cGMP binding domain D mediates a unique activation mechanism in

Subscriber access provided by Gothenburg University Library

Article

cGMP binding domain D mediates a unique activation mechanism in Plasmodium falciparum PKG Eugen Franz, Matthias J. Knape, and Friedrich W. Herberg ACS Infect. Dis., Just Accepted Manuscript • DOI: 10.1021/acsinfecdis.7b00222 • Publication Date (Web): 18 Dec 2017 Downloaded from http://pubs.acs.org on December 22, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Infectious Diseases is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Infectious Diseases

cGMP binding domain D mediates a unique activation mechanism in Plasmodium falciparum PKG

Eugen Franz, Matthias J. Knape and Friedrich W. Herberg*

From the Department of Biochemistry, University of Kassel, Heinrich-Plett-Strasse 40, 34132 Kassel, Germany

*

Corresponding author (Friedrich W. Herberg: [email protected])

Eugen Franz: [email protected] Matthias J. Knape: [email protected]

1 ACS Paragon Plus Environment

ACS Infectious Diseases 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 35

cGMP-dependent protein kinase from Plasmodium falciparum (PfPKG) plays a crucial role in the sexual as well as the asexual proliferation of this human malaria causing parasite. However, function and regulation of PfPKG are largely unknown. Previous studies showed that the domain organization of PfPKG significantly differs from human PKG (hPKG) and indicated a critical role of the cyclic nucleotide binding domain D (CNB-D). We identified a novel mechanism, where the CNB-D controls activation and regulation of the parasite specific protein kinase. Here, kinase activity is not dependent on a pseudosubstrate autoinhibitory sequence (IS), as reported for human PKG. A construct lacking the putative IS and containing only the CNB-D and the catalytic domain is inactive in the absence of cGMP and can efficiently be activated with cGMP. Based on structural evidence, we describe a regulatory mechanism, whereby cGMP binding to CNB-D induces a conformational change involving the αC-helix of the CNB-D. The inactive state is defined by a unique interaction between Asp597 of the catalytic domain and Arg528 of the αC-helix. The same arginine (R528), however, stabilizes cGMP binding by interacting with Tyr480 of the phosphate binding cassette (PBC). This represents the active state of PfPKG. Our results unveil fundamental differences in the activation mechanism between PfPKG and hPKG, building the basis for the development of strategies for targeted drug design in fighting malaria.

Keywords Malaria, Plasmodium falciparum, PfPKG, cGMP-dependent protein kinase, cGMP, cyclic nucleotides.


Page 3 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


With approximately 214 million cases per year, malaria is still the most pathogenmediated infectious diseases worldwide. In 2015 the number of malaria deaths accounted to about 438 000.1 The disease is caused by protozoans of the genus Plasmodium, which are transmitted by the female Anopheles mosquito, thus the distribution of malaria is directly related to the living area of the mosquito. Malaria tropica is the most dangerous variant of malaria and is caused by Plasmodium falciparum.2 For the treatment of malaria, various drugs such as chloroquine, atovaquone, proguanil or artemisin are currently used. Treatment of malaria has been hampered severely by drug resistance, making the development of next generation antimalarial drugs indispensable.3 P. falciparum exhibits a complex life cycle advancing through multiple stages in both its human and the mosquito hosts. This involves tightly controlled intracellular processes including cyclic nucleotide signaling and a variety of protein kinases.4 The genome of P. falciparum encodes about 90 protein kinases including the CMGC, NIMA,

calcium-dependent,

PIK

and

AGC

kinase

family.5-6

Among

those,

cAMP-dependent protein kinase (PKA) and cGMP-dependent protein kinase (PKG) are the best characterized protein kinases biochemically and structurally. The P. falciparum homologue of PKA (PfPKA) was identified in the year 2000 and the PKG homologue (PfPKG) only two years later.7-8 Due to early evolutionary branching, cyclic nucleotide signaling in Plasmodium parasites differs significantly from their mammalian counterpart.5 cGMP signaling was shown to have a pivotal role in exflagellation and gametogenesis in the asexual blood stage and for schizogony in liver stage development.9-11 In contrast, cAMP signaling controls apical exocytosis, sporozoite motility, anion transport through the infected red blood cell (RBC) membrane and invasion of liver cells and RBCs.12-15



Page 4 of 35

The main effector of cGMP in Plasmodium is PfPKG.16 The P. falciparum genome encodes a single PKG isoform, which consists of an N-terminal regulatory domain and a C-terminal catalytic domain. The regulatory domain of PfPKG comprises four cGMP binding domains (CNB-A/B/C/D) with a degenerate CNB-C. With two cGMP binding domains (CNB-A and -B), the regulatory domain of mammalian PKGs differs significantly from that of PfPKG. Moreover, with 97.5 kDa, PfPKG is larger than its mammalian orthologue and is missing a dimerization domain.7,

17-18

A recent

phosphoproteomics study revealed 107 phosphorylation sites on 69 proteins as direct or indirect cellular targets of PfPKG, including proteins involved in cell signaling, gene regulation, proteolysis and protein transport.19 Studies on the activation mechanism of human PKGs (type I as well as type II isoforms) demonstrated that hPKG is regulated by autoinhibition via an N-terminal pseudosubstrate inhibitory sequence (IS).20-22 According to this model, the N-terminal IS binds to the C-terminal catalytic domain, rendering the inactive state of hPKG. Binding of cGMP to both CNBs induces conformational changes, which displace the IS from the catalytic domain.23-25 Based on sequence alignments of the apicomplexan

