C Mutation in the Rv2629 Gene that Was

Oct 31, 2007 - RIF sensitive (RIFs) isolates, and the laboratory H37Rv strain. ... RIF resistance only after being transformed with the mutated M. tb ...
0 downloads 0 Views 535KB Size
Download PDF
A Newly Identified 191A/C Mutation in the Rv2629 Gene that Was Significantly Associated with Rifampin Resistance in Mycobacterium tuberculosis Qingzhong Wang,† Jun Yue,‡ Lu Zhang,†,§ Ying Xu,† Jiazhen Chen,† Min Zhang,† Bingdong Zhu,† Hongyan Wang,† and Honghai Wang*,† State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University and Shanghai Pneumology Hospital, Shanghai, PRC, and School of Life Science & Engineering, Qiqihar University, Qiqihar, Heilongjiang Province, PRC Received April 27, 2007

In an effort to identify the new resistance factors in rifampin resistant (RIFr) Mycobacterium tuberculosis (M. tb), comparative proteome analysis and gene mutation assays were used to identify the differentially expressed proteins and correlated gene mutations among clinical RIFr isolates lacking rpoB mutations, RIF sensitive (RIFs) isolates, and the laboratory H37Rv strain. MALDI-TOF-MS revealed nine differentially expressed protein spots. PCR sequencing results showed four genes were mutated. The newly identified 191A/C mutation, in the gene Rv2629, was carried by 111 out of 112 clinical RIFr isolates. However, this mutation was absent in H37Rv and RIFs isolates. The RIFs species Mycobacterium smegmatis displayed RIF resistance only after being transformed with the mutated M. tb Rv2629, while it was not restored by the wild type gene. These results indicate that the 191A/C mutation of the Rv2629 gene may be associated with RIF resistance. Keywords: Mycobacterium tuberculosis • Rv2629 mutation • Rifampin resistance • proteomic analysis • clinical isolates

Introduction Approximately one-third of the world’s population is infected with Mycobacterium tuberculosis (M. tb). Tuberculosis (TB) disproportionately burdens the developing countries of the world.1 Drug resistance is a major concern in the global tuberculosis epidemic. Multidrug-resistant (MDR) strains have emerged, which are resistant to isoniazid (INH) and rifampin (RIF), two vital drugs of the five first-line antituberculosis agents. More than 10% of TB cases in many countries are multidrug resistant, and the incidence of MDR TB appears to be more widespread than previously documented.2,3 Treatments of MDR strains of M. tb require replacement of the standard short-course regimens with expensive, toxic, and less effective second line drugs, which often result in high clinical relapse rates.2,4 Knowledge of drug action and an understanding of the principles of drug resistance are the keys to developing diagnostic strategies, discovering new drugs, creating treatment programs, and gaining insight into the pathogenicity of drug-resistant strains. RIF, first introduced in 1972 as an antitubercular drug, was initially extremely effective against M. tb. Its minimal inhibitory * Corresponding author. State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, 220 Handan Road, Shanghai 200433, China. Tel.: +86 21 65643777. Fax: + 86 21 65648376. E-mail: [email protected]. † Fudan University. ‡ Shanghai Pneumology Hospital. § Qiqihar University.

4564 Journal of Proteome Research 2007, 6, 4564–4571 Published on Web 10/31/2007

concentration (MIC) was 0.1–0.2 µg/mL.5,6 Because RIF is highly bactericidal, it formed the backbone of short-course chemotherapy, together with INH.7 The number of strains resistant to RIF has increased with its widespread and extended use. Furthermore, resistance to RIF can now be assumed to be a surrogate marker for MDR tuberculosis.8 The previous work of Telenti and other researchers revealed that RIF resistance in M. tb as well as in Escherichia coli (E. coli) and Staphylococcus aureus was conferred by a set of restrictive mutations in the rpoB gene, which encoded the β-subunit of RNA polymerase in bacteria.9,10 RIF acted to inhibit the mRNA synthesis of bacteria by binding to the RNA polymerase β-subunit (rpoB).11,12 The RIFr M. tb mutations of the rpoB gene were found in nearly 95% of clinical isolates.9 Most of the mutations were located from nucleotides 1276 to 1356 (codon 432–458 in the M. tb rpoB gene and codon 507–533 in the E. coli rpoB gene). An 81 bp core region was called the RIF resistance determining region (RRDR) of rpoB.13–15 Little attention was paid to the remaining 5–10% of RIFr isolates carrying no RRDR mutations of the rpoB gene.14,16,17 Our published results of oligonucleotide microarray analyses on the M. tb RIFr isolates demonstrated that 49 RIFr isolates (92.5%) carried mutations in the RRDR of the rpoB gene, and four RIFr isolates (7.5%) did not contain mutations in the rpoB gene.18 In the present study, proteome technology was applied to screen for the differentially expressed proteins in clinical RIFr isolates, especially the four without rpoB mutations, the H37Rv laboratory strain, and clinical RIFs isolates. DNA sequencing 10.1021/pr070242z CCC: $37.00

 2007 American Chemical Society

research articles

Newly Identified 191A/C Mutation in the Rv2629 Gene Table 1. Primer Sets for the Entire Rv2629 Gene Amplification

a

fragment

PCR product (bp)

primer positiona

primers

1

695

2

892

-165 to -147 509 to 529 318 to 338 +66 to +84

forward 5′-ATGGGCAACAGTGGGTTTG-3′ reverse 5′-AGTTCATTCGGATGGCTTCTT-3′ forward 5′-CGTGCCATTGATAGACCTTGA-3′ reverse 5′-GGATTTGTCGCTCGTAGGC-3′

Position of primer sequence from the transcription start site of the Rv2629 gene (accession number: gi|15609766).

was performed to track the unknown gene mutations and identify potential new resistant factors that might be helpful in explaining the resistance mechanism of RIFr isolates lacking rpoB mutations. This research provided further understanding of the complex activity of RIF to anti M. tb and will potentially provide important insight into the mechanism of drug resistance. Most importantly, the fact that the carriage frequency of the newly identified Rv2629 191A/C mutation was as high as 99.1% in the RIFr isolates and as low as 0% in the RIFs isolates means that the 191 A/C mutation is potentially an ideal biomarker for the rapid detection of the RIFr isolates.

