradation and strategies for protection. 2D Mater. 2018, 5, No. 032001. (37) Ahmed, T.; Balendhran, S.; Karim, M. N.; Mayes, E. L.; Field, M. R.; Ramanathan, R.; Singh, M.; Bansal, V.; Sriram, S.; Bhaskaran, M.; Walia, S. Degradation of Black Phosphorus Is Contingent on UV−Blue Light Exposure. npj 2D Mater. Appl. 2017, 1, No. 18. (38) Walia, S.; Balendhran, S.; Ahmed, T.; Singh, M.; El-Badawi, C.; Brennan, M. D.; Weerathunge, P.; Karim, M. N.; Rahman, F.; Rassell, A.; Duckworth, J.; Ramanathan, R.; Collis, G. E.; Lobo, C. J.; Toth, M.; Kotsakidis, J. C.; Weber, B.; Fuhrer, M.; Dominguez-Vera, J. M.; Spencer, M. J. S.; Aharonovich, I.; Sriram, S.; Bhaskaran, M.; Bansal, V. Ambient Protection of Few-Layer Black Phosphorus via Sequestration of Reactive Oxygen Species. Adv. Mater. 2017, 29, No. 1700152. (39) Luo, S.; Yang, Z.; Tan, X.; Wang, Y.; Zeng, Y.; Wang, Y.; Li, C.; Li, R.; Shi, C. Multifunctional Photosensitizer Grafted on Polyethylene Glycol and Polyethylenimine Dual-Functionalized Nanographene Oxide for Cancer-Targeted Near-Infrared Imaging and Synergistic Phototherapy. ACS Appl. Mater. Interfaces 2016, 8, 17176−17186. (40) Ryder, C. R.; Wood, J. D.; Wells, S. A.; Yang, Y.; Jariwala, D.; Marks, T. J.; Schatz, G. C.; Hersam, M. C. Covalent Functionalization and Passivation of Exfoliated Black Phosphorus via Aryl Diazonium Chemistry. Nat. Chem. 2016, 8, 597−602. (41) Adkins, M. W.; Williams, S. K.; Linger, J.; Tyler, J. K. Chromatin Disassembly From the PHO5 Promoter is Essential for The Recruitment of The General Transcription Machinery and Coactivators. Mol. Cell. Biol. 2007, 27, 6372−6382. (42) Safari, F.; Tamaddon, A. M.; Zarghami, N.; Abolmali, S.; Akbarzadeh, A. Polyelectrolyte Complexes of hTERT siRNA and Polyethyleneimine: Effect of Degree of PEG Grafting on Biological and Cellular Activity. Artif. Cells, Nanomed., Biotechnol. 2016, 44, 1561−1568. (43) Li, J.; Chen, Y. C.; Tseng, Y. C.; Mozumdar, S.; Huang, L. Biodegradable Calcium Phosphate Nanoparticle with Lipid Coating for Systemic siRNA Delivery. J. Control. Release 2010, 142, 416−421. (44) Lechardeur, D.; Verkman, A. S.; Lukacs, G. L. Intracellular Routing of Plasmid DNA During Non-viral Gene Transfer. Adv. Drug Delivery Rev. 2005, 57, 755−67. (45) Huth, U. S.; Schubert, R.; Peschka-Suss, R. Investigating the Uptake and Intracellular Fate of pH-sensitive Liposomes by Flow Cytometry and Spectral Bio-imaging. J. Control. Release 2006, 110, 490−504. (46) Boscolo-Rizzo, P.; Da Mosto, M. C.; Rampazzo, E.; Giunco, S.; Del Mistro, A.; Menegaldo, A.; Baboci, L.; Mantovani, M.; Tirelli, G.; De Rossi, A. Telomeres and Telomerase in Head and Neck Squamous

Cell Carcinoma: From Pathogenesis to Clinical Implications. Cancer Metastasis Rev. 2016, 35, 457−474. (47) Yang, Y.; Zhao, W.; Xu, Q. W.; Wang, X. S.; Zhang, Y.; Zhang, J. IQGAP3 Promotes EGFR-ERK Signaling and the Growth and Metastasis of Lung Cancer Cells. PLoS One 2014, 9, No. e97578.

21148

DOI: 10.1021/acsami.8b04807 ACS Appl. Mater. Interfaces 2018, 10, 21137−21148