Environ. Sci. Technol. 2009, 43, 4188–4193
Biomarker Discovery and Transcriptomic Responses in Daphnia magna exposed to Munitions Constituents NATA ` L I A G A R C I A - R E Y E R O , †,⊥ H E L E N C . P O Y N T O N , ‡,⊥,# ALAN J. KENNEDY,§ XIN GUAN,| B. LYNN ESCALON,| BONNIE CHANG,‡ JULIA VARSHAVSKY,‡ ALEX V. LOGUINOV,‡ CHRIS D. VULPE,‡ A N D E D W A R D J . P E R K I N S * ,§ Department of Chemistry, Jackson State University, Jackson, Mississippi 39217, Nutritional Sciences and Toxicology and Berkeley Institute of the Environment, University of California, Berkeley, California 94720, United States Army Engineer Research and Development Center (ERDC), Vicksburg, Mississippi 39180, SpecPro, Vicksburg, Mississippi 39180
Received December 30, 2008. Revised manuscript received April 1, 2009. Accepted April 17, 2009.
Ecotoxicogenomic approaches are emerging as alternative methods in environmental monitoring because they allow insight into pollutant modes of action and help assess the causal agents and potential toxicity beyond the traditional end points of death, growth, and reproduction. Gene expression analysis has shown particular promise for identifying gene expression biomarkers of chemical exposure that can be further used to monitor specific chemical exposures in the environment. We focused on the development of gene expression markers to detect and discriminate between chemical exposures. Using a custom cDNA microarray for Daphnia magna, we identified distinctexpressionfingerprintsinresponsetoexposureatsublethal concentrations of Cu, Zn, Pb, and munitions constituents. Using the results obtained from microarray analysis, we chose a suite of potential biomarkers for each of the specific exposures. The selected potential biomarkers were tested in independent chemical exposures for specificity using quantitative reverse transcription polymerase chain reaction. Six genes wereconfirmedasdifferentiallyregulatedbytheselectedchemical exposures. Furthermore, each exposure was identified by response of a unique combination (suite) of individual gene expression biomarkers. These results demonstrate the potential for discovery and validation of novel biomarkers of chemical exposures using gene expression analysis, which could have broad applicability in environmental monitoring.
* Corresponding author phone: 601-634-2782; fax: 601-634-4002; address: ERDC, Halls Ferry Road 3909,Vicksburg, MS 39180. † Jackson State University. ‡ University of California. § United States Army Engineer Research and Development Center (ERDC). | SpecPro. ⊥ Both authors share first authorship. # Current address: Molecular Indicator Research Branch, U.S. Environmental Protection Agency, Cincinnati, OH 45268. 4188
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 43, NO. 11, 2009
Introduction At military training sites, a variety of pollutants may contaminate the area originating from used munitions. These contaminants, munitions constituents (MCs), include nitroaromatic compounds such as hexahydro-1,3,5-trinitro1,3,5-triazine (RDX) and 2,4,6-Trinitrotoluene (TNT) and the heavy metals copper (Cu), zinc (Zn), lead (Pb), and tungsten (W); they are also found in several sites included on the National Priorities List (Superfund) (1, 2). The MCs 2,4dinitrotoluene (2,4-DNT) and its isomer 2,6-DNT are used in a variety of manufacturing processes (e.g., production of dyes, munitions, and gelatinizing and plasticizing agents). Production of 2,4-DNT and its use in military training activities have resulted in its release to the aquatic environment (3). RDX and TNT have also been detected in the environment (4, 5), and several studies have reported their high toxicity to soil invertebrates at high doses (6). TNT degrades in soils and is also metabolized in animals to its major metabolites 2-amino-4,6-dinitrotoluene (2-ADNT) and 4-amino-2,6-dinitrotoluene (4-ADNT). Additionally, through photolysis or oxidation, it may be further broken down into 1,3,5-trinitrobenzene (TNB) and 1,3-dinitrobenzene (DNB) (1, 7). Studies investigating the mechanism of toxicity of MCs have shown that TNT causes oxidative stress (8, 9), while RDX affects the central nervous system causing seizures in humans and animals (10–12). Additionally, 2,4-DNT is known to affect oxygen transport and lipid metabolism in liver (13). One of the challenges with munitions-related pollution is its propensity to be present in mixtures of parent organic compounds and contaminants introduced during chemical production and their degradation products (1). With several different compounds present at a site, it is often difficult to discern which chemicals are responsible for toxicity. This challenge creates a pressing need to develop biologically relevant biomarkers of exposure and effect for MCs. While biomarkers have potential in monitoring and risk assessment, they also face challenges because of concerns about dose responsiveness and specificity in complex field environments (14). Ideally, biomarkers identified at the molecular