PKGs

and

their

mammalian

orthologues,

an

N-terminal

pseudosubstrate inhibitory sequence was predicted, suggesting a similar activation mechanism.26 Previous studies demonstrated that the C-terminal CNB-D is important for the activation of PfPKG.17-18 A crystal structure of the isolated cGMP-bound CNB-D revealed a capping triad formed upon cGMP binding. This capping triad is conserved in all apicomplexan PKGs, consisting of an arginine (R484 in PfPKG) in the phosphate binding cassette (PBC) and a glutamine (Q532) as well as an aspartate (D533) in the αC-helix. Yet so far, the exact activation mechanism of this parasite kinase is largely unexplored. 4 ACS Paragon Plus Environment

Page 5 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In this study, we analyzed the molecular mechanisms of PfPKG regulation, studying the details of how domain organization and cGMP binding mediate activation and inhibition. Since the regulatory domain of PfPKG significantly differs from hPKG, this Plasmodium kinase could act as a potential drug target for the treatment of malaria.

Results The detailed molecular basis of how cGMP binding controls catalytic activity of PfPKG is not known so far. In mammals both PKA and PKG are regulated by a pseudosubstrate inhibitory sequence (IS) 20, either on a separate regulatory subunit as in PKA, or on the same polypeptide chain (PKG). However, for PfPKG biochemical evidence for the autoinhibitory function of an IS is missing so far. The role of the inhibitory sequence in regulation of PfPKG To investigate the role of an IS for the regulation of PfPKG, we generated a deletion construct of PfPKG lacking the N-terminal putative autoinhibitory sequence (PfPKG 32-853, catalytic domain with CNB-A/B/C/D without IS, Fig. 1A). The mutant protein was expressed in E. coli TP2000 ∆cya, a bacterial strain lacking adenylyl cyclase activity, and purification was performed under cyclic nucleotide-free conditions allowing for affinity measurements using fluorescence polarization (FP) and activation studies based on microfluidic mobility-shift assays (MSA, Caliper).27 The expression of PfPKG 32-853 and full length PfPKG in TP2000 resulted in low yields and consequently it was not possible to quantify the exact phosphotransferase activity for these constructs. However, it was shown previously that the full length protein including the IS is activated at nanomolar concentrations of cGMP.18 Although lacking the IS, the activity of PfPKG 32-853 was efficiently inhibited in the absence of cGMP.

Moreover,

this

mutant

protein

could

be

activated

by

cGMP 5

ACS Paragon Plus Environment


(Kact(cGMP) = 315 nM,

Fig. 1C),

comparable

to

Page 6 of 35

the

full

length

protein

(Kact(cGMP) = 330 nM, Fig. 1C and Deng et al. 17). We therefore conclude that control of activity may not depend on the interaction of the N-terminal IS motif with the catalytic domain as described for hPKG. The CNB-D is sufficient for autoinhibition of PfPKG Since activation still depends on cGMP binding, we then analyzed which part of the regulatory domain is responsible for activation. For this, we sequentially deleted the individual CNBs and generated the following constructs: PfPKG 158-853 (catalytic domain with CNB-B/C/D), PfPKG 275-853 (catalytic domain with CNB-C/D), PfPKG 401-853 (catalytic domain with CNB-D), and PfPKG 519-853 (isolated catalytic domain) (Fig. 1A). All deletion constructs were expressed in E. coli TP2000 ∆cya. PfPKG 158-853 (catalytic domain with CNB-B/C/D) and 275-853 (catalytic domain with CNB-C/D) showed low basal activity and again, both could be activated with cGMP (19-fold, Fig. 1B). Surprisingly, even PfPKG 401-853, just comprising CNB-D and the catalytic domain showed a low basal activity in the absence of cGMP (about 0.2 U/mg) and was efficiently activated by cGMP (30-fold to 5.3 U/mg, Fig. 1B, S1 Table). This corresponds to about 60% activity of the full length protein.18 The isolated catalytic domain (PfPKG 519-853) showed high level expression in TP2000 yielding a stable protein, however, no kinase activity could be detected with the peptide substrates PKStide or Kemptide in the presence or absence of cGMP. It should be noted that for the calculation of specific activities, the active protein concentration was determined by titration with Compound 2 (specific inhibitor of PfPKG).28 Depending on the protein preparation 50-80% of the protein concentration as determined by the Bradford assay was catalytically active. We then analyzed cGMP binding to the deletion construct containing CNB-D and the catalytic domain (PfPKG 401-853: EC50 = 42 ± 6 nM, Table 1), revealing similar 6 ACS Paragon Plus Environment

Page 7 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


affinities for cGMP as described for the isolated CNB-D.18 Strikingly, the activation constant for cGMP (Kact = 270 ± 10 nM) was almost identical to the full length PfPKG (Kact = 330 ± 20 nM) (Fig. 1C). These data again suggest that control of activity may not depend on the interaction of an N-terminal IS with the catalytic domain, as described for human PKG (hPKG). Hence, we tested the putative IS