Materials AND Methods Collection of Clinical M. tb Isolates and RIF Susceptibility Testing. There were, in total, 112 RIFr and 30 RIFs M. tb clinical isolates collected from six provinces of eastern China including Shanghai, Zhejiang, Jiangsu, Anhui, Jiangxi, and Fujian. Clinical isolates and the laboratory strain of M. tb were grown in Löwenstein–Jensen medium. The genetic relatedness among all isolates was assessed by the restriction fragment length polymorphism (RFLP) of IS6110 digestion following a standardized method as described previously.19,20 The RFLP-IS6110 pattern showed considerable heterogeneity, which suggested there were no geographical or temporal relations among the studied isolates. All isolates were initially classified as RIF resistant or sensitive by use of a BACTEC MGIT 960 instrument (Becton Dickinson, Microbiology Systems, Sparks, MD, USA). The MICs were determined by the E test and the FDA gold standard:proportional method on 7H9 solid medium.21 The conventional antibiotic susceptibility test using the proportion method was performed at Shanghai Pneumology Hospital and Shanghai CDC TB Laboratory, respectively. The E test result was consistent with the one from the proportion method. Sample Preparation and 2D Gel Electrophoresis. Wholecell extracts were prepared from M. tb by harvesting 10 mL cultures for each strain after 15 days growth. The bacterial pellets (5000 × g, 15 min) were washed twice in PBS with 1% (v/v) Tween-80, resuspended in lysis buffer (8 M urea, 2 M thiourea, 140 mM DTT, 0.5% Biolyte (pH 4–7), 4% CHAPs, 400 µg/mL of n-octyl-β-D-glucopyranoside, 1 mM PMSF) and complete protease inhibitor cocktail (Roche Molecular Biochemicals, Indianapolis, IN, USA), and heat-inactivated at 80 °C for 20 min before bead-beating in a ribolyser. Finally, the purified bacterial pellets were sonicated in the presence of proteinase inhibitors and were further processed as described for whole cell proteins of broth-cultured mycobacteria.22 Protein concentration was estimated using the Bradford assay. Approximately 80 µg total of proteins was loaded onto linear pH 4–7 IPG strips (Amersham Pharmacia, Uppsala, Sweden) for 80 000 Vh. Proteins were separated in the second dimension (2D) on 0.75 mm thick, 18 cm wide, and 24 cm long 12% vertical SDS PAGE gels. The gels were stained with silver nitrate as described previously,23,24 scanned using Molecular Image Fx

(Bio-Rad, Hercules, CA, USA), and analyzed with PDQuest6.0 software (Bio-Rad). Tryptic In-Gel Digestion. The protein spots of interest were excised from the silver-stained 2D gels after the gels were washed twice using Milli-Q water. The excised spots were washed 3 times in Milli-Q water and destained twice in 60 µL aliquots of 50 mM NH4HCO3 and 50% ACN. An aliquot of 3 mL (12.5 ng/ mL) of freshly diluted trypsin (Roche, Switzerland) was added to the dried gel. The gel pieces were then dehydrated in 50% trifluoroacetic acid and completely dried in a vacuum centrifuge for 20–40 min. The dried gel pieces were rehydrated in 25 mM ammonium hydrogen carbonate containing 0.01 µg/µL of modified trypsin, to digest proteins, and incubated for 16–20 h at 37 °C. The resulting peptides were extracted twice from the gel pieces, using 120 µL of 5% trifluoroacetic acid for 1 h at 40 °C and 120 µL of 2.5% trifluoroacetic acid and 50% acetonitrile for 1 h at 30 °C, respectively. For MALDI-TOF-MS analysis, the peptide solution was dried with N2. The 0.8 µL matrix (5 mg/mL of CHCA diluted in 50% ACN/0.1% TFA; Sigma, Germany) was added and mixed several times to extract the peptides, and the mixture was spotted onto MALDI plates. MS measurements were carried out on an ABI Voyager System 6192. After MS acquisition, the six strongest peptides per spot were selected automatically for the MS/MS analysis. Peptide mass fingerprint data were searched using PepIdent (www.expasy.org/tools/peptident.pl), which limited the search to Mycobacterium species. The mass tolerance was set at 0.3 Da, and the MS/MS tolerance was 0.4 Da. Proteins with a protein score greater than 59, or a best ion score (MS/MS) greater than 30, were significant. Genome DNA Extraction. Genomic DNA was extracted as described by van Soolingen25 with a slight modification. Bacteria were harvested from the Löwenstein–Jensen slopes, heat-inactivated, and incubated with lysozyme (4 h, 37 °C) followed by the digestion with 50 µg of proteinase K in 10% SDS for 30 min at 65 °C. A further incubation with CTAB/NaCl for 30 min at 65 °C was followed by phenol/chloroform extraction and 100% ethanol precipitation. Target Gene Amplification and Sequencing. All target genes in the M. tb isolates were amplified by PCR using the high fidelity KOD polymerase (Toyobo, Co., Tokyo, Japan) with the primers shown in Table 1. Purified PCR products (Qiagen kit, Valencia, CA, USA) were sequenced. Isolates containing gene mutations were resequenced using single colonies through PCR product subcloning into T vectors. Sequence data were assembled and analyzed using the CLUSTAL W program. Primer sets for sequencing the whole Rv2629 gene are shown in Table 2. The forward primer, 5′-GACCACGATGACCGTTCCG-3′, and the reverse primer, 5′-AGCCGATCAGACCGATGTTG-3′, were used to amplify a 440 bp fragment (nt1038-1477), which Journal of Proteome Research • Vol. 6, No. 12, 2007 4565

research articles

Wang et al.

