Article Cite This: J. Agric. Food Chem. XXXX, XXX, XXX−XXX
pubs.acs.org/JAFC
Biodegradation of Ethyl Carbamate and Urea with Lysinibacillus sphaericus MT33 in Chinese Liquor Fermentation Kaixiang Cui, Qun Wu,* and Yan Xu* The Key Laboratory of Industrial Biotechnology, Ministry of Education, State Key Laboratory of Food Science and Technology, Synergetic Innovation Centre of Food Safety and Nutrition, School of Biotechnology, Jiangnan University, Wuxi, Jiangsu 214122, China S Supporting Information *
ABSTRACT: It is important to reduce the concentration of ethyl carbamate (EC) in fermented foods. However, controlling the formation of EC and its precursor urea is difficult in spontaneous food fermentation because urea is a natural product of nitrogen metabolism. Biodegradation is a better solution to reduce the concentration of EC. This study aimed to reduce the concentration of EC in Chinese liquor via an indigenous strain Lysinibacillus sphaericus MT33. This strain produced urethanase (940 U/L) and urease (1580 U/L) and degraded 76.52% of EC and 56.48% of urea. After inoculation in liquor fermentation, the maximal relative abundance of Lysinibacillus increased from 0.02% to 8.46%, the final EC and urea contents decreased by 41.77% and 28.15%. Moreover, the concentration of EC decreased by 63.32% in liquor. The negative correlation between abundance of Lysinibacillus and contents of EC and urea indicated the effect of L. sphaericus on EC and urea degradation. KEYWORDS: ethyl carbamate, urea, Lysinibacillus sphaericus, inoculation, Chinese liquor
■
may contribute to urea biosynthesis.18 Thus, it is difficult to regulate urea metabolism only by modification of S. cerevisiae strain to reduce EC production in spontaneous food fermentation. Chinese liquor is a typical spontaneously fermented food. There was no legislation about the maximum allowed level for EC in Chinese liquor up to now. The current legislative maximum level for ethyl carbamate in brandy is 400 μg/L.7 The lower the concentration of EC controlled in the fermented food, the better it is for health.19,20 In brief, it is a challenge to degrade EC by enzymatic decomposition and reducing urea biosynthesis in spontaneous food fermentation. Therefore, a more efficient strategy should be further explored to control EC in spontaneously fermented foods. Biodegradation is a more effective solution to reduce EC in multispecies fermentations. In this work, we aimed to provide an effective strategy to reduce the concentration of EC in Chinese liquor fermentation, a typical spontaneously fermented food. A strain of Lysinibacillus sphaericus MT33, which was isolated from Chinese liquor fermentation, contained both urethanase and urease activities. It can survive in the harsh environment with high temperature and acids concentration in liquor fermentation. In this study, it was inoculated to degrade both EC and urea in liquor fermentation. The effects of inoculation on the dynamics of EC and urea contents and microbial successions were analyzed during liquor fermentation.
