Biosynthesis of Thermoresponsive Magnetic Nanoparticles by

Subscriber access provided by UNIV OF YORK

Biosynthesis of Thermo-Responsive Magnetic Nanoparticles by Magnetosome Display System Tomoko Yoshino, Takumi Shimada, Yasuhito Ito, Toru Honda, Yoshiaki Maeda, Tadashi Matsunaga, and Tsuyoshi Tanaka Bioconjugate Chem., Just Accepted Manuscript • DOI: 10.1021/acs.bioconjchem.8b00195 • Publication Date (Web): 12 Apr 2018 Downloaded from http://pubs.acs.org on April 12, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry

Biosynthesis of Thermo-Responsive Magnetic Nanoparticles by Magnetosome Display System

Tomoko Yoshino*, Takumi Shimada, Yasuhito Ito, Toru Honda, Yoshiaki Maeda, Tadashi Matsunaga, Tsuyoshi Tanaka

Division of Biotechnology and Life Science, Institute of Engineering, Tokyo University of Agriculture and Technology, 2-24-16, Naka-cho, Koganei, Tokyo 184-8588, Japan

*Author to whom correspondence should be addressed 2-24-16, Naka-cho, Koganei, Tokyo 184-8588, Japan E-mail; [email protected] Tel.: +81-42-388-7021; Fax: +81-42-385-7713.

1

ACS Paragon Plus Environment

Bioconjugate Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Thermo-responsive magnetic nanoparticles (MNPs) were synthesized using a magnetosome display system. An elastin-like polypeptide decamer of VPGVG (ELP10), which is hydrophobic above the transition temperature (Tt) and can form an insoluble aggregation, was immobilized on biogenic MNPs in the magnetotactic bacterium, Magnetospirillum magneticum AMB-1. It was suggested that hydrophobicity of the MNP surface increased at 60ºC compared with 20ºC by the immobilization of ELP10. Size distribution analysis indicated that the immobilization of ELP10 onto MNPs induced the increased hydrophobicity with increasing temperatures up to 60ºC, promoting aggregation of the particles by hydrophobic and magnetic interactions. These results suggest that the acceleration of magnetic collection at 60°C was caused by particle aggregation promoted by hydrophobic interaction between ELP-MNPs. Furthermore, the immobilization of ELP on MNPs gave a quick magnetic collection at 60ºC by external magnetic field. The thermo-responsive properties will further expand the utility of biotechnological applications of biogenic MNPs.

2


Page 2 of 23

Page 3 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Magnetic nanoparticles (MNPs) have been used for various applications in the field of biotechnology. These applications include cell separation, DNA and protein recovery, magnetic resonance imaging (MRI), drug delivery, and hyperthermia

1, 2

. MNPs have several advantages for

biotechnological application, including easy manipulation by magnetic force and a large surface area per unit volume, which allows immobilization of many probes on a surface. An attractive approach is the functionalization of the MNP surface with stimuli-responsive materials

3-7

. As an example,

thermo-sensitive MNPs have been synthesized by the attachment of poly-(N-isopropylacrylamide) (NIPAAm) and its copolymers

8-10

. NIPAAm exhibits a reversible transition between soluble and

insoluble states in water according to temperature. Thus, the dispersity and aggregation of MNPs can be controlled by temperature. This allows, for example, high dispersity of MNPs during reaction and quick magnetic separation after reaction by changing the temperature. Issues to be solved include the labor-intensive and time-consuming nature of the chemical immobilization, in particular when multiple functional components including antibodies, enzymes or receptors, besides NIPAAm, are co-immobilized on the MNPs towards specific purposes such as enzyme-linked immunosorbent assay and drug screening. We have proposed a novel method for the synthesis of functional MNPs by a “magnetosome display system” using the magnetotactic bacterium, Magnetospirillum magneticum AMB-1. The magnetosome is a unique organelle that is arranged intracellularly in magnetotactic bacteria. It is easily purified from cell lysate using a permanent magnet. Each magnetosome (MNPs) in the bacterial cells observed with transmission electron microscopy is 10 to 80 nm (48.3 ± 12.5 nm, mean ± standard deviation)11 in size, and is covered by a lipid bilayer membrane. In the magnetosome display system, useful proteins can be immobilized on MNPs using the Mms13 protein as a fusion partner by genetic engineering because Mms13 is a major protein that is tightly bound to MNPs 12, 13. Many recombinant proteins, such as antibodies, enzymes, G protein-coupled receptor, and tyrosine 3



Page 4 of 23

kinase receptor have been successfully immobilized on MNPs by the magnetosome display system, and applied to ligand screening assays