Table 2. Primer Sets for the Entire rpoB Gene Amplification fragment

a

PCR product (bp)

1

821

2

948

3

941

4

763

5

1110

primer position

primers

-252 to -233 404 to 468 370 to 388 1299 to 1317 1264 to 1282 2187 to 2404 1906 to 1923 2651 to 2668 2523 to 2540 +95 to +113

forward 5′-ACGCTAAACGGGTCAATCTG-3′ reverse 5′-CTCGGTCATCATCGGGAAG-3′ forward 5′-GCGGCTCCACTGTTCGTCA-3′ reverse 5′-CGGGTTGTTCTGGTCCATG-3′ forward 5′-AAGGAGTTCTTCGGCACCA-3′ reverse 5′-AGGCGGTTGGACAGGATG-3′ forward 5′-GTCGTCGCCGAAGAAAGC-3′ reverse 5′-CGATCACGCCCTTGTTGC-3′ forward 5′-GATCGGCATTCGGGTGTT-3′ reverse 5′-CCATTGCCTGATGTCCTCC-3′

a

Position of primer sequence from the transcription start site of the rpoB gene (accession number: gi| 15607807).

Table 3. Primer Sets for Amplification of the Eight Entire Genes gene

forward primers

reverse primers

Rv0054 Rv0927c Rv1446c Rv2145c Rv2334 Rv3133c Rv3136 Rv3841

5′-GTGGCTGGTGACACCACCATC-3′ 5′-ATGATCCTGGATATGTTCCGTCT-3′ 5′-ATGATTGTCGACTTGCCCGAC-3′ 5′-ATGCCGCTTACACCTGCCG-3′ 5′-ATGAGCATCGCCGAGGACAT-3′ 5′-ATGACAACAGGGGGCCTCGT-3′ 5′-ATGGATTTCGCACTGTTACCAC-3′ 5′-ATGACAGAATACGAAGGGCCT-3′

5′-TCAGAATGGCGGTTCGTCATC-3′ 5′-TCACAGGTCCGGAATGGG-3′ 5′-TCACCGGTACTGCACCTTCTT-3′ 5′-CTAGTTTTTGCCCCGGTTGAAT-3′ 5′-TTAGTCAGCCACGTCGGCGAAC-3′ 5′-CTACTGCGACAACGGTGCTGAC-3′ 5′-TTACCCTGCCGCGGGTGGG-3′ 5′-CTAGAGGCGGCCCCCGG-3′

Table 4. Primer Sequence and Plasmid Construct for Rv2629 Gene Cloning primer setsa

sequence

forward primer reverse primer plasmids pMV261 pVA1

5′- TAGGATCCATGCGATCAGAACGTCTCCG - 3′ 5′- GATAAGCTTCTAGGATCTATGGCTGCCGAGT - 3′ construct kanamycin-resistant, E. coli–Mycobacterial shuttle vector insertion: 1.2 kb wild 191A Rv2629 gene digested by BamH I & Hind III insertion: 1.2 kb mutant 191C Rv2629 gene digested by BamH I & Hind III

pVA2 a

Underlined letters represent restriction enzyme sites.

covered the RRDR of the rpoB gene. Primer sets for sequencing the whole rpoB gene are described in Table 3. Cloning and Transformation of the 191 Polymorphic Rv2629 Genes in M. smegmatis. The 191 polymorphic Rv2629 genes were cloned into the E. coli mycobacterial shuttle vector pMV261 to construct plasmids pVA1 (191 wild A) and pVA2 (191 mutant C). The adapted BamH 1 and Hind III cutting sites in the forward and reverse PCR primers were used for Rv2629 gene cloning (Table 4). The Rv2629 gene inserts were confirmed by sequencing. The pVA1 and pVA2 vectors were transformed into M. smegmatis strain MC2 155, using the electroporation method described by Parish and Stoker.26 The RIF susceptibilities of the transformed M. smegmatis strains were determined as described above. Accession Number of the Nucleotide Sequence. The sequence of the Rv2629 gene with the 191A/C mutation was deposited into GenBank under accession number DQ449423.

Results Identification of the Differential Expression Proteins. To identify resistant factors in the clinical RIFr M. tb, which did not bear rpoB mutations, proteomic techniques were used to characterize the differentially expressed proteins among the laboratory M. tb H37Rv strain, five clinical RIFs isolates, and four clincial RIFr isolates without rpoB mutations. Two4566

Journal of Proteome Research • Vol. 6, No. 12, 2007

dimensional electrophoresis (2DE) results showed that the protein patterns of clinical RIFs M. tb isolates were highly similar to that of the M. tb H37Rv, while the patterns of RIFr M. tb isolates were more diverse. Approximately 1500 spots were revealed on the silver-stained 2DE patterns of the whole cell proteins (Figure 1). All spots that were confirmed by a minimum of three experiments were accepted for further study. Comparisons of the silver-stained gels showed that 34 protein spots had at least a 2-fold less or more density difference between the RIFr isolates and the H37Rv strain and RIFs isolates (Figure 2). There were nine different spots identified by MALDI-TOF-MS or MS/MS. The differential spots were digested in-gel by trypsin, after desalting/concentrating, and analyzed by MALDI-TOF-MS. A representative map of PMF is shown in Figure 3. When the 2D result from the RIFr isolates was compared to that of the RIFs isolates or the H37Rv laboratory strain, the down-expressed four protein spots of R1 (Ssb, Rv0054), R2 (Rv0927c), R5 (OpcA, Rv1446c), and R7 (PPE51, Rv3136) were observed. The protein Rv0927c was only present in the H37Rv strain but was absent in all clinical isolates. There were five up-expressed proteins including R3 (DevR, Rv3133c), R4 (BfrB, Rv3841), R6 (Ag84, Rv2145c), R8 (CysK Rv2334), and R9 (Rv2629). Protein Rv2629 was predomi-

research articles

Newly Identified 191A/C Mutation in the Rv2629 Gene

Figure 1. 2DE patterns of whole cell supernatant proteins from (A) H37Rv, (B) the RIFs, and (C) the RIFr clinical isolates in the pH range 4–7. Proteins were visualized by silver staining. 2DE patterns of RIFr isolates comprised about 1500 protein spots. Spot numbers on the reverse image correspond to proteins identified by MALDI-TOF-MS as listed in Table 5. Table 5. Identification Results of Differentially Expressed Proteins in RIFr Isolates from 2DE Maps spot no.