level should predict adverse effects at the organism, population, or ecosystem level. Temporal and dose dependency changes in gene expression should be taken into consideration when determining mechanisms of action and gene expression patterns as transcriptome responses to exposure vary with dose and time and might not be linear (15). To be broadly useful, monitoring technologies should be able to quantify exposure and bioavailability and assess biological risks that chemicals may pose to biological systems. Ecotoxicogenomics provides an attractive alternative to single biomarker approaches as thousands of end points (mRNA levels, protein expression, and metabolite levels) are monitored for changes after exposure to an environmental stressor (16). Considering the entire set of genes together as a suite of biomarkers could provide a more robust alternative to single biomarker approaches. The aim of our present study is to develop a set of biomarkers to detect exposure to metals and MCs using the freshwater cladoceran, Daphnia magna. Cladocerans are good candidates for gene expression studies because of their short life cycle and their ability to reproduce through parthenogenesis maintaining relatively genetically homogeneous populations. Because MCs are usually found in chemical mixtures, our goal was to identify biomarkers that are specific for individual contaminants and capable of distinguishing causal agents. 10.1021/es803702a CCC: $40.75
2009 American Chemical Society
Published on Web 05/04/2009
In previous studies (17), we examined gene expression profiles for the metal toxicants Cu, Cd, and Zn in D. magna. We then analyzed how the expression profiles changed at high and low concentrations as well as the NOTEL (No Observed Transcriptional Effect Level) for these metals, providing evidence linking gene expression changes to traditional ecotoxicity end points (18). We then validated the ability of gene expression profiling to predict the presence of a toxicant in field samples and provided support for the application of the NOTEL approach to field samples (19). In the current study, we followed a similar approach to identify distinct expression fingerprints in response to MC exposures. We exposed D. magna to the metals Cu, Zn, Pb and WO4, the MCs RDX, 2,6-DNT, 4,6-DNT TNT, and their degradation products 2-ADNT, 4-ADNT, DNB and TNB. Using the results obtained from microarray analysis, we chose a suite of potential biomarkers that would produce a specific pattern of gene expression for each compound. Daphnia magna were then re-exposed to these compounds for a period of 24 h, and the selected candidate biomarkers were tested using quantitative reverse transcription polymerase chain reaction (qRT-PCR). Six genes were confirmed as being differentially expressed by the chemical exposure. Furthermore, gene expression analyses revealed a specific gene expression signature for each of the compounds tested. Gene expression changes were time dependent, not being detectable after 4 h of exposure but being differentially expressed after 24 h.
Materials and Methods Biological Exposures. The freshwater cladoceran, Daphnia magna, was obtained from the U.S. Army Engineer Research and Development Center (ERDC) in-house cultures (originally Aquatic Biosystems, Fort Collins, CO). Organisms were cultured at 25 ( 1 °C according to the U.S. Environmental Protection Agency (EPA) procedures (20) in hard reconstituted water (HRW) to provide ample calcium for reproduction (21) and received daily feeding rations of 1:1 Raphidocelis subcapitata and yeast-cerophyll-trout chow (YCT). Neonates were removed from the culture daily and aged 6-8 days for chemical exposure, while receiving a daily feeding ration as above. This age range was selected to provide adequate tissue mass for RNA extraction but to avoid potentially confounding physiological changes associated with reproductive maturity. Test organisms were exposed to reagent grade nitroaromatics or metals (described in detail in Table S1 of the Supporting Information) dissolved in moderately hard reconstituted water (MHRW), which provides a representative hardness level (80 mg/L as CaCO3) of natural freshwater bodies. Exposure concentrations of each chemical were based upon one-tenth of the median lethal concentration, inducing 50% mortality (LC50) in D. magna as determined from the literature (3) or from toxicity exposures conducted for this study (Table S1 of the Supporting Information). We chose the 1/10 LC50 concentration because this level is below acutely toxic levels that may lead to a nonspecific gene expression response. We have shown previously that as the concentration of a contaminant increases the proportion of genes responding that are specific to that contaminant decreases (18). In addition, we were more interested in finding genes that may be related to chronic effects. In general, the concentration corresponding to 1/10 LC50 is used to detect sublethal, chronic effects (22–24). Each chemical exposure consisted of a single concentration (i.e., 1/10th LC50) with four (or six) replicate 1 L beakers, each containing 80-100 D. magna for recovery of 20-30 mg of wet tissue. Each chemical exposure was conducted at 25 ( 1 °C side-by-side with a control (clean MHRW), with sampling points at 4 h and/or 24 h of exposure. After exposures, D. magna were