14, 15

, enzyme reaction 16, and cell separation systems

17, 18

. It

has been also reported that multiple functional proteins can be readily displayed on MNPs by specifically designing the transformation vectors

19-21

. Therefore, the magnetosome display system

has the potential to functionalize the MNP surface by stimulus-responsive proteins as well as other functional proteins in a way that is not labor-intensive or time-consuming. In this study, the magnetosome display system was employed to immobilize elastin-like polypeptide (ELP) on MNPs to synthesize thermo-responsive MNPs (Fig. 1A). ELP is a thermally responsive biopolymer composed of the pentapeptide repeat (Val-Pro-Gly-Xaa-Gly), where the “guest residue” Xaa can be any amino acid residues, except proline 22. These properties of ELP could accelerate the use of the biopolymer to biotechnological and medical applications, such as tissue engineering

23, 24

, purification of recombinant proteins

25, 26

, and as a drug carrier

27-29

. ELP is

hydrophobic above the transition temperature (Tt) and can form an insoluble aggregate. Below the Tt, ELP is hydrophilic and deforms the aggregate. Here, the effect of ELP on magnetic separation behaviors of biogenic MNPs was evaluated.

4


Page 5 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 1. (A) Schematic diagram of the thermo-responsive behavior of ELP-MNPs. (B) Procedure for the production of ELP-MNPs by magnetosome display system.

RESULTS AND DISCUSSION Display of ELP10 on MNPs The magnetosome display system was employed for the production of ELP, which is a decamer of VPGVG (ELP10), and magnetic nanoparticle complexes (ELP10-MNPs) (Fig. 1B). ELP10 was fused to the C-terminus of the magnetosome membrane-anchored protein Mms13 along with a FLAG tag (Fig. 1B). ELP10-MNPs were purified from the cell lysate of the magnetotactic bacterium by magnetic separation. Expression and localization of Mms13-FLAG tag-ELP10 fusion protein (approximately 19 kDa) on the MNPs was confirmed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (Fig. 2A). The fusion protein was detected at the predicted size, and showed the major band among the magnetosome membrane proteins. We further confirmed that this major band 5



contains the fusion protein by Western blotting analysis using anti-FLAG tag antibody (Fig. 2B). Based on the band intensity in SDS-PAGE, it was estimated that the amount of the displayed ELP10 was 57 molecules/MNP (Fig. S1). To assess whether the fusion protein was displayed on the surface of MNPs, enzyme-linked immunosorbent assay (ELISA) using anti-FLAG tag antibody was also carried out on the MNPs. As a result, significant binding of the antibody was confirmed on the ELP10-MNPs, while little was bound on the non-functionalized MNPs (Fig. 2C). These results indicate that ELP10-MNPs were successfully prepared by magnetosome display system. As is the case with ELP10-MNPs, preparation of ELP20- and ELP30-MNPs were also confirmed (Fig S2 and S3).

Fig. 2 Display of ELP10 on MNPs. (A) SDS-PAGE for magnetosome membrane proteins. The arrow head indicates the Mms13-FLAG tag-ELP10 fusion protein, (B) Western blotting with ALP-labeled anti-FLAG tag antibody for magnetosome membrane proteins, (C) Antibody-binding assay for ELP10-MNPs with ALP-labeled anti-FLAG tag antibody. Lane 1 and 2 represent the ELP10-MNPs and non-functionalized MNPs, respectively. Lane M represents molecular marker.

Size distributions of ELP10-MNPs 6


Page 6 of 23

Page 7 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3 shows the particle size distributions of non-functionalized MNPs and ELP10-MNPs in aqueous solution at different temperatures (see also Fig. S4). Non-functionalized MNPs showed a wide size distribution ranging from approximately 100 to 400 nm, regardless of the temperature. The mean diameter of non-functionalized MNPs was 258 ± 79 nm at 20ºC, 234 ± 65 nm at 30ºC, 224 ± 55 nm at 40ºC, and 239 ± 54 nm at 60ºC. It should be noted that the particle size analyzed by dynamic light scattering is hydrodynamic diameter of particles. In our previous studies, we revealed that the size of the MNPs in the bacterial cells analyzed by transmission electron microscopy ranged from 10 to 80 nm (48.3 ± 12.5 nm, mean ± standard deviation)11. After MNPs were extracted from the cells, and were washed through the repeated process of magnetic separation and re-suspension in HEPES buffer (see also Experimental procedures section), the size distribution of the monodispersed recombinant MNPs shifted to larger range (61.9 ± 50.5 nm)30 due to loss of small MNPs during the washing steps. The MNPs dispersed in aqueous solution (1 µg/ml) formed slightly larger aggregates. This could be due to spontaneous aggregation by magnetic interaction between MNPs. Similar size distributions were observed in ELP10-MNPs at 20ºC and 30°C, while the size distributions at more than 40ºC shifted to the larger diameter, indicating that ELP10-MNPs formed larger aggregates at 40oC. In general, biogenic MNPs (magnetosomes) have good dispersion in aqueous solutions (mean diameter: 0.12 µm), although biogenic MNPs without a membrane form larger aggregates (mean diameter: 12.5 µm) 31. MNPs are covered with a lipid bilayer membrane that is composed mainly of phosphatidylethanolamine. The membrane is a significant determinant of the aqueous dispersion characteristics of MNPs. We assume that the immobilization of ELP10 onto MNPs could potentially induce the hydrophobic property at higher temperatures, promoting particle aggregation by hydrophobic interaction in addition to magnetic interaction. This assumption is based on the previous studies reporting that (1) conformation change of ELPs in response to temperature variation increased hydrophobicity of the ELP surface proteins35,