gene

gi in NCBI

a

locus taga

gi|15607196 Rv0054

no. of peptides matched

R1

Ssb

6

R2

11

R3

hypothetical gi|15608067 Rv0927c protein DevR gi|15610269 Rv3133c

R4

BfrB

gi|15610977 Rv3841

10

R5

OpcA

gi|15608584 Rv1446c

18

R6

Ag84

gi|15609282 Rv2145c

16

R7

PPE51

gi|15610272 Rv3136

7

R8

CysK

gi|15609471 Rv2334

12

R9

hypothetical gi|15609766 Rv2629 protein

15

6

peptide sequence matched by MS/MS

percent protein coverage (%) score

pIt/pIob

Mrt/Mrob

expression levelc

TVIEVEVDEIGPSLR TPSGAAVANFTVASTPR AGDTTITIVGNLTADPELR TSSELDAVAEQIR GASLRGAAIALAFAQAGADVLI VPAARPDVAVLDVR

47.56

234

4.84/5.12

17320.99/ decrease 17342.6

33.08

132

5.6/5.49

29.03

90

5.45/5.62

EALALALDQER AGANLFELENFVAR AVGELKVELVR VGADAGAGEFVVLR TGKPDALVPLAR TYLESQLEELGQR GFNSRAAPVDSNADAGGFDQ MDFALLPPEVNSAR

52.49

112

4.47/4.73

56.44

143

4.98/5.2

26745.62/ disappear 26729.1 23261.87/ increase 23279.3 20441.93/ increase 20429.2 32717.49/ decrease 32697.4

55.38

133

4.52/4.8

13.42

73

4.11/4.37

35.48

91

4.93/5.2

43.05

187

5.01/5.2

LIVVVLPDFGER YFVPQQFENPANPAIHR IAPLDGVGALLR LVDAADPEVVFVSGEVR

28277.1/ increase 28260.1 37979.75/ decrease 37956.2 32752.62/ increase 32732.3 40839.76/ new 40900

a gi in NCBI and locus tag according to the complete genome of Mycobacterium tuberculosis H37Rv (http://www.ncbi.nlm.nih.gov). b pIt and Mrt were theoretical pI and Mr, respectively, according to protein sequence and the TubercuList database (http://genolist.pasteur.fr/TubercuList/). pIo and Mro were observed pI and Mr respectively, detected by MALDI-TOF. c Expression level indicated the expression of a specific protein in FIFr compared with laboratory and RIFs isolates.

nantly expressed in the RIFr isolates, down-expressed in the RIFs isolates, and absent in the H37Rv strain (Table 5, Figure 2). Mutated Genes in the Clinical Isolates. All genes which encoded the nine differentially expressed proteins were cloned and sequenced from the H37Rv strain, 15 clinical RIFs isolates,

and 18 clincial RIFr isolates individually. There were 6 isolates out of the 18 clinical RIFr isolates not carrying rpoB gene mutations. Sequencing results of PCR products showed that, in all M. tb isolates, five genes (Rv0054, Rv3133c, Rv2145, Rv3136c, and Rv2334) had relatively unchanged sequences and four genes (Rv2629, Rv0927c, Rv1446c, and Rv3841) had muJournal of Proteome Research • Vol. 6, No. 12, 2007 4567

research articles

Wang et al.

Figure 2. Representative, enlarged, partial 2-D gels showing the protein spots’ altered expressions in (a) H37Rv, (b) RIFs isolates, and (c) RIFr isolates. The histogram shows corresponding changed protein spots in intensity among the three strains. Bars represent spot intensity with relative volume divided by the total volume (vol %) over the whole image, according to the PDQuest 6.0 software description.

Figure 3. MALDI-TOF spectra obtained for Rv2629 (spot R9). Monoisotopic peptide masses were used to search protein databases to match and subsequently identify individual protein spots. In this example, the four masses indicated were matched to Rv2629. Table 6. Characteristics of Gene Mutations in Clinical Isolates spot

protein

locus tag

base change

amino acid change

no. of RIFr isolates

no. of RIFs isolates

R1 R2 R3 R4 R5 R6 R7 R8 R9

Ssb hypothetical protein DevR BfrB OpcA antigen 84 PPE51 CysK hypothetical protein

Rv0054 Rv0927c Rv3133c Rv3841 Rv1446c Rv2145c Rv3136 Rv2334 Rv2629

no GCA deletion no CTAfCTG CGAfCCA No no no GATfGCT CGTfCAT GACfCAC CTGfTTG

no Ser(140) deletion no Leu(156)fLeu(156) Arg(192)fPro(192) no no no Asp(64)fAla(64) Arg(346)fHis(346) Asp(348)fHis(348) Leu(282)fLeu(282)

18 18 18 5 3 18 18 18 18 3 2 0

15 15 15 2 6 15 15 15 0 0 0 13

tated sequences compared with that in the H37Rv strain. A GAC deletion mutation was found in the Rv0927c gene of all clinical isolates and caused a Ser140 deletion. The CGAfCCA mutation of the Rv1446c gene, which coded for an amino acid at site 192, existed in three RIFr and six RIFs isolates. There were two mutations in the Rv3841 gene: the synonymous mutation of CTAfCTG coded for the same Leu156 in five RIFr and two RIFs isolates, and the missense mutation of ATCfACC (Ile157/ Thr157) that was found in four RIFr isolates (Table 6). Since the above-described gene mutations were found in both RIFr and RIFs isolates, we concluded that these mutations were not associated with RIF selection pressure. In the Rv2629 gene, the substitution of A for C at nucleotide 191 converted an Asp64 codon to an Ala64 codon, which was found only in the RIFr 4568

Journal of Proteome Research • Vol. 6, No. 12, 2007

isolates and was absent in the RIFs isolates (Table 6). This newly identified 191A/C mutation in the Rv2629 gene was differentially associated with RIFr and RIFs isolates. These results indicated that the differentially displayed 191A/C mutation of the Rv2629 gene might be related to the RIF selection pressure, and this isogenic mutant might play an important role as a potential resistant factor related to RIFr isolates. rpoB and Rv2629 Gene Mutations in Clinical Isolates. To clarify the relationship between the 191A/C mutation of the Rv2629 gene and RIF resistance, we sequenced the Rv2629 and rpoB genes in a larger scale of M. tb clinical isolates. A total of 112 RIFr and 30 RIFs M. tb isolates were collected from six provinces of eastern China, and these strains included the 18 RIFr and 15 RIFs isolates cited above. The results indicated that

research articles

Newly Identified 191A/C Mutation in the Rv2629 Gene Table 7. Mutations of rpoB in Clinical Isolates

no. of RIF-resistant strains with indicated RIF MIC range (µg/mL) mutation position (E. coli position)