removed from the exposure media and preserved in RNAlater (Ambion, Austin, TX) at -80 °C until RNA was processed. Exposures were initially conducted for microarray analysis and later repeated for quantitative RT-PCR. Determination of Exposure Concentrations, Exposures, and Analytical Methods. Tungsten, copper, and zinc concentrations were determined directly using inductively coupled plasma mass spectrometry (ICP-MS), following modifications of EPA Method 6020 and using a PerkinElmer (Wellesley, MA) Elan DRC-II. The instrument was calibrated from a blank and a series of three standards (1, 10, and 100 µg/L), with linear correlation coefficients (R2) greater than 0.9999. Rhodium, yittrium, and terbium were added online as internal standards to correct for instrumental drift during the analysis. Second source check standards were used to verify instrument calibration, and concentrations were always within 10% of the nominal value. MCs were extracted and analyzed following modifications of EPA Method 8330 for high performance liquid chromatography (HPLC), using an Agilent 1100 Series (Agilent, Santa Clara, CA) equipped with an autosampler (catalog no. G1313A), degasser (catalog no. G1379A), quaternary pump (catalog no. G1311A), thermostatted column compartment (catalog no. G1316A) set at 38 °C, and a DAD UV detector monitored at 254 nm. The calibration consisted of six calibration points with a correlation factor of 0.99996 for RDX and 0.99999 for TNT. Second source check standards obtained from Ultra Scientific (catalog nos. NAIM-833A and NAIM-833B) were used to verify instrument calibration and were found to be within ( 10% of the expected value. Daphnia magna cDNA Microarray Construction. The microarray was constructed using two different libraries. First, 5000 randomly selected cDNA clones from the Daphnia Genome Consortium (DGC) library (generous gift from D. Bauer and J. Colbourne at Indiana University) were PCR amplified from the pDNR-LIB vector using the following primers: forward AGTCGACGGTACCGGACATA and reverse GCCAAACGAATGGTCTAGAAA. The cDNA clones were printed onto lysine-coated glass slides in the NST (Nutritional Science & Toxicology, University of California, Berkeley) Genomics Facility (25). In addition, a second set of 2681 cDNA clones was used that were enriched for genes whose expression was affected by exposure to target chemicals in Table S1 of the Supporting Information. Daphnia magna cDNA libraries were constructed using suppressive subtractive hybridization PCR (SSH). The SSH library was made using pooled mRNA (2 µg) extracted from unexposed D. magna against pooled mRNA (2 µg) from D. magna exposed for 24 h to each of the 12 MCs and metals found in Table S1 of the Supporting Information. Briefly, total RNA from exposed and unexposed D. magna was extracted using RNeasy Kits (Qiagen, Valencia, CA). The pooled total RNA was purified to obtain mRNA using a NucleoTrap Nucleic Acid Purification Kit (BD Biosciences, Franklin Lakes, NJ). Nuclease-free water (Ambion, Austin, TX) was used to elute total and poly(A) mRNA. A Clontech PCR-Select cDNA Subtraction Kit (BD Biosciences) was then used to enrich for differentially expressed genes using forward and reverse subtractions, following manufacturer protocol. PCR products of the libraries were then cloned using pCR4.0 vectors and Mach1T1 chemically competent cells (Invitrogen, Carlsbad, CA). The cDNA inserts were PCR amplified then purified using a Millipore Montage PCR 96 Cleanup Kit (Billerica, MA). Concentrations of randomly selected purified cDNAs were checked using PicoGreen (Molecular Probes, Eugene, OR). Concentrations of cDNA inserts ranged from 100-500 ng/ µL, with an average of 240 ng/µL. A 4 µL aliquot of the purified cDNA (55 µL in total) was sequenced using BigDye Terminator v3.1 and a 16 capillary ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA), according to manuVOL. 43, NO. 11, 2009 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
4189