36

32-34

, and (2) various types of materials (including

and nanoparticles36-39) conjugated with ELPs aggregated with the aid of ELP 7



conformation change. Increase in hydrophobicity of MNP surface in response to temperature was suggested by fluorescent probe-binding assay using 1-anilino-8-naphthalene-sulfonic acid (ANS) (Fig. S5). It would be ideal to directly confirm the conformation change of ELPs on MNPs. However, as shown by SDS-PAGE (Fig. 2A), the MNPs contain not only Mms13-FLAG tag-ELP10 fusion protein but also other magnetosome-membrane proteins abundantly. Therefore, it is difficult to confirm the conformation change of ELPs on MNPs by circular dichroism (CD) spectrometry. Instead, we chemically synthesized the ELP10 without any fusions, and at least, confirmed the conformation change in response to temperature variation by CD spectrometry (Fig. S6). The transition temperature (Tt) of ELP10 fused to MNPs was estimated from the variation of average particle diameters as a function of temperature (Fig. 3). Tt of the hydrophilic-hydrophobic transition was expected to be the temperature between 30°C and 40°C. Tt of ELP10 molecule itself, (VPGVG)10 was simulated as 72 ± 5°C

40

, so the estimated values in this assay were much lower than the

theoretical value. Tt depends on the solution composition, salt concentration, pH, composition of the guest residues, and other factors. Tt is easily controlled by changing the guest residue and ELP chain length 40-42. Furthermore, Tt can be changed by the immobilization of ELPs on particles or fusion of ELPs to other proteins

36-39

. In particular, Trabbic-Carlson et al. reported that larger decrease in Tt

was observed when ELPs were fused to the proteins with larger fraction of hydrophobic surface 36. They explained that this phenomenon could be attributed to the release of hydration water molecules from the hydrophobic surface in molecular proximity to ELPs; more water molecules were released from larger hydrophobic surface of the fusion partner, leading to a greater increase in entropy. In this study, ELP10 was fused with a magnetosome membrane protein Mms13, which is hydrophobic transmembrane protein, and consequently conjugated with MNPs which contain lipid bilayer membrane and various proteins. These molecules or part of thereof could contribute to release the water molecules, resulting in decrease in Tt.

8


Page 8 of 23

Page 9 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3 Relationship between average MNP sizes and temperature in non-functionalized MNPs and ELP10-MNPs. Size distribution of MNPs (1 µg/ml in HEPES buffer at pH7.4) was analyzed by dynamic light scattering, and mean and standard deviation were calculated from the histogram data of the size distribution. Data represent the mean ± standard deviation.

Thermo-responsive magnetic separation behaviors of ELP-MNPs The magnetic separation behavior of the ELP10-MNPs was evaluated in aqueous conditions. ELP10-MNPs suspended in HEPES buffer were magnetically collected in a cuvette and the optical density at 660 nm (OD660) was monitored with time at 20°C or 60°C. A permanent magnet was placed onto the upper side of cuvette immediately after the dispersion of MNPs. OD660 at 20ºC gradually decreased and reached to zero at 60 sec. In contrast, the OD values at 60ºC decreased more quickly (Fig. 4). These results strongly suggest that the acceleration of magnetic collection at 60°C was caused by particle aggregation promoted by hydrophobic interaction between ELP10-MNPs. Similar magnetic separation behaviors correlated to particle aggregation were studied with thermos-sensitive polymer-coated MNPs 43. Therefore, we assume that magnetic separation behavior of ELP10-MNPs as a function of temperature could be consistent with Figure 3.