Leu430(511) Gln432(513) Asp435(516)

Ser441(522) His445(526)

Ser450(531)

Phe424(505), Ser450(531) Gly426(507), Asn437(518), Leu457(538) none

nucleotide change

amino acid change

no. (%) of samples

1 e MIC < 16

16 e MIC < 64

CTGfCCG CAAfCCA GACfGGC GACfTAC GACfGTC TCGfCCG CACfGAC CACfCTC CACfCGC CACfAAC CACfTAC TCGfTTG TCGfTGG TCGfTAG TTCfTCC, TCGfTTG

LrufPro GlnfPro AspfGly AspfTyr AspfVal SerfPro HisfAsp HisfLeu HisfArg HisfAsn HisfTyr SerfLeu SerfTrp SerfTermi-nation PhefSer, SerfLeu

3(2.68) 2(1.79) 3(2.68) 1(0.89) 2(1.79) 3(2.68) 7(6.25) 11(9.82) 4(3.57) 3(2.68) 9(8.04) 33(29.46) 15(13.39) 2(1.79) 2(1.79)

2 1 1

1 1 2 1 1

1 1 3 2 2 2 5 3 1 2

GGCfGAC, AACfTAC, CTGfCCG

GlyfAsp, AsnfTyr, LeufPro

1(0.89)

1

11(9.82)

3

wild type

99.1% (111/112) of RIFr clinical isolates, which included 11 isolates having no rpoB mutations and 100 isolates having rpoB mutations, had the same 191A/C mutation in the Rv2629 gene. However, none of the 30 RIFs isolates carried the Rv2629 191A/C mutation. The unique RIFr isolate without the Rv2629 191A/C mutation had a mutation in the amino acid Ser450 of rpoB, and its MIC was 16 µg/mL. A total of 101 out of the 112 RIFr clinical isolates (90.17%) carried mutations in the rpoB gene. Also, 11 out of the 112 (9.83%) RIFr isolates, as well as the 30 RIFs isolates, had no mutations in the rpoB gene. The hot mutation sites in the rpoB gene included codons 450 (44.64%), 445 (30.36%), and 435 (5.36%) (Table 7). Restored RIF Resistance in RIFs M. smegmatis. The 191A/C polymorphic Rv2629 genes of M. tb were cloned into the pMV261 vector, as described in Cloning and Transformation of the 191 Polymorphic Rv2629 Genes in M. smegmatis. MICs of RIF for M. smegmatis transformed with pVA1 or pVA2 were then determined. The RIF MIC for pVA1-transformed (191A unmutated Rv2629 gene) M. smegmatis (20 µg/mL) was similar to the parental RIFs M. smegmatis strain (20 µg/mL). The MIC for pVA2-transformed (191C mutated Rv2629 gene) M. smegmatis was significantly higher (up to 160 µg/mL). The parental RIFs M. smegmatis strain had restored RIF resistance after being transformed with mutant 191C pVA2 plasmid DNA.

Discussion For survival purposes, a number of strategies are utilized by bacteria to escape from the effects of drugs. The common drugresistant strategies have included: (1) barrier mechanisms (decreased permeability and efflux pumps); (2) degrading or inactivating key enzymes such as β-lactamases; (3) drug target modifications such as the binding site point mutations or modifications through the mobility of exogenous genetic elements; and (4) overproduced targets causing an increased drug titration. Antituberculosis drug resistance usually develops based on the third target modification mechanism through key target gene mutations.27,28

2 1 1 10 2

5

64 e MIC

1 2 4 8 1 1 6 18 10 1

3

Previous works have indicated that most of the drug resistance that has emerged in M. tb is controlled by a complex genetic system involving several genes,22 affecting not only first line but also second line antituberculosis drugs. For example, INH-resistant strains of M. tb were apparently controlled by a genetic system involving several genes29 associated with identified amino acid substitutions in genes katG, inhA, and kasA.30 In addition, the resistance of a small proportion of INHresistant strains was also associated with mutations of the genes furA, iniA, iniB, and iniC.31 Another example is Streptomycin resistance, which was associated with rpsL and rrs gene mutations.27,32 Almost 90–95% of RIF-resistant M. tb isolates have been associated with rpoB mutations.13–15 Characterization of the rpoB gene in E. coli demonstrated that RIF specifically interacted with the β-subunit of RNA polymerase, thereby hindering transcription, and that mutations in the rpoB locus conferred conformational changes leading to defective binding of the drug and, consequently, resistance.30 Subsequently, the rpoB locus in M. tb was characterized and mutations conferring the resistant trait were identified.10,33,34 The rpoB mutations have been described in other genus of RIFr M. tb complex bacteria, whereas little attention has been paid to mutations other than the rpoB mutations. Dabbs35,36 and Quan35,36 proposed that a degradation mechanism might induce RIF resistance in the rapidly growing mycobacteria ribosylation. However, it was not clarified what conferred the RIF resistance in the RIFr strains lacking rpoB mutations in M. tb; therefore, the explanation of the RIF-resistant mechanism in the 5–10% of RIFr M. tb isolates without rpoB mutations remained unknown. In the current study, proteomic methodologies were used to identify the genetic factors which contributed to RIF resistance in clinical RIF-resistant M. tb isolates. Proteomic analysis was previously successfully applied to study erythromycin resistance in Streptococcus pneumoniae, revealing a significantly increased amount of GAPDH in the M phenotype of resistant bacteria. It was hypothesized that the GAPDH may Journal of Proteome Research • Vol. 6, No. 12, 2007 4569