INTRODUCTION Ethyl carbamate (EC) is classified as a group 2A carcinogen.1 It widely exists in various fermented foods including vinegar, soy sauce, pickles, cheese, chocolate, and alcoholic beverages.2−5 Therefore, it is necessary to reduce the concentration of ethyl carbamate in these fermented foods because of its potential carcinogenic risk. Urea is the main precursor of EC in most fermented foods.6 Various methods for minimizing the EC content have been focused on control of EC and its precursor urea. Among these methods, enzymatic decomposition is developed to control EC in food fermentation via degrading EC and urea directly. For example, urethanase from Rhodotorula mucilaginosa and Penicillium variabile were used to degrade EC to ammonia, CO2, and ethanol in commercial rice wine.8,9 Acid urease produced by recombinant strains was also used to degrade urea to ammonia and CO2 in wine, sake, and rice wine.10−12 However, the enzymatic activity is affected by acids and alcohols in liquor fermentation, and the degradation effects are unstable and limited.6 Therefore, a more effective solution is necessary to control EC in liquor fermentation. At present, reducing biosynthesis of urea (the main precursor of EC) is a general way to control EC in liquor fermentation. For example, Saccharomyces cerevisiae is the main urea producer in many fermented foods.13,14 Urea is produced by arginine via arginase (CAR1) and then could be degraded to ammonia and CO2 via urea amidolyase (DUR1, 2) in S. cerevisiae. The knockout of CAR1 was employed to lower the EC concentration in wine15 and rice wine.16 Overexpressing genes of DUR1,2, decreased the concentrations of EC and urea in rice wine.17 However, most of the fermented foods are produced by spontaneous fermentation involving a variety of species. For example, in the liquor fermentation, different species were mainly from Daqu, sorghum, and other environments, and some of them © XXXX American Chemical Society
Received: Revised: Accepted: Published: A
November 6, 2017 January 21, 2018 January 23, 2018 January 23, 2018 DOI: 10.1021/acs.jafc.7b05190 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
■
the fermented grains or fermentation broth was mixed with 0.4 mL of 9hydroxyxanthene (0.02 mol/L), 0.5 mL of anhydrous ethanol, and 0.1 mL of HCl (1.50 mol/L). Then the derivative reactions were done in a dark water bath (25 °C) for 30 min. Urea was determined by high performance liquid chromatography with fluorescence detection as reported.26 All the analysis of samples were based on dry weight. Microbial Population Analyses by Quantitative Real-Time PCR (qPCR). qPCR was carried out in technical quadruplicate on a realtime PCR System (Applied Biosystems) with a commercial kit (SYBR Premix Ex TaqII, Takara, Dalian, China).27 Primers YEASTF (5′GAGTCGAGTTGTTTGGGAATGC-3′) and YEASTR (5′TCTCTTTCCAAAGTTCTTTTCATCTT-3′) were used to quantify the abundance of total yeasts.28 Primers B1 (5′-CCTACGGGAGGCAGCAG-3′) and B2 (5′-ATTACCGCGGCTGCTGG-3′) were used to quantify the abundance of total bacteria.29 Primers NS3-GC (5′CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGGCAAGTCTGGTGCCAGCAGCC-3′) and YM 951r (5′TTGGCAAATGCTTTCGC-3′) were used to quantify the abundance of total molds.30 qPCR reactions were performed in 20.0 μL volumes containing 10.0 μL of SYBR Premix Ex Taq (Takara, Dalian, China), 0.2 μL of each primer, 1.0 μL of genomic DNA, and 8.6 μL of sterilized H2O. The qPCR thermocycling conditions were set at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 55 °C for 30 s, 72 °C for 30 s. Agarose gel electrophoresis and melting curve analysis confirmed the specificity of the amplification. DNA Extractions, Amplification, and Sequencing. Genomic DNA was extracted by the E.Z.N.A. Soil DNA Kit (Omega Biotek, Norcross, GA) from 7 g of each sample in accordance with the manufacturer’s instructions. For fungi, the ITS2 sequence was amplified by PCR (95 °C for 2 min, followed by 30 cycles at 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 45 s with a final extension at 72 °C for 10 min) with the primers of the ITS3 (5′-GCATCGATGAAGAACGCAGC-3′) and the ITS4 (5′-TCCTCCGCTTATTGATATGC-3′).31 The V3−V4 regions of the bacteria 16S rRNA gene were amplified with the universal primers of the forward 338F (5′-ACTCCTACGGGAGGCAGCAG-3′) and the reverse 806R (5′-GACTACHVGGGTWTCTAAT-3′).32 The PCR program was as follows: 95 °C for 5 min, 25 cycles at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, and a final extension of 72 °C for 10 min. PCR products were purified with a PCR purification kit (TaKaRa, Dalian, China). Amplicons were merged into equimolar quantities and then sequenced for 2 × 300 bp paired-end sequencing (Illumina, San Diego, CA).33 All the sequence data were stored in the DNA Data Bank of Japan (DDBJ) with the accession number of DRA006044 (16S) and DRA006045 (ITS2). Sequence Processing. The raw sequences generated from MiSeq were processed by QIIME pipeline.32 The sequences that were less than 100 bp in length after quality trimming, contained one or more ambiguous bases, average quality scores 0.6 and P < 0.05 was regarded as a significant correlation.