9



It should be noted that aggregation of ELP10-MNPs in response to elevating temperatures observed in the present study should not be caused by variation of magnetization but by variation of surface properties due to ELP10-display. The effect of temperature on the magnetic properties of magnetosomes was analyzed in our previous studies where general magnetic properties, i.e., coercive force (Hc) and the ratio of residual magnetization and saturation magnetization (Mr / Ms) were reported 44, 45. These studies support the general notion that magnetic properties such as Hc and Mr /

Ms decrease with elevating temperatures. Therefore, we consider that the variation of magnetization in ELP10-MNPs cannot contribute to induction of aggregation. Variation of OD might be affected by not only magnetic separation but also other phenomena such as downward settling of MNPs. Therefore, we monitored the OD variation of ELP10-MNP suspension at 20 and 60°C in the absence of magnetic field (Fig. S7). Downward settling of ELP10-MNPs at 60°C was more rapid than that at 20°C. However, even at 60°C, the settling took more than 7 min, suggesting that, during the time range for magnetic separation of ELP10-MNPs shown in Figure 4 (within 1 min), the effect of downward settling could be limited. In addition, it was previously reported that ELP showed concentration-dependent phase transition behaviors; ELP at higher concentration was more easily aggregated over the concentration rage of ~1 µM to ~1 mM 46. However, in the case of ELP10-MNPs, existence of magnetite core hampered the analysis with such a wide range of concentrations (three order of magnitude). When we increase the concentration by an order of magnitude, the MNP suspension becomes too dense, and thus it is difficult to precisely measure the OD. Instead, we decreased the concentration of ELP10-MNPs in half (125 µg/ml), and assessed its effects on the phase behavior at 60°C. As a result, decrease in relative OD of 125 µg/ml ELP10-MNPs was slower than that of 250 µg/ml (Fig. S8). This data suggests that ELP10-MNPs at higher concentration showed more aggregation.

10


Page 10 of 23

Page 11 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Incidentally, no significant difference in magnetic separation behaviors among the three MNPs was observed (Fig. S9). These results indicate that the decamer of VPGVG (ELP10) is sufficient to regulate the magnetic separation behavior of MNPs. The reversibility of the magnetic separation behavior of ELP10-MNPs was investigated. ELP10-MNP suspensions were magnetically collected at 20ºC and the OD660 was monitored (Fig. 5A). Collected MNPs were re-suspended in HEPES buffer and the magnetic response at 60ºC was investigated as described above (Fig. 5B). The collected MNPs were re-suspended again, and the OD660 at 20ºC was monitored (Fig. 5C). Similar response curves were observed in Figures 5A and 5C, indicating that the magnetic response of ELP10-MNPs was reversible. MNPs are characterized by higher reaction efficiency due to their greater surface area. In particular, biogenic MNPs synthesized by the magnetosome display system are covered with a lipid bilayer membrane as described above. The lipid membrane is negatively charged at neutral pH, resulting in high dispersity of MNPs in aqueous conditions. The biogenic MNPs permit the development of highly sensitive immunoassays by immobilizing antibody to their surfaces based on good dispersion

30

. In contrast, magnetic separation of MNPs becomes difficult with increasing

dispersity. In this study, the immobilization of ELP onto MNPs gave a quick response to external magnetic field, compared with non-functionalized MNPs. These characteristics of MNPs in terms of quick separation and high dispersity in aqueous solutions are valuable for biotechnological applications, such as magnetic cell separation, immunoassays, and drug delivery systems.

11



Figure 4 Time course variations of optical density at 660 nm (OD660) of ELP10-MNPs (250 µg/ml) with application of magnetic field. ELP10-MNPs were incubated at 20°C (closed circles) or 60°C (open circles), and OD660 was measured. The initial OD660 was defined to be 100%.

12


Page 12 of 23

Page 13 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5 Reversibility of magnetic separation behavior of ELP10-MNPs when the MNPs were collected using a magnet. (A) Magnetic response of ELP10-MNPs at 20°C. (B) Magnetic response of re-suspended ELP10-MNPs (A) at 60°C. (C) Magnetic response of re-suspended ELP10-MNPs (B) at 20°C.

EXPERIMENTAL PROCEDURES Bacterial strains and culture conditions Escherichia coli strain TOP10 (Invitrogen, Carlsbad, CA, USA) was used as the hosts for gene cloning, and was cultured in lysogeny broth (LB) medium containing 50 µg/ml ampicillin at 37°C. M. 13



Page 14 of 23

magneticum AMB-1 (ATCC 700264) was microaerobically cultured in magnetic spirillum growth medium (MSGM) at 28°C as previously described 47. AMB-1 transformants were cultured under the same conditions in MSGM containing 5 µg/ml ampicillin.