26

as a short peptide (ERNKKKAIFSNDDF) on

PfPKG kinase activity in a spectrophotometric assay.29 PfPKG 401-853, pre-activated with cGMP (100 µM), could not be inhibited by this IS peptide (500 µM) (Fig. 1B). Moreover, based on fluorescence polarization (FP), we were not able to demonstrate any interaction of an FITC-labelled IS peptide (FITC-ERNKKKAIFSND) with PfPKG (Fig. S1). Binding of cGMP to CNB-D is a prerequisite for PfPKG activation In previous studies, we and others demonstrated that the CNB-C of PfPKG is degenerate and binds neither cGMP or cAMP. While the isolated CNBs A and B have been described as low affinity nucleotide binding sites with low selectivity between cAMP and cGMP, the isolated CNB-D is a high-affinity, cGMP selective site.17-18 To further investigate the involvement of CNB-D in the activation mechanism, we selectively changed the conserved Arg within the phosphate binding cassette (PBC). This residue (R492 in CNB-D), interacting specifically with cGMP, was replaced by a Lys residue. The R492K mutant protein bound cGMP with extremely low affinity (EC50 > 100 µM, Table 1) and showed a tremendously elevated activation constant (approximately 600-fold) (Fig. 2), yet only slightly decreased maximum phosphotransferase activity compared to PfPKG 401-853 (Fig. 1B, S1 Table). Along this line, binding of cGMP to CNB-D may cause a conformational change in this domain, which unleashes catalytic activity potentially by stabilizing an active conformation of the kinase. 7 ACS Paragon Plus Environment


Page 8 of 35

Interestingly, when comparing PfPKG 401-853 and full length PfPKG, the Hill slopes changed from 0.7 to 1.6, indicating that CNB-A and -B entail some positive cooperativity (Fig. 1D). To investigate the role of CNB-B in the regulation of PfPKG, we used a construct encompassing CNB-B/C/D and the catalytic domain (PfPKG 158-853). We now disrupted cGMP binding in CNB-B and CNB-D in this construct by mutating the respective Arg residues to Lys (R250K and R492K) (Fig. 1A). Interestingly, both mutant proteins displayed comparable affinities for cGMP (70 to 110 nM, Table 1), while previously a micromolar affinity for cGMP was determined for the isolated CNB-B.18 The specific activity of both mutant proteins was reduced to 50% compared to PfPKG 158-853 (S1 Table). While disruption of cGMP binding to CNB-B (R250K) had no influence on the activation constant, mutation of CNB-D (R492K) strongly influenced PfPKG activation (Fig. 2). Again, the Kact value was about 600-fold higher compared to PfPKG 158-853, suggesting that cGMP binding to CNB-D triggers activation. The CNB-B cannot substitute for the CNB-D Amino acid alignments of the CNB-D between all CNBs revealed the highest identity between CNB-D and CNB-B (38%, Fig. 3A). To test whether the CNB-B can structurally and functionally substitute for the CNB-D, we generated a construct where the catalytic domain was fused to the CNB-B (PfPKG 158-294/540-853). This chimera bound cGMP with low affinity (EC50 = 1260 nM), which is in line with data for the isolated CNB-B as determined previously (EC50 = 1200 nM, Kim et al. 18) (Fig. 3C). However, the chimera was not active in the presence or absence of cGMP. Apparently, CNB-B cannot substitute for the function of CNB-D in the activation of the parasite specific kinase. The role of the αC-helix of CNB-D in PfPKG activation 8 ACS Paragon Plus Environment

Page 9 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


We compared several available apo-structures of full length PfPKG (PDB code: 5DYK) and P. vivax PKG (PvPKG) (PDB code: 5DZC). Those structures reflect the inhibited state of the protein and in both an α(C)-helix connects the C-terminal CNB-D to the respective catalytic domain. Structural analyses revealed an Arg residue (R528) in the αC-helix that forms a hydrogen bond with an Asp residue (D597) of the catalytic domain. Interestingly, the same Arg (R528) was found to interact with the hydroxyl group of a Tyr residue (Y480) in the PBC based on the crystal structure of the isolated, cGMP-bound CNB-D (PDB code: 4OFG) (Fig. 4A, 4B). To delineate the influence of these three amino acids on activation, we introduced the following mutations into the PfPKG 401-853 construct: Y480F, R528K and D597N. Binding studies using FP demonstrated that none of these mutations had a significant effect on cGMP affinity (S2 Table), however, activation studies with cGMP revealed an approximately 5-fold higher Kact value for PfPKG 401-853 Y480F compared to the wildtype construct (Kact = 1500 ± 170 nM versus 270 ± 10 nM). In contrast, D597N (Kact = 87 ± 10 nM) and R528K (Kact = 75 ± 10 nM) displayed 3-fold lower activation constants (Fig. 4D). While the catalytic activity of the D597N and Y480F mutant proteins was only slightly reduced compared to PfPKG 401-853, the R528K mutation resulted in a very low activity (9-fold reduced). Furthermore, although the basal activity of all constructs was similar, only D597N and Y480F could be activated in a similar manner (25-fold and 15-fold compared to 30-fold for PfPKG 401-853). Notably, R528K could be activated only 3-fold (Fig. 4C), again supporting the indispensable role of the αC-helix in CNB-D.

Discussion



Page 10 of 35

Malaria is expected to increase in the near future since vaccines are not readily available and the emergence of increasing drug resistance, requires alternative therapeutic strategies. Protein kinases represent one target for the development of antimalarial drugs. Recent phosphoproteomics studies revealed that numerous protein kinases are involved in the life cycle of P. falciparum.19,