facturer protocol. Detailed information about the microarray construction and design is available at the Gene Expression Omnibus (GEO) (located at http://www.ncbi.nlm.nih.gov/ geo) with the accession number GPL5129. Microarray Hybridization. Following exposure, D. magna preserved in RNAlater (Ambion, Austin, TX) were placed in a mortar. Liquid nitrogen was added to freeze the daphnids, and they were ground with a pestle. While frozen, Trizol was added, and RNA was isolated according to standard methods (Invitrogen, Carlsbad, CA). Before proceeding to reverse transcription, RNA from the unexposed and exposed D. magna was split into two pools to provide two dye-swapped technical replicates for each chemical exposure. Because three exposures were performed for each chemical and RNA from each exposure was hybridized to two different microarrays, there were six hybridizations for each exposure condition. Details related to the microarray hybridization procedure have been described previously (17). Information about the experimental design, raw signal intensity values, and other minimum information about a microarray experiment (MIAME) compliant data are available at the Gene Expression Omnibus (GEO) (located at http://www.ncbi. nlm.nih.gov/geo) with the accession number GSE13169. Identification of Candidate Differentially Expressed Genes. Statistical methods used to preprocess the data and identify differentially expressed genes are described in detail in Loguinov et al. (26). Briefly, raw intensities in each channel were corrected by subtracting local background. Log2 transformed intensity values were normalized by print-tip groups to remove possible nonlinearity, if any. We applied an approach based on sequential single-slide data analysis utilizing the R-outlier-generating model and outlier regions approach to identify differentially expressed cDNAs on each slide, correcting raw p-values for multiplicity of comparisons with q-values (26). An average false positive cutoff of 1 was applied to identify differential gene expression candidates. Differential cDNA expression was observed in both technical replicates, and two of the three biological replicates were chosen as candidate differentially expressed cDNAs to offset the allowance of 1 false positive in each single slide experiment. Candidate differentially expressed cDNAs were sequenced as described previously and closest protein homologues were determined by translated BLAST searches (http://greengene.uml.edu/Batch.html) and PredictProtein (http://www.embl-heidelberg.de/predictprotein/predictprotein.html). Because of the recent completion of the Daphnia pulex sequencing project, we also searched for homologues for the uncharacterized cDNAs in the D. pulex genome. Translated BLAST searches were conducted against the filtered gene models or predicted transcripts of the D. pulex genome from the D. pulex genome version 1.0 portal (http:// genome.jgi-psf.org/Dappu1/Dappu1.home.html). Predicted functions were assigned to these cDNAs based on the annotation of the homologous D. pulex transcript. Following homologue identification and functional assignment, cDNAs were grouped and analyzed for similarity. Vector NTI 7 and ContigExpress (Invitrogen, Carlsbad, CA) were used to organize sequences and group similar sequences into contigs. Table S2 of the Supporting Information shows the final list of differentially expressed genes. Log2 ratios were averaged over the six replicate experiments. The log2 ratios of all of the cDNAs that were assembled into a single contig representing one gene were again averaged so that one ratio is given for each gene for each condition. Genes that were differentially expressed (p < 0. 05) are represented in the heat map (Figure S1 of the Supporting Information). Quantitative Reverse Transcription PCR. To develop a PCR-based screening tool for MC exposure, microarray analysis was used to find differentially expressed genes to be used as potential biomarkers. Biomarkers were selected that 4190
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 43, NO. 11, 2009
were reproducible over the six microarray hybridizations for each chemical exposure, showed the largest degree of differential expression, and were not differentially expressed by any of the other 11 chemical exposures. When it was not possible to find candidate genes to meet all three requirements, we chose genes that were the most reproducible and had the largest degree of differential expression. Total RNA was extracted using RNeasy Kits (Qiagen, Valencia, CA) from about 10 to 30 mg of whole D. magna from each exposure vessel providing four replicates per treatment. An 800 ng total of RNA was first reverse transcribed into cDNA in a 20 µL reaction containing 250 ng of random primers and SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA), following manufacturer protocols. The synthesized cDNA was diluted to 10 ng/µL. qRT-PCR was performed on an ABI Sequence Detector 7900 (Applied Biosystems, Foster City, CA). Each 20 µL reaction was run in duplicate and contained 6 µL of synthesized cDNA template, along with 2 µL of each forward and reverse primer (5 µM/ µL) and 500 nM SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA). Cycling parameters were 95 °C for 15 min, 40 cycles of 95 °C for 15 s, and 60 °C for 1 min. Primer pairs for lectin, β-glucan binding protein (BGBP), 18S rRNA, and chitinase were designed using Primers3 software (27). The remaining primers were designed using Primer Express (Applied Biosystems, Foster City, CA). Primers were synthesized by Operon Biotechnologies (Huntsville, AL). Sequences for all of the primers can be found in Table S3 of the Supporting Information.