Construction of transformants ELP was synthesized with optimized codon usage for M. magneticum AMB-1 (pIDTSMART-AMP: polypeptide E, Integrated DNA Technologies, Coralville, IA). ELP was amplified with forward primer 5′-TGCCGCGCGGCAGCGACTACAAGGACGACGACGACAAAACTAGTGTCCCGGGAGTG -3′

(containing

FLAG-tag

sequence)

and

reverse

primer

5′-TTTTTCAATAATATTTCAGCTAGCCCCCACACCG-3′ using pIDTSMART-AMP: polypeptide E as a template. The PCR fragment was digested with NheI and SspI, and was ligated into SspI-digested pUMGP16M13, which expresses mms13 and fusion genes under control of the Mms16 promoter. The constructed plasmid was designated pUM13ELP10 (Fig. S2). The ELP fragment was obtained by cleaving pIDTSMART-AMP: polypeptide E with NheI and SspI, and ligated into NheI-digested pUM13ELP10 (pUM13ELP20). The same ELP fragment was ligated into NheI-digested pUM13ELP20 (pUM13ELP30). The constructed plasmids pUM13ELP10, pUM13ELP20, and pUM13ELP30 were introduced into AMB-1 by electroporation as described previously 48.

Preparation of MNPs M. magneticum AMB-1 cells cultured in 5 l of MSGM were collected by centrifugation at 9,000 × g for 10 min at 4°C. The cells were re-suspended in 40 ml of 10 mM HEPES buffer (pH 7.4) and were disrupted by passing through a French press at 1,500 kg/cm2 (Ohtake Works, Tokyo, Japan). MNPs were collected from the disrupted cells using a columnar neodymium-iron-boron (Nd-Fe-B) magnet. The MNPs were washed 10 times with HEPES buffer and stored at 4°C. The concentration of MNPs 14


Page 15 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in suspension was determined by measuring OD660 using a UV-2200 spectrophotometer (Shimadzu, Kyoto, Japan). A value of 1.0 corresponded to 172 µg of MNPs (dry weight)/ml.

Fluorescent analysis of MNPs with ANS ANS was added to a suspension of MNPs (300 µg/ml) to achieve a final concentration of 50 µM. After pulsed sonication, the suspension was put into a fluorescence spectroscopy cell folder (FluoroMax-4; Horiba Scientific, Kyoto, Japan) and the fluorescence intensities were measured at an excitation and emission wavelength of 371 nm and 517 nm, respectively. The temperature of the suspension was maintained at 20 or 60°C during measurement.

Analysis of particle size distribution of MNPs The size distribution of MNPs was measured using a Particle Sizer and Zeta Potential Analyzer (Zetasizer nano-s; Malvern, Worcestershire, UK). MNPs (1 µg/ml) were suspended into 1 ml HEPES buffer (pH 7.4) at 20 to 60°C to achieve a final concentration of 1 µg/ml. Solutions were sonicated prior to measurement at 20-60°C.

Evaluation of magnetic separation behavior of MNPs To evaluate the effect of temperature on magnetic collection, optical density of MNP suspension was monitored by a spectrophotometer. MNPs (50 µg) were suspended in 200 µl of HEPES buffer (pH7.4) at 20 or 60°C, and then OD660 was measured every 5 sec with a column-shaped Nd-Fe-B magnet (1 cm in height and 1 cm in diameter, surface magnetic flux density: 450 mT) placed on the cell folder.

Enzyme-linked Immunosorbent Assay (ELISA) ELP10-MNPs, ELP20-MNPs or ELP30-MNPs (50 µg) were mixed with alkaline phosphatase (ALP) 15



conjugated mouse anti-FLAG antibody (1 µg/ml) in 100 µl of phosphate buffered saline containing 0.1% Tween 20 (PBST). The mixtures were incubated for 30 min at room temperature with pulsed sonication every 10 min. The MNPs were then magnetically separated and washed three times with 200 µl of PBST with sonication. After washing, the MNPs were resuspended in 50 µl of PBS, followed by the addition of 50 µl of Lumi-Phos 530 as a luminescence substrate. After 5 min of incubation, the luminescence intensity was measured.

Statistics For the analysis of MNP size distribution, statistical analysis was performed with Fisher’s exact test using R ver. 3.2.5 as if the data are categorical (Fig. S4). Significant difference was assessed with an α level of 0.05.

SUPPORTING INFORMATION This information is available free of charge via the Internet at http://pubs.acs.org.