30

In particular, the

cGMP-dependent protein kinase of P. falciparum offers potential for the rational design of innovative antimalarial drugs. This protein kinase plays an important role in gene regulation, proteolysis and protein transport within the malaria parasite life cycle in both sexual and asexual blood-stages.19 A recent study by Baker and coworkers demonstrated that targeting PfPKG with the protein kinase inhibitor ML10 blocks blood stage proliferation in vitro and hinders both merozoite egress and erythrocyte invasion in vivo.31 The primary structure of PfPKG differs significantly from its mammalian counterpart with regulatory domain of PfPKG encompassing four instead of two CNBs.7, 32 Alignments of human and apicomplexan PKG sequences as well as gel filtration chromatography experiments on Eimeria tenella PKG demonstrated that parasite PKGs lack the N-terminal leucine zipper motif and are monomeric.33-34 For cyclic nucleotide-dependent protein kinases two principle mechanisms of autoinhibition are described sharing the common theme of (pseudo)substrate inhibition. The first one, exemplified in mammalian PKG (mPKG), is based on kinase regulation by a short inhibitory sequence (IS), mimicking the substrate consensus sequence.20-22 The second mechanism is employed by a close relative, cAMP-dependent protein kinase (PKA), where autoinhibitory sequences are located on both types of physiological inhibitor proteins, the PKA regulatory subunits and the heat stable protein kinase inhibitors (PKI). Peptides derived from these inhibitory sequences are efficient inhibitors of PKA kinase activity.35 Upon binding of cyclic nucleotides, the IS is displaced, allowing for catalytic activity.23-25 Interestingly, the 10 ACS Paragon Plus Environment

Page 11 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


sequences of the respective IS´ in mammalian PKG isoforms are not highly conserved.36 Yet, sequence alignments of apicomplexan PKGs with mammalian PKG isoforms indicated similarities in the IS, leading to the assumption that activity of PfPKG is also controlled by autoinhibition.26 Our study, however, revealed no influence of the putative IS on autoinhibition. This is based on two lines of evidence: (i.) truncation of the putative N-terminal IS did not alter basal activity in the absence of cGMP; (ii.) a peptide comprising the putative IS failed to inhibit PfPKG kinase activity in the presence of cGMP. We also tested common substrate peptides of PKG, where in the respective phosphorylation site a serine was replaced with an alanine. The pseudosubstrates tested, Ala-Glasstide 37 and Ala-Kemptide 38, showed no binding to the kinase based on FP (data not shown). Strikingly, all PfPKG constructs with or without IS displayed catalytic activity only in the presence of cGMP. This effect is particularly prominent for the construct encompassing only the catalytic domain and CNB-D (PfPKG 401-853). This construct had low basal activity in the absence of cGMP, but was efficiently activated by cGMP (30-fold). Thus, our results indicate a completely novel regulatory mechanism, where the control of kinase activity may not depend at all on autoinhibition by an N-terminal IS motif. As a consequence, other contacts between the regulatory and the catalytic domains need to lock the kinase in a catalytically inactive state. This suggests a fundamentally different activation mechanism for PfPKG, where the parasite specific CNB-D acts as regulatory domain controlling catalytic activity in PfPKG. These results are consistent with previous studies on PfPKG, which showed that all three cGMP-binding sites are involved in kinase regulation, but the CNB-D has the strongest influence on activation.17 In line with this our chimeric constructs, where CNB-D is replaced by CNB-B still bound cGMP, but yielded an inactive protein. 11 ACS Paragon Plus Environment


Page 12 of 35

To test in more detail how cGMP binding to CNB-D affects activation, we generated a mutant enzyme defective in cGMP binding (PfPKG 401-853 R492K). Introducing R492K within the PBC of CNB-D reduces cGMP binding affinity by more than three orders of magnitude, based on surface plasmon resonance (SPR) data. This Arg is a conserved feature of all functional PBCs and interacts with the phosphodiester of the cyclic nucleotide.39 Interestingly, mutagenesis of a corresponding residue in bovine PKA RIα, R209K in CNB-A and R333K in CNB-B, reduced the cAMP affinity for CNB-A and CNB-B only by a factor of 10.40 While the PfPKG cGMP deficient construct (PfPKG 401-853 R492K) had only slightly decreased specific activity compared to PfPKG 401-853, the activation constant for cGMP was highly increased (600-fold higher), in accordance with the strongly reduced affinity. Even adding back CNB-B and -C (158-853 R492K) did not change the respective activation constants. In contrast, mutating solely CNB-B (R250K) did not influence the activation constant. It should be noted, that the specific activity for this cGMP deficient mutants was reduced by 50% compared to PfPKG 158-853, indicating that all functional CNBs seem to be required for maximal kinase activity. Mutation of the respective CNB-A and -B in Eimeria tenella PKG and in Toxoplasma gondii PKG resulted in a small effect on activity, however, when CNB-D was disrupted, activity was decreased by >70%.32 Already early studies on mPKG Iα demonstrated that occupation of CNB-A partially activates the kinase, yet, saturation of all CNBs is required for full activation.23, 25, 41 Truncated constructs, where the CNBs were sequentially deleted, revealed similar activation constants comparable to full length PfPKG (Fig. 1C). However, the Hill slopes changed from 1.6 (PfPKG 1-853, full length) to 0.7 (PfPKG 401-853), suggesting that N-terminal CNB-A and CNB-B induce positive cooperativity. Our