■
RESULTS AND DISCUSSION EC and Urea Degradation Activities in L. sphaericus MT33. L. sphaericus MT33 entered into the stationary phase at 48 h and then kept its biomass (OD600) ranging from 0.83 to 0.86 until 72 h (Figure 1A). It degraded a total of 153.04 μg/L EC, and the degradation ratio of EC was 76.52% at the end of fermentation. The maximum specific degradation rate of EC reached 30.81 μg/(L h OD600). Furthermore, the concentration of urea decreased from 100.00 mg/L to 43.61 mg/L. The maximum specific degradation rate of urea reached 25.82 mg/(L h OD600) at 12 h, and the degradation ratio of urea reached 56.48% at the end of fermentation (Figure 1B). As shown in Figure 1C, the maximum activities of the urethanase and urease were 940 U/L and 1580 U/L at 12 h. Subsequently, urethanase and urease activities decreased until 36 h and stabilized at a lower level until 72 h, ranging from 100 to 180 U/L and 80 to 230 U/L. It may be related with the decrease of pH (from 5.46 to 4.67) in fermentation because it has been reported that the activities of urease and urethanase were negatively correlated with pH.39 The existences of urethanase gene and ureA indicated that L. sphaericus MT33 had the ability of degrading EC and urea. As shown in Figure 2A, sequences of urethanase gene in L. sphaericus MT33 showed the highest identity (99%) with that in L. sphaericus 2362 (CP015224.1), and the lowest identity (65%) with that in G. stearothermophilus 10 (CP008934.1). Besides, sequence of ureA also showed the highest identity (100%) with that in L. sphaericus 2362 (CP015224.1), the lowest identity (67%) with that in C. formicaceticum DSM 92 (CP020559.1) (Figure 2B). Phylogenetic trees revealed low identity of ureA and urethanase gene in L. sphaericus MT33 with those from other genera. Dynamics of Concentrations of EC and Urea Concentrations in Liquor Fermentation after Inoculation. The concentration of EC decreased from 307.53 μg/L to 112.79 μg/L (P < 0.05) in liquors, and the degradation ratio of EC was 63.32% after inoculation of L. sphaericus MT33 in liquor fermentation. Figure 3A showed the time profile of the concentration of EC in liquor fermentation. The concentration of EC increased from 61.64 μg/kg to 73.17 μg/kg in stacking fermentation and reached the maximum (161.62 μg/kg) at day 15 and then decreased to 152.04 μg/kg at the end of alcoholic fermentation without inoculation. Although the concentration of EC decreased from 65.84 μg/kg to 48.99 μg/kg in the stacking fermentation, it then increased to 123.36 μg/kg at day 15 and then it decreased to 88.53 μg/kg at the end of alcoholic fermentation with inoculation of L. sphaericus MT33. The concentration of EC decreased by 25.59% at the end of stacking and decreased by 41.77% at the end of alcoholic fermentation with inoculation, comparing with those without inoculation. It indicated that the inoculation of L. sphaericus MT33 efficiently decreased the concentration of EC in both two fermentation stages. Figure 3B showed the time profile of the concentration of urea in liquor fermentation. The concentration of urea increased from
Figure 3. Dynamics of EC and urea concentrations during stacking and alcoholic fermentation stages (P < 0.05). (A) EC. (B) Urea. S0, S1, and S2 are short for stacking fermentation days 0, 1, and 2; A0, A5, A15, and A30 are short for alcoholic fermentation days 0, 5, 15, and 30. Three representative fermentation pits were carried out for every sample.