Results and Discussion Gene Expression Analysis. Daphnia magna were exposed at one-tenth of the LC50 values specific to 12 different compounds to determine how these toxicants affected gene expression at sublethal concentrations. Gene expression analysis was assessed using a 7681 clone cDNA microarray, containing expressed genes cloned from unexposed D. magna in addition to D. magna exposed individually to DNB, 2,4-DNT, 2,6-DNT, TNB, TNT, RDX, sodium tungstate, lead chloride, copper sulfate, or zinc chloride. The complete list of differentially expressed genes and their corresponding log2 expression ratios for each exposure condition are given in Table S2 of the Supporting Information, and the major protein functions affected by each treatment are summarized in Table 1. Metals. The metals Cu and Zn affected many of the same genes and pathways described in previous exposures (17). They caused up-regulation of two metallothionein genes and down-regulation of genes involved in immune response and digestion. In addition, Zn exposure resulted in downregulation of many genes involved in exoskeletal maintenance, which was previously correlated with a decrease in chitinase enzyme activity (17). Interestingly, tungstate (WO4) showed a very similar pattern of differential expression to Zn (Figure S1 of the Supporting Information). Tungsten has recently received attention as it was associated with cases of acute lymphocytic leukemia but still very little is known about the mechanism of its toxicity (2). The similarity in the gene expression patterns of Zn and WO4 implies a shared mode of action. However, one difference between these expression profiles is the up-regulation of cell cycle related genes by WO4, suggesting a possible role in cell proliferation. Several studies show that W induces the expression of genes involved in DNA damage repair and oxidative stress (28), and it is a reproductive toxicant for earthworms, which by comparison demonstrates that its sublethal toxicity is greater than that of lead (2, 29). Lead (Pb) had a distinct pattern of differential expression, when compared with the other metals (Figure S1 of the Supporting Information). One notable functional category affected by Pb exposure was metal binding proteins involved
TABLE 1. Major Protein Functions Affected in Daphnia magna Exposed to Ordnance-Related Compounds and Metals Determined by Gene Expression Analysis treatment RDX
TNT 2-ADNT 4-ADNT 2,4-DNT 2,6-DNT DNB TNB
Cu
Zn
Pb
WO4
up-regulated cytoskeletal proteins exoskeletal proteins peptidase function metal binding proteins (ferritins) oxidative stress response -
down-regulated cellular transport
digestion cytoskeletal proteins exoskeletal proteins exoskeletal proteins
exoskeletal proteins reproduction related proteins (VTG) developmental proteins peptidase function cellular metabolism exoskeletal proteins dehydrogenase function developmental oxidative stress response proteins cellular metabolism dehydrogenase function exoskeletal proteins oxidative stress response reproduction related proteins (VTG) oxidative stress response cell cycle regulation metal binding proteins (MT) cellular metabolism cytoskeletal proteins digestion exoskeletal proteins immune response metal Binding proteins (MT) cellular Metabolism digestion exoskeletal proteins fatty acid binding proteins immune response peptidase function cellular metabolism exoskeletal proteins metal binding proteins oxidative stress response peptidase function cell cycle regulation cellular Metabolism digestion exoskeletal proteins fatty acid binding proteins immune response peptidase function
in iron transport, including ferritins, heme-binding proteins, and hemoglobin. Ferritin up-regulation has also been observed in fathead minnows (Pimephales promelas) exposed chronically to Pb (30). Lead disrupts heme synthesis by inhibiting the enzyme δ-aminolevulinic acid dehydratase (31). The up-regulation of heme-binding proteins, including hemoglobin, may be a compensatory response to reduced heme levels. Hemoglobin induction has also been observed following Pb exposure in chironomids (32), and other studies have found a complex response pattern of hemoglobin content after exposure to copper, cadmium, and lead (33–35). To confirm the microarray results and better understand the effect of these metals on hemoglobin gene expression in D. magna, we performed a Northern blot analysis of hemoglobin after exposure to Cu, Cd, and Pb at two concentrations. Hemoglobin (U67067) gene expression was affected by Pb at both concentrations, but Cu and Cd had no effect on its expression (Figure S3 of the Supporting Information). MCs. RDX exhibited a robust gene expression pattern affecting diverse pathways involved in exoskeletal maintenance such as protein catabolism, cell structure, and cellular transport (Table 1 and Table S2 of the Supporting Information). The ability of daphnids to reproduce is directly related to their molting activity, a highly coordinated process regulated by arthropod hormones, and requires chitinase activity and the synthesis of new cuticle proteins (36). The
dysregulation of many genes involved in exoskeletal maintenance, including chitinases and cuticle proteins, suggests that reproduction may be affected. Although acute lethal toxicity to RDX is low, effects on reproduction have been documented following chronic exposure to low levels of RDX (