ABBREVIATIONS ANS, 1-anilino-8-naphthalene- sulfonic acid; ALP, alkaline phosphatase; MNP, magnetic nanoparticle; ELISA, Enzyme-linked Immunosorbent Assay; ELP, elastin-like polypeptide; NIPAAm, poly-(N-isoproplyacrylamide); MSGM, magnetic spirillum growth medium; PBST, phosphate buffered saline with Tween 20; Tt, transition temperature; WT, wild type

AUTHORS ORCID INFORMATION ORCID of the corresponding author: 0000-0002-4505-2774

ACKNOWLEDGEMENTS 16


Page 16 of 23

Page 17 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


This study was in part supported by Japan Society for the Promotion of Science (JSPS) KAKENHI Grant Numbers 17H03466 (Grant-in-Aid for Scientific Research B).

CONFLICT OF INTEREST The authors declare that there is no conflict of interest associated with this manuscript.

17



REFERENCES (1)

Gao, J., Gu, H., and Xu, B. (2009) Multifunctional magnetic nanoparticles: design, synthesis, and biomedical applications. Acc. Chem. Res. 42, 1097-1107.

(2)

Mornet, S., Vasseur, S., Grasset, F., and Duguet, E. (2004) Magnetic nanoparticle design for medical diagnosis and therapy. J. Mater. Chem. 14, 2161-2175.

(3)

Stuart, M. A., Huck, W. T., Genzer, J., Muller, M., Ober, C., Stamm, M., Sukhorukov, G. B., Szleifer, I., Tsukruk, V. V., Urban, M., et al. (2010) Emerging applications of stimuli-responsive polymer materials. Nat. Mater. 9, 101-113.

(4)

Shimoboji, T., Larenas, E., Fowler, T., Kulkarni, S., Hoffman, A. S., and Stayton, P. S. (2002) Photoresponsive polymer-enzyme switches. Proc. Natl. Acad. Sci. U. S. A. 99, 16592-16596.

(5)

Sumaru, K., Kameda, M., Kanamori, T., and Shinbo, T. (2004) Characteristic phase transition of aqueous solution of poly (N-isopropylacrylamide) functionalized with spirobenzopyran. Macromolecules 37, 4949-4955.

(6)

Bhattarai, N., Ramay, H. R., Gunn, J., Matsen, F. A., and Zhang, M. (2005) PEG-grafted chitosan as an injectable thermosensitive hydrogel for sustained protein release. J. Control. Release 103, 609-624.

(7)

Motornov, M., Sheparovych, R., Lupitskyy, R., MacWilliams, E., Hoy, O., Luzinov, I., and Minko, S. (2007) Stimuli-responsive colloidal systems from mixed brush-coated nanoparticles. Adv. Funct. Mater. 17, 2307-2314.

(8)

Kondo, A., Kamura, H., and Higashitani, K. (1994) Development and application of thermo-sensitive magnetic immunomicrospheres for antibody purification. Appl. Microbiol. Biotechnol. 41, 99-105.

(9)

Lea, T., Vartdal, F., Nustad, K., Funderud, S., Berge, A., Ellingsen, T., Schmid, R., Stenstad, P., and Ugelstad, J. (1988) Monosized, magnetic polymer particles: their use in separation of cells and subcellular components, and in the study of lymphocyte function in vitro. J. Mol. 18


Page 18 of 23

Page 19 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Recognit. 1, 9-18. (10)

Ohnishi, N., Furukawa, H., Hideyuki, H., Wang, J.-M., An, C.-I., Fukusaki, E., Kataoka, K., Ueno, K., and Kondo, A. (2006) High-efficiency bioaffinity separation of cells and proteins using novel thermoresponsive biotinylated magnetic nanoparticles. NanoBiotechnology 2, 43-49.

(11)

Tanaka, M., Mazuyama, E., Arakaki, A., and Matsunaga, T. (2011) Mms6 protein regulates crystal morphology during nano-sized magnetite biomineralization in vivo. J. Biol. Chem. 286, 6386-6392.

(12)

Arakaki, A., Webb, J., and Matsunaga, T. (2003) A novel protein tightly bound to bacterial magnetic particles in Magnetospirillum magneticum strain AMB-1. J. Biol. Chem. 278, 8745-8750.

(13)

Yoshino, T., and Matsunaga, T. (2006) Efficient and stable display of functional proteins on bacterial magnetic particles using mms13 as a novel anchor molecule. Appl. Environ. Microbiol. 72, 465-471.