42.19 mg/kg to 44.46 mg/kg in stacking fermentation, and reached the peak (81.72 mg/kg) at day 15, and then it decreased to 67.45 mg/kg at the end of alcoholic fermentation without inoculation. It decreased by 18.61% and 28.15% at the end of stacking and alcoholic fermentation, compared with those without inoculation. It indicated that the inoculation of L. sphaericus MT33 efficiently decreased the concentration of urea in both two fermentation stages. Dynamics of Population and Microbial Composition after Inoculation. The population of total yeast and bacteria presented higher levels with a range of 7.33−8.16 lg copies/g and 7.43−8.85 lg copies/g. Meanwhile, the population level of mold maintained a range of 5.84−6.35 lg copies/g during the fermentation. No significant differences (P > 0.05) were found for the population of total yeast, bacteria, or mold after inoculation during liquor fermentation (Figure 4A). We obtained 1 444 184 reads (34 385 ± 9547 on average) in 16S rRNA sequences and 2 029 605 reads (48 324 ± 9832 on average) in ITS2 sequences after quality control. A total of 449 OTUs and 467 OTUs were classified in 16S rRNA and ITS2 sequences. The sequence coverage (>97.0%) for 16S rRNA and ITS2 sequences indicates the adequate sequencing depth of all the samples.40,41 The α-diversity characteristics in all samples were estimated by the Shannon diversity and Chao1 richness (Table 1). The αdiversity of the bacteria and fungi community did not differ significantly between the uninoulated and inoculated fermentation, indicating that inoculation did not alter the diversity of the microbial community. Figure 4B showed the dynamics of microbial composition in liquor fermentation. The most predominant bacterial genus was Bacillus (about 50.0%) in stacking fermentation and the initial of alcoholic fermentation, and then it dramatically decreased to 75.0%). Highly similar successional dynamics of fungal genera was also observed in both uninoculated and inoculated fermentation process. Pichia prevailed during stacking fermentation (about 40.0%) and then decreased gradually to nearly 10.0% at the end of fermentation in the two fermentation groups. Komagataella dominated the fermentation process after day 15 (>50.0%). As shown in Figure 4B, the proportion of Lysinibacillus was less than 0.02% in the whole uninoculated fermentation. Whereas, in D
DOI: 10.1021/acs.jafc.7b05190 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
Figure 4. Dynamics of population and microbial composition during fermentation.(A) Dynamics of population of yeasts, bacteria, molds during stacking fermentation and alcoholic fermentation. (B) Relative abundances of different genera of prokaryotes and eukaryoyes in the whole liquor fermentation process. (C) Relative abundances of Lysinibacillus between inoculated and uninoculated fermentation. The boxplot represents the median values, the first and the third quartile. (D) Correlation between the biomass of Lysinibacillus with EC. (E) Correlation between the biomass of Lysinibacillus with urea. S0, S1, and S2 are short for stacking fermentation days 0, 1, and 2; A0, A5, A15, and A30 are short for alcoholic fermentation days 0, 5, 15, and 30. Three representative fermentation pits were carried out for every sample.
Table 1. Bacterial and Fungal Diversity of the Shannon Diversity and Chao1 Richness during the Fermentation Processa bacteria
fungi
Shannon diversity
Chao1 richness
Shannon diversity
Chao1 richness
α-diversity
UFG
IFG
UFG
IFG
UFG
IFG
UFG
IFG
S0 S1 S2 F0 F5 F15 F30 t p
3.21 ± 0.10 3.12 ± 0.18 2.86 ± 0.31 3.03 ± 0.16 1.25 ± 0.41 0.27 ± 0.08 0.27 ± 0.03 0.68 0.52
3.02 ± 0.23 3.12 ± 0.40 2.66 ± 0.38 2.95 ± 0.42 1.88 ± 0.93 0.34 ± 0.18 0.58 ± 0.24
188.27 ± 11.32 198.35 ± 11.32 187.08 ± 44.73 188.53 ± 13.08 177.69 ± 26.31 56.49 ± 6.76 77.93 ± 9.41 −0.27 0.79
207.70 ± 9.53 190.82 ± 14.62 185.56 ± 24.77 188.91 ± 9.34 141.57 ± 28.80 67.21 ± 12.55 79.95 ± 12.17
3.10 ± 0.63 2.66 ± 0.38 2.21 ± 0.07 2.30 ± 0.33 3.28 ± 0.39 2.96 ± 0.53 2.67 ± 0.72 0.62 0.56
3.36 ± 0.18 2.68 ± 0.30 2.56 ± 0.03 2.60 ± 0.39 3.07 ± 0.25 2.65 ± 0.26 2.68 ± 0.38
83.53 ± 0.07 94.94 ± 7.66 96.21 ± 3.93 95.16 ± 12.31 102.50 ± 3.76 80.05 ± 3.38 75.43 ± 3.73 0.125 0.91
100.78 ± 2.51 85.41 ± 2.87 84.55 ± 3.44 79.97 ± 2.98 91.37 ± 12.78 90.33 ± 9.66 100.85 ± 5.84
a
Paired-sample t-test results are shown at the bottom. b“UFG” uninoculated fermented process. “IFG” inoculated fermented process.