Page 13 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


results are consistent with studies of Salowe and coworkers reporting positive cooperativity (Hill slope of 1.7) for another parasite PKG, EtPKG.32 With the crystal structure of the full length PfPKG (PDB code: 5DYK) available, first insight into the domain organization of PKG catalytic domains is provided. This crystal structure reveals a single helix (αC-helix (AA 520-542) between CNB-D and catalytic domain, originally assigned to the CNB-D.18 This αC-helix most likely corresponds to a highly conserved A-helix of the catalytic domain also found in PKA of various organisms.42-43 Here, this N-terminal amphipathic helix (A-helix, AA 15-40 in murine PKA) spans the surface between the small and the large kinase lobe covering a hydrophobic surface. The A-helix is important for thermostability and for activation of PKA Type II holoenzyme.42-43 For PfPKG we conclude that both the catalytic domain and CNB-D, share this helix. Our previous structural analyses showed that binding of cGMP to CNB-D induces a drastic conformational change in the C-terminal αC-helix.18 An arginine (R528) located on the αC-helix directly interacts with an aspartate (D597) of the catalytic domain, stabilizing the αC-helix in a cGMP-free form, corresponding to the inactive state of PfPKG. Binding of cGMP to CNB-D induces conformational changes, reorienting R528 towards the PBC. In this cGMP-bound form, an interaction between Y480 and R528 stabilizes the active state. To investigate this proposed activation mechanism in more detail, we introduced three specific mutations (Y480F, R528K and D597N, Fig. 4A, 4B). Weakening the interaction between R528 and D597 by introducing either a Lys at position 528 (R528K), or an Asn at position 597 (D597N) resulted in a 3-fold lower Kact-value, suggesting that the αC-helix cannot longer be stabilized in the inactive state. Notably, the R528K mutant protein could be activated only 3-fold with cGMP and showed 10-fold reduced activity (0.6 U/mg). Introducing a Phe at position 480 (Y480F), abolishing the interaction with R528, increased the 13 ACS Paragon Plus Environment


Page 14 of 35

Kact-value about 5-fold. Here, the αC-helix cannot be stabilized in the active, cGMP-bound state anymore. Taken together, our model suggests that the catalytic activity of PfPKG is mainly controlled by the αC-helix of CNB-D. Apparently, there are two different conformations of the αC-helix. Without cGMP, the αC-helix stabilizes the catalytic domain in inactive state via interaction between R528 and D597. Upon cGMP binding, the αC-helix moves towards PBC and the interaction between Y480 and R528 stabilizes the αC-helix in a conformation corresponding to the active state of PfPKG. Recent crystal structures reveal this specific interaction between R528 and D597 also in Plasmodium vivax PKG.31 Having shown that the interaction between Y480 and R528 is a prerequisite for PfPKG activation, disruption of this interaction could be a potential target for allosteric inhibitors. This novel strategy may include specific small molecule competitors, restrained

scaffolds

like

stapled

peptides,

or

cyclic

nucleotide

analogues

(antagonists) selective for CNB-D.

Material and Methods Construct design and mutagenesis All protein constructs of PfPKG were ligated into the pQTEV-vector (N-terminal HisTag) 27 applying BamHI and HindIII restriction sites. Site-directed mutagenesis was performed using the KAPA HiFi Polymerase with the respective site-specific primer pairs (KAPA Biosystems, Wilmington, MA, USA): R250K

for:

GATGAACCGAAATCAGCCACAATT,

AATTGTGGCTGATTTCGGTTCATC,

R250K

R492K

rev: for:

CGACGAGCCTAAAACCGCAAGC, R492K rev: GCTTGCGGTTTTAGGCTCGTCG, Y480F

for:

GCAAAAATGATTTCTTTGGCGAGCG,

Y480F

rev: 14


Page 15 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CGCTCGCCAAAGAAATCATTTTTGC,

R528K

for:

CATCTGGAAGAAAAGATTAAAATGC,

R528K

rev:

GCATTTTAATCTTTTCTTCCAGATG,

D597N

for:

CCGCAGAAAACAATCATCCGTTT,

D597N

rev:

AAACGGATGATTGTTTTCTGCGG. Template DNA was digested using DpnI (2h, 37°C). All mutant constructs were verified by Sanger sequencing (GATC Biotech Konstanz, Germany).

Protein expression and purification All PfPKG protein constructs were expressed in E. coli TP2000. Cells were grown at 37°C until an OD600nm of 0.6-0.8. Expression was then induced with 500 µM IPTG and the protein constructs were expressed overnight at 18°C. The cells were harvested by centrifugation at 7000 xg for 20 min and 4°C. Next, the cells were resuspended using lysis buffer containing 50 mM sodium phosphate (pH 8.0), 300 mM NaCl, 10 mM imidazole, 5 mM 2-mercaptoethanol and EDTA-free protease inhibitor (cOmpleteTM, Roche, Basel, Switzerland) and lysed using a French press (Thermo Scientific, Waltham, MA, USA). The lysate was centrifuged at 45.000 xg for 20 min at 4°C and incubated with Protino Ni-NTA agarose (Macherey-Nagel, Dueren, Germany). After incubation, the agarose was washed four times with washing buffer containing 50 mM sodium phosphate (pH 8.0), 300 mM NaCl, 60 mM imidazole and 5 mM 2-mercaptoethanol. The His-tagged protein constructs were eluted with elution buffer

containing

50

mM

sodium

phosphate

(pH 8.0),

300 mM NaCl,

250 mM imidazole, 5 mM 2-mercaptoethanol. Finally, the samples were loaded onto a HiLoad 16/60 Superdex 75 gel filtration column (GE Healthcare, Chalfont St Giles, United Kingdom) equilibrated with a buffer containing 20 mM MOPS (pH 7.0), 300 mM NaCl and 1 mM DTT. Sample purity was verified using a SDS-PAGE ACS Paragon Plus Environment

44

. 15


Protein concentration was determined using the Bradford assay (Bio-Rad, Hercules, CA, USA). The protein constructs were stored at 4°C until use. At least two separate protein preparations were used for all measurements.