(14)

Yoshino, T., Kato, F., Takeyama, H., Nakai, M., Yakabe, Y., and Matsunaga, T. (2005) Development of a novel method for screening of estrogenic compounds using nano-sized bacterial magnetic particles displaying estrogen receptor. Anal. Chim. Acta 532, 105-111.

(15)

Yoshino, T., Kaji, C., Nakai, M., Saito, F., Takeyama, H., and Matsunaga, T. (2008) Novel method for evaluation of chemicals based on ligand-dependent recruitment of GFP labeled coactivator to estrogen receptor displayed on bacterial magnetic particles. Anal. Chim. Acta 626, 71-77.

(16)

Honda, T., Tanaka, T., and Yoshino, T. (2015) Stoichiometrically controlled immobilization of multiple enzymes on magnetic nanoparticles by the magnetosome display system for efficient cellulose hydrolysis. Biomacromolecules 16, 3863-3868.

(17)

Yoshino, T., Hirabe, H., Takahashi, M., Kuhara, M., Takeyama, H., and Matsunaga, T. (2008) 19



Page 20 of 23

Magnetic cell separation using nano-sized bacterial magnetic particles with reconstructed magnetosome membrane. Biotechnol. Bioeng. 101, 470-477. (18)

Takahashi, M., Akiyama, Y., Ikezumi, J., Nagata, T., Yoshino, T., Iizuka, A., Yamaguchi, K., and Matsunaga, T. (2009) Magnetic separation of melanoma-specific cytotoxic T lymphocytes

from

a

vaccinated

melanoma

patient's

blood

using

MHC/peptide

complex-conjugated bacterial magnetic particles. Bioconjug. Chem. 20, 304-309. (19)

Matsunaga, T., Togo, H., Kikuchi, T., and Tanaka, T. (2000) Production of luciferase-magnetic particle complex by recombinant Magnetospirillum sp. AMB-1. Biotechnol. Bioeng. 70, 704-709.

(20)

Maeda, Y., Yoshino, T., and Matsunaga, T. (2009) Novel nanocomposites consisting of in vivo-biotinylated bacterial magnetic particles and quantum dots for magnetic separation and fluorescent labeling of cancer cells. J. Mater. Chem. 19, 6361-6366.

(21)

Honda, T., Tanaka, T., and Yoshino, T. (2015) Stoichiometrically controlled immobilization of multiple enzymes on magnetic nanoparticles by the magnetosome display system for efficient cellulose hydrolysis. Biomacromolecules 16, 3863-3868.

(22)

MacEwan, S. R., and Chilkoti, A. (2010) Elastin-like polypeptides: biomedical applications of tunable biopolymers. Biopolymers 94, 60-77.

(23)

Betre, H., Setton, L. A., Meyer, D. E., and Chilkoti, A. (2002) Characterization of a genetically

engineered

elastin-like

polypeptide

for

cartilaginous

tissue

repair.

Biomacromolecules 3, 910-916. (24)

Mie, M., Mizushima, Y., and Kobatake, E. (2008) Novel extracellular matrix for cell sheet recovery using genetically engineered elastin-like protein. J. Biomed. Mater. Res. B Appl. Biomater. 86, 283-290.

(25)

Meyer, D. E., and Chilkoti, A. (1999) Purification of recombinant proteins by fusion with thermally-responsive polypeptides. Nat. Biotechnol. 17, 1112-1115. 20


Page 21 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(26)

Trabbic-Carlson, K., Liu, L., Kim, B., and Chilkoti, A. (2004) Expression and purification of recombinant proteins from Escherichia coli: Comparison of an elastin-like polypeptide fusion with an oligohistidine fusion. Protein Sci. 13, 3274-3284.

(27)

Meyer, D. E., Kong, G. A., Dewhirst, M. W., Zalutsky, M. R., and Chilkoti, A. (2001) Targeting a genetically engineered elastin-like polypeptide to solid tumors by local hyperthermia. Cancer Res. 61, 1548-1554.

(28)

Bidwell, G. L., 3rd, Fokt, I., Priebe, W., and Raucher, D. (2007) Development of elastin-like polypeptide for thermally targeted delivery of doxorubicin. Biochem. Pharmacol. 73, 620-631.

(29)

Na, K., Lee, S. A., Jung, S. H., Hyun, J., and Shin, B. C. (2012) Elastin-like polypeptide modified liposomes for enhancing cellular uptake into tumor cells. Colloids Surf. B Biointerfaces 91, 130-136.

(30)

Takahashi, M., Yoshino, T., and Matsunaga, T. (2010) Surface modification of magnetic nanoparticles using asparagines-serine polypeptide designed to control interactions with cell surfaces. Biomaterials 31, 4952-4957.