the inoculated fermentation, the proportion of Lysinibacillus increased from 2.1% in the initial of the stacking fermentation, and reached the maximum 8.5% at the end of stacking fermentation, then it decreased from 2.0% to 0.1% in the alcoholic fermentation. Figure 4C showed the relative abundances of Lysinibacillus in inoculated and uninoculated liquor fermentation. It indicated that the genus Lysinibacillus had significant differences in the two liquor fermentation processes.
Meanwhile, the correlation between the population of Lysinibacillus and concentrations of EC and urea was analyzed. A significant negative correlation was illustrated for EC (Figure 4D, P < 0.05) and urea (Figure 4E, P < 0.05). It implied that the decrease of EC and urea might result from the increase of relative abundance of Lysinibacillus in the inoculated liquor fermentation process. E
DOI: 10.1021/acs.jafc.7b05190 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
Figure 5. Dynamics of urethanase and urease genes during fermentation process. (A) Urethanase. (B) Urease. S0, S1, and S2 are short for stacking fermentation days 0, 1, and 2; A0, A5, A15, and A30 are short for alcoholic fermentation days 0, 5, 15, and 30. Three representative fermentation pits were carried out for every sample.
Variation of Urethanase and ureA Gene Copy Numbers after Inoculation. As shown in Figure 5, copy numbers of urethanase gene and ureA presented higher levels with a range of 3.82−5.67 lg copies/g and 3.09−4.26 lg copies/g in the inoculated fermentation, whereas the two gene copy numbers maintained a lower range of 1.22−2.05 lg copies/g and 0.69− 1.56 lg copies/g in the uninoculated fermentation. Significant differences (P < 0.05) between the uninoculated and inoculated processes were exhibited in Figure 5. It is consistent with the relative abundance of Lysinibacillus at the end of stacking fermentation after inoculation. Sensory Profiles of Liquors. Liquors collected from the inoculated and uninoculated fermentation were collected for sensory analysis. The results were illustrated in a radar graph for quantitative descriptive analysis (Figure 6). These two liquors
Lysinibacillus sphaericus in 2007.42 Bacillus is an important flavor contributor and is associated with various volatile compounds including phenols, pyrazines, and aromatic heterocycles. The inoculation of Bacillus could improve the flavor as previously reported.43 Therefore, we speculated that distinct liquor flavor profiles might be associated with the inoculation of L. sphaericus. In this work, we used an indigenous strain L. sphaericus MT33, containing both urethanase and urease activities, to efficiently biodegrade both EC and urea in spontaneous Chinese liquor fermentation and hence reduce EC in Chinese liquor. This work provided an effective strategy to reduce EC in spontaneously fermented foods.
■
ASSOCIATED CONTENT
* Supporting Information S
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.7b05190. Dynamics of physicochemical characteristics including contents of moisture, acidity, temperature, and alcohol during stacking and alcoholic fermentation processes (PDF)
■
AUTHOR INFORMATION
Corresponding Authors
*E-mail:
[email protected]. Phone: +86 510 85864112. Fax: +86 510 85864112. *E-mail:
[email protected]. Figure 6. Sensory profiles of the liquors from inoculated and uninoculated fermentations.