Fluorescence Polarization (FP) The fluorescence polarization (FP) assay was performed as described before.45 All measurements were performed in 20 mM MOPS (pH 7.0), 150 mM NaCl and 0.005% CHAPS. For the competition assays, the cGMP (Biolog Life Science Institute, Bremen, Germany) dilutions were mixed with 0.5 nM (finale concentration) 8-Fluo-cGMP (Biolog Life Science Institute, Bremen, Germany) and a fixed protein concentration (4-8 nM) in a black 384-well microtiterplate (Perking Elmer, Waltham, MA, USA). For the IS peptide studies, fixed concentrations of the FITC-IS peptide (FITC-ERNKKKAIFSNDDF) and the protein samples were mixed. Data acquisition was done using a FusionTMα-FP microtiter plate reader at room temperature for two seconds at 485 nM (Ex) and 535 nm (Em) with a PMT voltage of 1100 V. Binding data was analyzed using GraphPad Prism 6 by plotting the measured FP signal in mPol against the logarithm of the cGMP concentration. The EC50 values were calculated from sigmoidal dose-response (variable slope) curves.

Surface Plasmon Resonance (SPR) Surface plasmon resonance (SPR) assays were performed at 25°C with running buffer (20 mM MOPS (pH 7.0), 150 mM NaCl and 0.005% (v/v) surfactant polysorbate P20) using a Biacore T200 system (GE Healthcare, Chalfont, UK). The cyclic nucleotide analog (8-AET-cGMP) was coupled to CM5 sensor chip surface (GE Healthcare, Chalfont, UK) as described previously.46 For solution competition assays, the cGMP (Biolog Life Science Institute, Bremen, Germany) dilutions were 16 ACS Paragon Plus Environment

Page 16 of 35

Page 17 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mixed with a fixed protein concentration (10-20 nM) before injection. All measurements were performed at a flow rate of 30 µL/min. The association and dissociation phase for at least 150 s, respectively. After each measurement cycle, the surface was regenerated by two injections of SDS (0.5% w/v) SDS for 30 s and 1 M NaCl for 60 s. Data was analyzed using GraphPad Prism 6 by plotting the SPR signal (RU) 10 s before the end of the association phase against the logarithm of the cGMP concentration. The EC50 values were calculated from sigmoidal doseresponse (variable slope) curves.

Microfluidic mobility-shift assay The respective activation constants (Kact) were determined using a microfluidic mobility-shift assay on a Caliper DeskTop Profiler (PerkinElmer, Waltham, MA, USA). cGMP dilution series were prepared in 20 µL buffer (20 mM MOPS (pH 7.0), 300 mM NaCl, 1 mM DTT, 0.05% L-31, 990 µM PKStide (GRTGRRNSI; GeneCust, Luxembourg), 10 µM FITC-PKStide (FITC-GRTGRRNSI; GeneCust, Luxembourg), 1 mM ATP and 10 mM MgCl2) with a fixed protein concentration. Samples without cGMP were used as a control. The samples were incubated for 2 h at a room temperature in a 384-well plate (Corning LV, non-binding surface) before measurement. A ProfilerProTM LabChip (4-sipper mode, PerkinElmer, Waltham, MA, USA) was used for the separation of product and substrate using following conditions: upstream voltage -1900 V, downstream voltage -500 V and a screening pressure of -1.3 psi. Data analysis was done using GraphPad Prism 6 by plotting the measured substrate conversion against the logarithm of the cGMP concentration. The Kact values were calculated from sigmoidal dose-response (variable slope) curves.



Page 18 of 35

Determination of specific activity The specific activity was measured using a coupled spectrophotometric assay according to Cook.29 All measurements were performed at room temperature in reaction buffer (100 mM MOPS (pH 7.0), 10 mM MgCl2, 1 mM phosphoenolpyruvate, 1 mM

ATP,

220 µM

NADH,

5 mM

2-mercaptoethanol,

15.1 U/mL

lactate

dehydrogenase and 8.4 U/mL pyruvate kinase). PfPKG samples were mixed with reaction buffer and measured with cGMP (100 µM) and without cGMP in a quartz cuvette. Since some of the mutant proteins required higher cGMP concentration for full activation (in the µM range) compared to wildtype (about 300 nM) we used 100 µM cGMP for all spectrophotometric measurements (specific activity under full activation) to ensure comparable conditions. The kinase reaction was started by adding 1 mM PKStide (GRTGRRNSI; GeneCust, Luxembourg). The absorption at 340 nm was monitored photometrically (Specord 205, Analytik Jena) for at least 60 s and the slope was determined. The specific activity in U/mg was calculated based on the Beer-Lambert law using GraphPad Prism 6. Active protein concentration for all protein constructs including the catalytic domain were determined by titrating with the inhibitor Compound 2. For this, 200-300 nM of the respective pre-activated protein (with 100 µM cGMP) was measured in the presence of various concentrations of Compound 2 (3-600 nM) in reaction buffer containing 1 mM PKS-tide. The determined slopes were analyzed with GraphPad Prism 6.

Acknowledgements We thank Michaela Hansch (University of Kassel) for expert technical assistance. We also thank David Baker (London School of Hygiene & Tropical Medicine, London) for 18 ACS Paragon Plus Environment

Page 19 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


providing Compound 2 and the PfPKG 1-853 DNA clone. We acknowledge Jascha Manschwetus (University of Kassel) and Eileen J. Kennedy (University of Georgia) for the peptide synthesis of FITC-IS.

Funding information E.F. is supported by a Ph.D fellowship of the Kassel University as a member of the graduate

program

Functionomics.