research articles provide reduced equivalents for the active efflux mechanism or may even be directly involved in membrane transport, which regulated the erythromycin resistance in the M phenotype.37 A new function of PstS, a subunit of the phosphate ABC transporter in S. pneumoniae penicillin-resistant strains, was revealed by proteomic analysis.38 The three antibiotic-resistant proteins of TolC, OmpC, and YhiU, together with the antibioticresistance-related proteins of FimD (precursor), LamB, Tsx, YfiO, OmpW, and NlpB, which responded to tetracycline and ampicillin resistance in E. coli K-12, were reported by Xu and his colleagues using proteomic technology.39 We used proteomic analysis and DNA sequencing to identify the susceptible factors that contribute to RIFr in M. tb. The RIFr M. tb isolates lacked rpoB mutations. It is noteable that protein Rv2629 is upregulated 7-fold in the RIFr strains compared to the laboratory H37Rv strain and RIFs strains. The DNA sequence results showed that the missense substitution of A with C, at the nucleic acid locus 191 of the Rv2629 gene, converting Asp64 to Ala64, happened in 111 out of 112 (99.1%) RIFr isolates. The 191A/C mutation occurred in RIFr isolates with or without the rpoB mutations. This 191A/C missense substitution in the Rv2629 gene was not found in either the laboratory H37Rv strain or any of the 30 clinical RIFs isolates. These results showed that overexpression of the Rv2629 protein and its 191A/C mutation were associated with RIFr isolates and indicated that the 191A/C mutation might be a good biomarker and predictive sign for RIF resistance in M. tb. The Rv2629 protein was previously presumed to be one of the dormant markers.40–43 The Rv2629 gene was 1125 bp in size, which converted to a 374 aa protein. The Rv2629 protein PI was 5.01 and MW was 40 839.76 Da (http:// genolist.pasteur.fr/TubercuList; Cole, 1998). The function of the Rv2629 protein in the current study remains unknown. We propose that Rv2629 might be an RIF action target and that the mechanism of RIFr might depend on the Rv2629 mutation to change the RIF active site or might depend on overexpression of the Rv2629 protein to increase the RIF titration. The molecular mechanism of RIFr has not been fully elucidated to date. There is no explanation for the RIF resistance in the 5–10% RIFr isolates that were not linked to rpoB mutations. To rapidly detect the rpoB mutations, it took at least 1–2 days using existing molecular methods such as PCR single-strandedconformationalpolymorphism(PCR-SSCP)analysis,10 DNA sequencing,33 line probe assay,44 mismatch analysis,45 heteroduplex analysis,46 molecular beacon sequence analysis,47,48 TB-Biochip oligonucleotide microarray system,49 and rifampin oligonucleotide (RIFO) macroarray.50 Since all the genotypes associated with RIFr have not been discovered (5–10% remain unexplained) and although the detection techniques are fairly advanced, treatment relapse and treatment failure are still possible.49,50 On the basis of our results, we postulate that the 191A/C mutation of Rv2629 might be a new genetic risk factor for the detection of the RIFr in M. tb. Its correlation with RIF resistance (about 99.1%) and its absence in the RIF sensitive isolates make it a likely detective biomarker. Furthermore, the fact that the mutation involves a single nucleotide means detection will be economic, quick, and simple, and there will be a stable strategy to screen RIFr isolates in scale. The prospect of this potential detection of the RIFr would bring about the timely initiation of appropriate therapy for the RIFr cases and thus avoid unnecessary cost and morbidity. The RIFs M. smegmatis had restored resistance to RIF after being transformed with the 191 mutated Rv2629 gene of M. tb 4570

Journal of Proteome Research • Vol. 6, No. 12, 2007

Wang et al. and was not restored by the 191 wild-type Rv2629 gene transformation. These results suggest that the mutant 191C in the Rv2629 gene conferred RIF resistance in M. tb. However, the entire mechanism of RIF resistance in M. tb needs to be explored. The subcellular location of the Rv2629 protein in both cell walls and cell membranes (data not shown) suggests this protein could be one component of a drug efflux complex. If so, the 191A/C mutation might change the structure of the efflux pump and decrease the uptake of RIF in RIFr isolates. Further studies are still necessary to see if there is any association between the 191A/C mutation of the Rv2629 gene and RIF resistance in an enlarged sample size (more than 300). We have constructed a recombinant plasmid to express the Rv2629 protein in the E. coli system, together with future Rv2629 knock-out and/or knock-in experiments, to distinguish the interactions between mutations of the rpoB gene and the 191A/C mutation of the Rv2629 gene. The direct or indirect effects of the Rv2629 mutation on RIF resistance in M. tb are currently being explored in our research laboratories. Abbreviations: M. tb, Mycobacterium tuberculosis; RIF, rifampin; RIFr, rifampin resistant; RIFs, rifampin sensitive; MDR, multidrug-resistant; INH, isoniazid; CTAB, cethyltrimethylammonium bromide.

Acknowledgment. This work was supported by the National Basic Research Program of China (973 Program, Nos. 2002CB512804 and 2005CB523102) and the National High Technology Research and Development Program of China (863 program, No. 2006AA02Z445). References (1) Stop TB Partnership and World Health Organization, Global Plan to Stop TB 2006–2015; World Health Organization: Geneva, 2006. (2) Dye, C.; Espinal, M. A.; Watt, C. J.; Mbiaga, C.; Williams, B. G. Worldwide incidence of multidrug-resistant tuberculosis. J. Infect. Dis. 2003, 185, 1197–1202. (3) Anti-tuberculosis drug resistance in the world. Third global report: the WHO/IUATLD global project on anti-tuberculosis drug resistance surveillance, 1999–2002; World Health Organization: Geneva, 2004. (4) Nachega, J. B.; Chaisson, R. E. Tuberculosis drug resistance: a global threat. Clin. Infect. Dis. 2003, 36, S24–30. (5) Mitchison, D. A. Mechanism of drug action in short-course chemotherapy. Bull. Int. Union Against Tuber. 1985, 65, 30–37. (6) Woodley, C. L.; Kilburn, J. O.; David, H. L.; Silcox, V. A. Susceptibility of mycobacteria to rifampin. Antimicrob. Agents Chemother. 1972, (2), 245–249. (7) Kochi, A.; Vareldzis, B.; Styblo, K. Multidrug-resistant tuberculosis and its control. Res. Microbiol. 1993, 144 (2), 104–110. (8) Vareldzis, B. P.; Grosset, J.; Dekantor, I.; Crofton, J.; Laszlo, A.; Felten, M.; Raviglione, M. C.; Kochi, A. Drug-resistant tuberculosis - laboratory issues - world-health-organization recommendations. Tuber. Lung Dis. 1994, 75 (1), 1–7. (9) Musser, J. M. Antimicrobial agent resistance in mycobacteria molecular-genetic insights. Clin. Microbiol. Rev. 1995, 8 (4), 496. (10) Telenti, A.; Imboden, P.; Marchesi, F.; Lowrie, D.; Cole, S.; Colston, M. J.; Matter, L.; Schopfer, K.; Bodmer, T. Detection of rifampicinresistance mutations in Mycobacterium tuberculosis. Lancet 1993, 341 (8846), 647–650. (11) Campbell, E. A.; Korzheva, N.; Mustaev, A.; Murakami, K.; Nair, S.; Goldfarb, A.; Darst, S. A. Structural mechanism for rifampicin inhibition of bacterial RNA polymerase. Cell 2001, 104 (6), 901– 912. (12) Zhang, G. Y.; Campbell, E. A.; Minakhin, L.; Richter, C.; Severinov, K.; Darst, S. A. Crystal structure of Thermus aquaticus core RNA polymerase at 3.3 angstrom resolution. Cell 1999, 98 (6), 811–824. (13) Miller, N.; Hernandez, S. G.; Cleary, T. J. Evaluation of gen-probe amplified mycobacterium-tuberculosis direct test and pcr for direct-detection of mycobacterium-tuberculosis in clinical specimens. J. Clin. Microbiol. 1994, 32 (2), 393–397. (14) Ramaswamy, S.; Musser, J. M. Molecular genetic basis of antimicrobial agent resistance in Mycobacterium tuberculosis: 1998 update. Tuber. Lung Dis. 1998, 79, 3–29.