ORCID
Qun Wu: 0000-0002-3266-7040 Yan Xu: 0000-0002-7919-4762
had the same scores for the attribute “sweetness” and significantly different scores of the other seven attributes. The liquor obtained from the inoculated fermentation reached higher scores for the beneficial attributes “aroma intensity”, “soft”, “fullness”, and “sesame flavor.” By contrast, the liquor obtained in uninoculated fermentation had higher score for the unbeneficial attribute “spicy.” It indicated that the quality of Chinese liquor had been improved by inoculation. L. sphaericus was previously regarded as Bacillus sphaericus, whereas the taxonomic status was changed to the species
Funding
This work was supported by the National Natural Science Foundation of China (31530055), National Key Research and Development Program of China (2016YFD0400503) , Priority Academic Program Development of Jiangsu Higher Education Institutions, the 111 Project (No. 111-2-06) and China Postdoctoral Science Foundation (2017M611702). Notes
The authors declare no competing financial interest. F
DOI: 10.1021/acs.jafc.7b05190 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
■
(20) Xia, Q.; Yuan, H.; Wu, C.; Zheng, J.; Zhang, S.; Shen, C.; Yi, B.; Zhou, R. An improved and validated sample cleanup method for analysis of ethyl carbamate in Chinese liquor. J. Food Sci. 2014, 79, 1854−1860. (21) Kong, Y.; Wu, Q.; Zhang, Y.; Xu, Y. In situ analysis of metabolic characteristics reveals the key yeast in the spontaneous and solid-state fermentation process of Chinese light-style liquor. Appl. Environ. Microbiol. 2014, 80, 3667−3676. (22) Wu, Q.; Chen, L.; Xu, Y. Yeast community associated with the solid state fermentation of traditional Chinese Maotai-flavor liquor. Int. J. Food Microbiol. 2013, 166, 323−330. (23) Wang, P.; Wu, Q.; Jiang, X.; Wang, Z.; Tang, J.; Xu, Y. Bacillus licheniformis affects the microbial community and metabolic profile in the spontaneous fermentation of Daqu starter for Chinese liquor making. Int. J. Food Microbiol. 2017, 250, 59−67. (24) Wenlai Fan, Y. X.; Binbin Shi. Evolvement of ethyl carbamate and urea from fermented grains in the fermentation process of Chinese liquor. Sci. Technol. Food Industry (Beijing, China) 2012, 33, 171−174. (25) Xia, Q.; Yuan, H.; Wu, C.; Zheng, J.; Zhang, S.; Shen, C.; Yi, B.; Zhou, R. An improved and validated sample cleanup method for analysis of ethyl carbamate in Chinese liquor. J. Food Sci. 2014, 79, 1854−1860. (26) Wang, R.; Wu, H.; Zhou, X.; Chen, L. Simultaneous detection of ethyl carbamate and urea in Chinese yellow rice wine by HPLC-FLD. J. Liq. Chromatogr. Relat. Technol. 2014, 37, 39−47. (27) Liu, J.; Wu, Q.; Wang, P.; et al. Synergistic effect in core microbiota associated with sulfur metabolism in spontaneous Chinese liquor fermentation. Appl. Environ. Microbiol. 2017, 83, e01475−17. (28) Bokulich, N. A.; Ohta, M.; Richardson, P. M.; Mills, D. A. Monitoring seasonal changes in winery-resident microbiota. PLoS One 2013, 8, e66437. (29) Muyzer, G.; de Waal, E. C.; Uitterlinden, A. G. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 1993, 59, 695−700. (30) Xu, W.; Huang, Z.; Zhang, X.; Li, Q.; Lu, Z.; Shi, J.; Xu, Z.; Ma, Y. Monitoring the microbial community during solid-state acetic acid fermentation of Zhenjiang aromatic vinegar. Food Microbiol. 