F.W.H.

is

funded

by

the

Deutsche

Forschungsgemeinschaft [Grant ID: He1818/10]. F.W.H. and M.J.K. are supported in the funding line Future (Phosmorg) and by research training group (Clocks) of Kassel University.

Supporting information S1 Figure. Interaction between the putative IS peptide and PfPKG recombinant proteins. Interaction studies between PfPKG 1-853 (full length protein, 100 nM), PfPKG 401-853 (CNB-D with catalytic domain, 100 nM) in the absence and presence of 100 µM cGMP and FITC-IS (putative inhibitory sequence, 20 nM) were performed utilizing fluorescence polarization. Buffer with FITC-IS (20 nM) was used as a negative control (C). S1 Table. Specific activities of PfPKG constructs. The specific activity was determined using a spectrophotometric assay and calculated based on the active protein concentration (titrated with Compound 2). PKS-tide (1 mM) was used as the substrate. For the determination of the specific activity 200-300 nM of each PfPKG construct with and without cGMP (100 µM) was used.



Page 20 of 35

S2 Table. EC50 values for cGMP binding of PfPKG constructs. The EC50 values for the PfPKG 401-853 constructs (4-6 nM) were determined by FP competition measurements.

Author Information Corresponding Author *E-mail: [email protected] Author Contributions E.F. performed the biochemical experiments. E.F. and M.J.K. analyzed the data. E.F. M.J.K. and F.W.H. wrote the manuscript. Declarations of interest The authors declare that there is no conflict of interest.

References 1.

Phillips, M. A.; Burrows, J. N.; Manyando, C.; van Huijsduijnen, R. H.; Van

Voorhis, W. C.; Wells, T. N. C., Malaria. Nat Rev Dis Primers 2017, 3, 17050. DOI: 10.1038/nrdp.2017.50. 2.

Cowman, A. F.; Healer, J.; Marapana, D.; Marsh, K., Malaria: Biology and

Disease. Cell 2016, 167 (3), 610-624. DOI: 10.1016/j.cell.2016.07.055. 3.

Miller, L. H.; Ackerman, H. C.; Su, X. Z.; Wellems, T. E., Malaria biology and

disease pathogenesis: insights for new treatments. Nat Med 2013, 19 (2), 156-67. DOI: 10.1038/nm.3073. 4.

Brochet, M.; Billker, O., Calcium signalling in malaria parasites. Mol Microbiol

2016, 100 (3), 397-408. DOI: 10.1111/mmi.13324.


Page 21 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5.

Baker, D. A., Cyclic nucleotide signalling in malaria parasites. Cell Microbiol

2011, 13 (3), 331-9. DOI: 10.1111/j.1462-5822.2010.01561.x. 6.

Doerig, C.; Billker, O.; Haystead, T.; Sharma, P.; Tobin, A. B.; Waters, N. C.,

Protein kinases of malaria parasites: an update. Trends in parasitology 2008, 24 (12), 570-7. DOI: 10.1016/j.pt.2008.08.007. 7.

Deng, W.; Baker, D. A., A novel cyclic GMP-dependent protein kinase is

expressed in the ring stage of the Plasmodium falciparum life cycle. Mol Microbiol 2002, 44 (5), 1141-51. 8.

Li, J.; Cox, L. S., Isolation and characterisation of a cAMP-dependent protein

kinase catalytic subunit gene from Plasmodium falciparum. Mol Biochem Parasitol 2000, 109 (2), 157-63. 9.

Taylor, C. J.; McRobert, L.; Baker, D. A., Disruption of a Plasmodium

falciparum

cyclic

gametogenesis.

Mol

nucleotide Microbiol

phosphodiesterase 2008,

69

(1),

gene

110-8.

causes

DOI:

aberrant

10.1111/j.1365-

2958.2008.06267.x. 10.

Taylor, H. M.; McRobert, L.; Grainger, M.; Sicard, A.; Dluzewski, A. R.; Hopp,

C. S.; Holder, A. A.; Baker, D. A., The malaria parasite cyclic GMP-dependent protein kinase plays a central role in blood-stage schizogony. Eukaryot Cell 2010, 9 (1), 3745. DOI: 10.1128/EC.00186-09. 11.

Falae, A.; Combe, A.; Amaladoss, A.; Carvalho, T.; Menard, R.; Bhanot, P.,

Role of Plasmodium berghei cGMP-dependent protein kinase in late liver stage development. The Journal of biological chemistry 2010, 285 (5), 3282-8. DOI: 10.1074/jbc.M109.070367. 12.

Mota, M. M.; Hafalla, J. C.; Rodriguez, A., Migration through host cells

activates Plasmodium sporozoites for infection. Nat Med 2002, 8 (11), 1318-22. DOI: 10.1038/nm785. 21 ACS Paragon Plus Environment


13.

Page 22 of 35

Ono, T.; Cabrita-Santos, L.; Leitao, R.; Bettiol, E.; Purcell, L. A.; Diaz-Pulido,

O.; Andrews, L. B.; Tadakuma, T.; Bhanot, P.; Mota, M. M.; Rodriguez, A., Adenylyl cyclase alpha and cAMP signaling mediate Plasmodium sporozoite apical regulated exocytosis and hepatocyte infection. PLoS Pathog 2008, 4 (2), e1000008. DOI: 10.1371/journal.ppat.1000008. 14.

Merckx, A.; Nivez, M. P.; Bouyer, G.; Alano, P.; Langsley, G.; Deitsch, K.;

Thomas, S.; Doerig, C.; Egee, S., Plasmodium falciparum regulatory subunit of cAMP-dependent PKA and anion channel conductance. PLoS Pathog 2008, 4 (2), e19. DOI: 10.1371/journal.ppat.0040019. 15.