Newly Identified 191A/C Mutation in the Rv2629 Gene

research articles

(15) Zhang, Y.; Telenti, A. Molecular genetics of mycobacteria; ASM Press: WA, DC, 2000; pp 235–254. (16) Bartfai, Z.; Somoskovi, A.; Kodmon, C.; Szabo, N.; Puskas, E.; Kosztolanyi, L.; Farago, E.; Mester, J.; Parsons, L. M.; Salfinger, M. Molecular characterization of rifampin-resistant isolates of Mycobacterium tuberculosis from Hungary by DNA sequencing and the line probe assay. J. Clin. Microbiol. 2001, 39 (10), 3736–3739. (17) Heep, M.; Brandstatter, B.; Rieger, U.; Lehn, N.; Richter, E.; RuschGerdes, S.; Niemann, S. Frequency of rpoB mutations inside and outside the cluster I region in rifampin-resistant clinical Mycobacterium tuberculosis isolates. J. Clin. Microbiol. 2001, 39 (1), 107– 110. (18) Yue, J.; Shi, W.; Xie, J. P.; Li, Y.; Zeng, E. L.; Liang, L.; Wang, H. H. Detection of rifampin-resistant Mycobacterium tuberculosis strains by using a specialized oligonucleotide microarray. Diagn. Microbiol. Infect. Dis. 2004, 48 (1), 47–54. (19) Kremer, K.; Au, B. K. Y.; Yip, P. C. W.; Skuce, R.; Supply, P.; Kam, K. M.; van Soolingen, D. Use of variable-number tandem-repeat typing to differentiate Mycobacterium tuberculosis Beijing family isolates from Hong Kong and comparison with IS6110 restriction fragment length polymorphism typing and spoligotyping. J. Clin. Microbiol. 2005, 43 (1), 314–320. (20) Vanembden, J. D. A.; Cave, M. D.; Crawford, J. T.; Dale, J. W.; Eisenach, K. D.; Gicquel, B.; Hermans, P.; Martin, C.; McAdam, R.; Shinnick, T. M.; Small, P. M. Strain identification of mycobacterium-tuberculosis by dna fingerprinting - recommendations for a standardized methodology. J. Clin. Microbiol. 1993, 31 (2), 406– 409. (21) Ramaswamy, S. V.; Reich, R.; Dou, S. J.; Jasperse, L.; Pan, X.; Wanger, A.; Quitugua, T.; Graviss, E. A. Single nucleotide polymorphisms in genes associated with isoniazid resistance in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 2003, 47 (4), 1241–1250. (22) Mollenkopf, H. J.; Mattow, J.; Schaible, U. E.; Grode, L.; Kaufmann, S. H. E.; Jungblut, P. R. Mycobacterial proteomes. In Bacterial Pathogenesis, Part C; Academic Press Inc.: San Diego, 2002; pp 242–256. (23) Gharahdaghi, F.; Weinberg, C. R.; Meagher, D. A.; Imai, B. S.; Mische, S. M. Mass spectrometric identification of proteins from silver-stained polyacrylamide gel: A method for the removal of silver ions to enhance sensitivity. Electrophoresis 1999, 20 (3), 601– 605. (24) Scheler, C.; Lamer, S.; Pan, Z.; Li, X. P. Peptide mass fingerprint sequence coverage from differentially stained proteins on 2-DE patterns by MALDI-MS. Electrophoresis 1998, 19, 918–927. (25) Vansoolingen, D.; Dehaas, P. E. W.; Hermans, P. W. M.; Vanembden, J. D. A. DNA-fingerprinting of Mycobacterium tuberculosis. In Bacterial Pathogenesis, Part A; Academic Press Inc.: San Diego, 1994; pp 196– 205. (26) Parish T; Stoker N. G. Mycobacteria protocols; Humana Press: Totowa, NJ, 1998. (27) Heym, B.; Cole, S. T. Multidrug resistance in Mycobacterium tuberculosis. Int. J. Antimicrob. Agent 1997, 8 (1), 61–70. (28) Telenti, A. Genetics of drug resistanct tuberculosis. Thorax 1998, 53, 793–797. (29) Herrera-Leon, L.; Molina, T.; Saiz, P.; Saez-Nieto, J. A.; Jimenez, M. S. New multiplex PCR for rapid detection of isoniazid-resistant Mycobacterium tuberculosis clinical isolates. Antimicrob. Agents. Chemother. 2005, 49 (1), 144–147. (30) Jin, D.; Gross, C. Mapping and sequencing of mutations in the Escherichia coli rpoB gene that leads to rifampicin resistance. J. Mol. Biol. 1988, 202, 45–58. (31) Sacchettini, J. C.; Blanchard, J. S. The structure and function of the isoniazid target in M-tuberculosis. Res. Microbiol. 1996, 147 (1–2), 36–43. (32) Rattan, A.; Kalia, A.; Ahmad, N. Multidrug-resistant Mycobacterium tuberculosis: Molecular perspectives. Emerging Infect. Dis. 1998, 4 (2), 195–209. (33) Kapur, V.; Li, L. L.; Iordanescu, S.; Hamrick, M. R.; Wanger, A.; Kreiswirth, B. N.; Musser, J. M. Characterization by automated dnasequencing of mutations in the gene (rpob) encoding the rnapolymerase beta-subunit in rifampin-resistant Mycobacterium tuberculosis strains from new york city and texas. J. Clin. Microbiol. 1994, 32 (4), 1095–1098.