2011, 28, 1175−1181. (31) Levin, R. A.; Myers, N. R.; Bohs, L. Phylogenetic relationships among the “spiny solanums” (Solanum subgenus Leptostemonum, Solanaceae). Am. J. Bot. 2006, 93, 157−169. (32) Zhang, X.; Tian, X.; Ma, L.; Feng, B.; Liu, Q.; Yuan, L.; Fan, C.; Huang, H.; Huang, H.; Yang, Q. Biodiversity of the Symbiotic Bacteria Associated with Toxic Marine Dinoflagellate Alexandrium tamarense. J. Biosci. Med. 2015, 3, 23−28. (33) Ren, G.; Ren, W.; Teng, Y.; Li, Z. Evident bacterial community changes but only slight degradation when polluted with pyrene in a red soil. Front. Microbiol. 2015, 6, 22. (34) Caporaso, J. G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F. D.; Costello, E. K.; Fierer, N.; Peña, A. G.; Goodrich, J. K.; Gordon, J. I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335−336. (35) Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460−2461. (36) Tao, Y.; Li, J.; Rui, J.; Xu, Z.; Zhou, Y.; Hu, X.; Wang, X.; Liu, M.; Li, D.; Li, X. Prokaryotic communities in pit mud from different-aged cellars used for the production of chinese strong-flavored liquor. Appl. Environ. Microbiol. 2014, 80, 2254−2260. (37) Thompson, J. D.; Higgins, D. G.; Gibson, T. J. Clustal-WImproving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties And weight matrix choice. Nucleic Acids Res. 1994, 22, 4673−4680. (38) Zhai, S. L.; Long, J. X.; Chen, Q. L.; Luo, M. L.; Wei, W. K.; Yuan, S. S. Concurrent infection of torque teno sus virus and porcine circovirus type 2 in a clinical case with post-weaning multisystemic wasting syndrome. Br. Microbiol. Res. J. 2014, 4, 607−615. (39) Liu, X.; Zhang, Q.; Zhou, N.; et al. Expression of an Acid Urease with Urethanase Activity in E. coli and Analysis of Urease Gene. Mol. Biotechnol. 2017, 59, 84−97.
ACKNOWLEDGMENTS Support by the Collaborative Innovation Center of Jiangsu Modern Industrial Fermentation is acknowledged.
■
REFERENCES
(1) Zuckerman, A. J. IARC monographs on the evaluation of carcinogenic risks to humans. J. Clin. Pathol. 1995, 48, 691−691. (2) Alberts, P.; Stander, M. A.; De Villiers, A. Development of a novel solid-phase extraction, LC-MS/MS method for the analysis of ethyl carbamate in alcoholic beverages: application to South African wine and spirits. Food Addit. Contam., Part A 2011, 28, 1−14. (3) Riachi, L. G.; Santos, A.; Moreira, R. F.; De Maria, C. A. A review of ethyl carbamate and polycyclic aromatic hydrocarbon contamination risk in cachaca and other Brazilian sugarcane spirits. Food Chem. 2014, 149, 159−169. (4) Weber, J. V.; Sharypov, V. I. Ethyl carbamate in foods and beverages: a review. Environ. Chem. Lett. 2009, 7, 233−247. (5) Wu, P.; Pan, X.; Wang, L.; Shen, X.; Yang, D. A survey of ethyl carbamate in fermented foods and beverages from Zhejiang, China. Food Control 2012, 23, 286−288. (6) Zhao, X.; Du, G.; Zou, H.; Fu, J.; Zhou, J.; Chen, J. Progress in preventing the accumulation of ethyl carbamate in alcoholic beverages. Trends Food Sci. Technol. 2013, 32, 97−107. (7) Jiao, Z.; Dong, Y.; Chen, Q. Ethyl carbamate in fermented beverages: presence, analytical chemistry, formation mechanism, and mitigation proposals. Compr. Rev. Food Sci. Food Saf. 2014, 13, 611−626. (8) Wu, Q.; Zhao, Y.; Wang, D.; Xu, Y. Immobilized Rhodotorula mucilaginosa: a novel urethanase-producing strain for degrading ethyl carbamate. Appl. Biochem. Biotechnol. 