(31)

Nakamura, N., and Matsunaga, T. (1993) Highly sensitive detection of allergen using bacterial magnetic particles. Anal. Chim. Acta 281, 585-589.

(32)

Urry, D. W. (1988) Entropic elastic processes in protein mechanisms. I. Elastic structure due to an inverse temperature transition and elasticity due to internal chain dynamics. J. Protein Chem. 7, 1-34.

(33)

Li, B., Alonso, D. O., and Daggett, V. (2001) The molecular basis for the inverse temperature transition of elastin. J. Mol. Biol. 305, 581-592.

(34)

Li, B., Alonso, D. O., Bennion, B. J., and Daggett, V. (2001) Hydrophobic hydration is an important source of elasticity in elastin-based biopolymers. J. Am. Chem. Soc. 123, 11991-8.

(35)

Christensen, T., Hassouneh, W., Trabbic-Carlson, K., and Chilkoti, A. (2013) Predicting 21



transition temperatures of elastin-like polypeptide fusion proteins. Biomacromolecules 14, 1514-1519. (36)

Trabbic-Carlson, K., Meyer, D. E., Liu, L., Piervincenzi, R., Nath, N., LaBean, T., and Chilkoti, A. (2004) Effect of protein fusion on the transition temperature of an environmentally responsive elastin-like polypeptide: a role for surface hydrophobicity? Protein Eng. Des. Sel. 17, 57-66.

(37)

Nath, N., and Chilkoti, A. (2002) Creating “smart” surfaces using stimuli responsive polymers. Adv. Mater. 14, 1243-1247.

(38)

Nath, N., and Chilkoti, A. (2001) Interfacial phase transition of an environmentally responsive elastin biopolymer adsorbed on functionalized gold nanoparticles studied by colloidal surface plasmon resonance. J. Am. Chem. Soc. 123, 8197-8202.

(39)

Higashi, N., Ochiai, T., Kanazawa, C., and Koga, T. (2013) Site-specific adsorption of gold nanoparticles coated with thermo-responsive peptides. Polymer J 45, 523.

(40)

Zhao, B., Li, N. K., Yingling, Y. G., and Hall, C. K. (2016) LCST behavior is manifested in a single molecule: elastin-like polypeptide (VPGVG)n. Biomacromolecules 17, 111-118.

(41)

Urry, D. W., Luan, C. H., Parker, T. M., Gowda, D. C., Prasad, K. U., Reid, M. C., and Safavy, A. (1991) Temperature of polypeptide inverse temperature transition depends on mean residue hydrophobicity. J. Am. Chem. Soc. 113, 4346-4348.

(42)

Reiersen, H., Clarke, A. R., and Rees, A. R. (1998) Short elastin-like peptides exhibit the same temperature-induced structural transitions as elastin polymers: implications for protein engineering. J. Mol. Biol. 283, 255-264.

(43)

Kondo, A., Kamura, H., and Higashitani, K. (1994) Development and application of thermo-sensitive magnetic immunomicrospheres for antibody purification. Appl. Microbiol. Biotechnol. 41, 99-105.

(44)

Banerjee, I. A., Yu, L., Shima, M., Yoshino, T., Takeyama, H., Matsunaga, T., and Matsui, H. 22


Page 22 of 23

Page 23 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(2005) Magnetic nanotube fabrication by using bacterial magnetic nanocrystals. Adv. Mater. 17, 1128-1131. (45)

Tanaka, M., Brown, R., Hondow, N., Arakaki, A., Matsunaga, T., and Staniland, S. (2012) Highest levels of Cu, Mn and Co doped into nanomagnetic magnetosomes through optimized biomineralisation. J. Mater. Chem. 22, 11919-11921.

(46)

Meyer, D. E., and Chilkoti, A. (2004) Quantification of the effects of chain length and concentration on the thermal behavior of elastin-like polypeptides. Biomacromolecules 5, 846-851.

(47)

Matsunaga, T., Sakaguchi, T., and Tadakoro, F. (1991) Magnetite formation by a magnetic bacterium capable of growing aerobically. Appl. Microbiol. Biotechnol. 35, 651-655.

(48)

Okamura, Y., Takeyama, H., Sekine, T., Sakaguchi, T., Wahyudi, A. T., Sato, R., Kamiya, S., and Matsunaga, T. (2003) Design and application of a new cryptic-plasmid-based shuttle vector for Magnetospirillum magneticum. Appl. Environ. Microbiol. 69, 4274-4277.

Table of Contents graphic

23


Biosynthesis of Thermoresponsive Magnetic Nanoparticles by

Recommend Documents