(34) Telenti, A.; Imboden, P.; Marchesi, F.; Schmidheini, T.; Bodmer, T. DIRECT, automated detection of rifampin-resistant mycobacterium-tuberculosis by polymerase chain-reaction and singlestrand conformation polymorphism analysis. Antimicrob. Agents Chemother. 1993, 37 (10), 2054–2058. (35) Dabbs, E. R.; Yazawa, K.; Mikami, Y.; Miyaji, M.; Morisaki, N.; Iwasaki, S.; Furihata, K. Ribosylation by mycobacterial strains as a new mechanism of rifampin inactivation. Antimicrob. Agents Chemother. 1995, 39 (4), 1007–1009. (36) Quan, S. W.; Venter, H.; Dabbs, E. R. Ribosylative inactivation of rifampin by Mycobacterium smegmatis is a principal contributor to its low susceptibility to this antibiotic. Antimicrob. Agents Chemother. 1997, 41 (11), 2456–2460. (37) Cash, P.; Argo, E.; Ford, L.; Lawrie, L.; McKenzie, H. A proteomic analysis of erythromycin resistance in Streptococcus pneumoniae. Electrophoresis 1999, 20 (11), 2259–2268. (38) Soualhine, H.; Brochu, V.; Menard, F.; Papadopoulou, B.; Weiss, K.; Bergeron, M. G.; Legare, D.; Drummelsmith, J.; Ouellette, M. A proteomic analysis of penicillin resistance in Streptococcus pneumoniae reveals a novel role for PstS, a subunit of the phosphate ABC transporter. Mol. Microbiol. 2005, 58 (5), 1430–1440. (39) Xu, C. X.; Lin, X. M.; Ren, H. X.; Zhang, Y. L.; Wang, S. Y.; Peng, X. X. Analysis of outer membrane proteome of Escherichia coli related to resistance to ampicillin and tetracycline. Proteomics 2006, 6 (2), 462–473. (40) Boon, C.; Dick, T. Mycobacterium bovis BCG response regulator essential for hypoxic dormancy. J. Bacteriol. 2002, 184 (24), 6760– 6767. (41) Park, H. D.; Guinn, K. M.; Harrell, M. I.; Liao, R.; Voskuil, M. I.; Tompa, M.; Schoolnik, G. K.; Sherman, D. R. Rv3133c/dosR is a transcription factor that mediates the hypoxic response of Mycobacterium tuberculosis. Mol. Microbiol. 2003, 48 (3), 833–843. (42) Starck, J.; Kallenius, G.; Marklund, B. I.; Andersson, D. I.; Akerlund, T. Comparative proteome analysis of Mycobacterium tuberculosis grown under aerobic and anaerobic conditions. Microbiology 2004, 150, 3821–3829. (43) Voskuil, M. I.; Schnappinger, D.; Visconti, K. C.; Harrell, M. I.; Dolganov, G. M.; Sherman, D. R.; Schoolnik, G. K. Inhibition of respiration by nitric oxide induces a Mycobacterium tuberculosis dormancy program. J. Exp. Med. 2003, 198 (5), 705–713. (44) Cooksey, R. C.; Morlock, G. P.; Glickman, S.; Crawford, J. T. Evaluation of a line probe assay kit for characterization of rpoB mutations in rifampin-resistant Mycobacterium tuberculosis isolates from new York City. J. Clin. Microbiol. 1997, 35 (5), 1281– 1283. (45) Nash, K. A.; Gaytan, A.; Inderlied, C. B. Detection of rifampin resistance in Mycobacterium tuberculosis by use of a rapid, simple, and specific RNA/RNA mismatch assay. J. Infect. Dis. 1997, 176 (2), 533–536. (46) Williams, D. L.; Spring, L.; Collins, L.; Miller, L. P.; Heifets, L. B.; Gangadharam, P. R. J.; Gillis, T. P. Contribution of rpoB mutations to development of rifamycin cross-resistance in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 1998, 42 (7), 1853– 1857. (47) Piatek, A. S.; Tyagi, S.; Pol, A. C.; Telenti, A.; Miller, L. P.; Kramer, F. R.; Alland, D. Molecular beacon sequence analysis for detecting drug resistance in Mycobacterium tuberculosis. Nat. Biotechnol. 1998, 16 (4), 359–363. (48) Torres, M. J.; Criado, A.; Palomares, J. C.; Aznar, J. Use of realtime PCR and fluorimetry for rapid detection of rifampin and isoniazid resistance-associated mutations in Mycobacterium tuberculosis. J. Clin. Microbiol. 2000, 38 (9), 3194–3199. (49) Mokrousov, I.; Jiao, W. W.; Sun, G. Z.; Liu, J. W.; Li, M.; Narvskaya, O.; Shen, A. D. Evaluation of the rpoB macroarray assay to detect rifampin resistance in Mycobacterium tuberculosis in Beijing, China. Eur. J. Clin. Microbiol. 2006, 25 (11), 703–710. (50) Caoili, J. C.; Mayorova, A.; Sikes, D.; Hickman, L.; Plikaytis, B. B.; Shinnick, T. M. Evaluation of the TB-Biochip oligonucleotide microarray system for rapid detection of rifampin resistance in Mycobacterium tuberculosis. J. Clin. Microbiol. 2006, 44 (7), 2378–2381.

PR070242Z

Journal of Proteome Research • Vol. 6, No. 12, 2007 4571