2013, 171, 2220−2232. (9) Zhou, N. D.; Gu, X. L.; Tian, Y. P. Isolation and characterization of urethanase from Penicillium variabile and its application to reduce ethyl carbamate contamination in Chinese rice wine. Appl. Biochem. Biotechnol. 2013, 170, 718−728. (10) Esti, M.; Fidaleo, M.; Moresi, M.; Tamborra, P. Modeling of urea degradation in white and rosé wines by acid urease. J. Agric. Food Chem. 2007, 55, 2590−2596. (11) Miyagawa, K.; Sumida, M.; Nakao, M.; Harada, M.; Yamamoto, H.; Kusumi, T.; Yoshizawa, K.; Amachi, T.; Nakayama, T. Purification, characterization, and application of an acid urease from Arthrobacter mobilis. J. Biotechnol. 1999, 68, 227−236. (12) Yang, L. Q.; Wang, S. H.; Tian, Y. P. Purification, properties, and application of a novel acid urease from Enterobacter sp. Appl. Biochem. Biotechnol. 2010, 160, 303−313. (13) Akinyanju, J. A.; Oyedeji, B. M. Comparative study of mixed flora and single strain fermentation in the production of plantain (Musa paradisiaca) wine. Acta Mater. 1993, 10, 975−977. (14) Lin, S. B.; Wu, Y. P.; Shen, F. L. Reveal the diversity of commercial spontaneously-fermented plum wines in their components by using single strain yeast-fermented plum wine. Taiwan J. Agric Chem. Food. 2005, 43, 162−170. (15) Guo, X. W.; Li, Y. Z.; Guo, J.; Wang, Q.; Huang, S. Y.; Chen, Y. F.; Du, L. P.; Xiao, D. G. Reduced production of ethyl carbamate for wine fermentation by deleting CAR1 in Saccharomyces cerevisiae. J. Ind. Microbiol. Biotechnol. 2016, 43, 671−679. (16) Wu, D.; Li, X.; Shen, C.; Lu, J.; Chen, J.; Xie, G. Decreased ethyl carbamate generation during Chinese rice wine fermentation by disruption of CAR1 in an industrial yeast strain. Int. J. Food Microbiol. 2014, 180, 19−23. (17) Wu, D.; Li, X.; Lu, J.; Chen, J.; Zhang, L.; Xie, G. Constitutive expression of the DUR1,2 gene in an industrial yeast strain to minimise ethyl carbamate production during Chinese rice wine fermentation. FEMS Microbiol Lett. 2016, 363, fnv214. (18) Wang, Z. M.; Lu, Z. M.; Shi, J. S.; Xu, Z. H. Exploring flavourproducing core microbiota in multispecies solid-state fermentation of traditional Chinese vinegar. Sci. Rep. 2016, 6, 26818. (19) Li, G.; Zhong, Q.; Wang, D.; Zhang, X.; Gao, H.; Shen, S. Determination and formation of ethyl carbamate in Chinese spirits. Food Control 2015, 56, 169−176. G
DOI: 10.1021/acs.jafc.7b05190 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry (40) Young, I.; Coleman, A. W. The advantages of the ITS2 region of the nuclear rDNA cistron for analysis of phylogenetic relationships of insects: a drosophila example. Mol. Phylogenet. Evol. 2004, 30, 236−242. (41) Schultz, J.; Maisel, S.; Gerlach, D.; Müller, T.; Wolf, M. A common core of secondary structure of the internal transcribed spacer 2 (ITS2) throughout the Eukaryota. RNA 2005, 11, 361−364. (42) Ahmed, I.; Yokota, A.; Yamazoe, A.; Fujiwara, T. Proposal of Lysinibacillus boronitolerans gen. nov sp nov., and transfer of Bacillus fusiformis to Lysinibacillus fusiformis comb. nov and Bacillus sphaericus to Lysinibacillus sphaericus comb. nov. Int. J. Syst. Evol. Microbiol. 2007, 57, 1117−1125. (43) Zhang, R.; Wu, Q. Use of lipopeptide compounds for improving sweet smell of white spirit and determination method of lipopeptide compounds. Chin. Patent CN 103571728, 2014.
H
DOI: 10.1021/acs.jafc.7b05190 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