Leykauf, K.; Treeck, M.; Gilson, P. R.; Nebl, T.; Braulke, T.; Cowman, A. F.;

Gilberger, T. W.; Crabb, B. S., Protein kinase a dependent phosphorylation of apical membrane antigen 1 plays an important role in erythrocyte invasion by the malaria parasite. PLoS Pathog 2010, 6 (6), e1000941. DOI: 10.1371/journal.ppat.1000941. 16.

Hopp, C. S.; Bowyer, P. W.; Baker, D. A., The role of cGMP signalling in

regulating life cycle progression of Plasmodium. Microbes Infect 2012, 14 (10), 8317. DOI: 10.1016/j.micinf.2012.04.011. 17.

Deng, W.; Parbhu-Patel, A.; Meyer, D. J.; Baker, D. A., The role of two novel

regulatory sites in the activation of the cGMP-dependent protein kinase from Plasmodium falciparum. The Biochemical journal 2003, 374 (Pt 2), 559-65. DOI: 10.1042/bj20030474. 18.

Kim, J. J.; Flueck, C.; Franz, E.; Sanabria-Figueroa, E.; Thompson, E.; Lorenz,

R.; Bertinetti, D.; Baker, D. A.; Herberg, F. W.; Kim, C., Crystal structures of the carboxyl cGMP binding domain of the Plasmodium falciparum cGMP-dependent protein kinase reveal a novel capping triad crucial for merozoite egress. PLoS Pathog 2015, 11 (2), e1004639. DOI: 10.1371/journal.ppat.1004639.


Page 23 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


19.

Alam, M. M.; Solyakov, L.; Bottrill, A. R.; Flueck, C.; Siddiqui, F. A.; Singh, S.;

Mistry, S.; Viskaduraki, M.; Lee, K.; Hopp, C. S.; Chitnis, C. E.; Doerig, C.; Moon, R. W.; Green, J. L.; Holder, A. A.; Baker, D. A.; Tobin, A. B., Phosphoproteomics reveals malaria parasite Protein Kinase G as a signalling hub regulating egress and invasion. Nat Commun 2015, 6, 7285. DOI: 10.1038/ncomms8285. 20.

Francis, S. H.; Poteet-Smith, C.; Busch, J. L.; Richie-Jannetta, R.; Corbin, J.

D., Mechanisms of autoinhibition in cyclic nucleotide-dependent protein kinases. Frontiers in bioscience : a journal and virtual library 2002, 7, d580-92. 21.

Francis, S. H.; Smith, J. A.; Colbran, J. L.; Grimes, K.; Walsh, K. A.; Kumar,

S.; Corbin, J. D., Arginine 75 in the pseudosubstrate sequence of type Ibeta cGMPdependent protein kinase is critical for autoinhibition, although autophosphorylated serine 63 is outside this sequence. The Journal of biological chemistry 1996, 271 (34), 20748-55. 22.

Heil, W. G.; Landgraf, W.; Hofmann, F., A catalytically active fragment of

cGMP-dependent protein kinase. Occupation of its cGMP-binding sites does not affect its phosphotransferase activity. European journal of biochemistry 1987, 168 (1), 117-21. 23.

Zhao, J.; Trewhella, J.; Corbin, J.; Francis, S.; Mitchell, R.; Brushia, R.; Walsh,

D., Progressive cyclic nucleotide-induced conformational changes in the cGMPdependent protein kinase studied by small angle X-ray scattering in solution. The Journal of biological chemistry 1997, 272 (50), 31929-36. 24.

Wall, M. E.; Francis, S. H.; Corbin, J. D.; Grimes, K.; Richie-Jannetta, R.;

Kotera, J.; Macdonald, B. A.; Gibson, R. R.; Trewhella, J., Mechanisms associated with cGMP binding and activation of cGMP-dependent protein kinase. Proceedings of the National Academy of Sciences of the United States of America 2003, 100 (5), 2380-5. DOI: 10.1073/pnas.0534892100. 23 ACS Paragon Plus Environment


25.

Alverdi, V.; Mazon, H.; Versluis, C.; Hemrika, W.; Esposito, G.; van den

Heuvel, R.; Scholten, A.; Heck, A. J., cGMP-binding prepares PKG for substrate binding by disclosing the C-terminal domain. J Mol Biol 2008, 375 (5), 1380-93. DOI: 10.1016/j.jmb.2007.11.053. 26.

Baker, D. A.; Deng, W., Cyclic GMP-dependent protein kinases in protozoa.

Frontiers in bioscience : a journal and virtual library 2005, 10, 1229-38. 27.

Bussow, K.; Scheich, C.; Sievert, V.; Harttig, U.; Schultz, J.; Simon, B.; Bork,

P.; Lehrach, H.; Heinemann, U., Structural genomics of human proteins--target selection and generation of a public catalogue of expression clones. Microb Cell Fact 2005, 4, 21. DOI: 10.1186/1475-2859-4-21. 28.

Donald, R. G.; Zhong, T.; Wiersma, H.; Nare, B.; Yao, D.; Lee, A.; Allocco, J.;

Liberator, P. A., Anticoccidial kinase inhibitors: identification of protein kinase targets secondary to cGMP-dependent protein kinase. Mol Biochem Parasitol 2006, 149 (1), 86-98. DOI: 10.1016/j.molbiopara.2006.05.003. 29.

Cook, P. F.; Neville, M. E.; Vrana, K. E.; Hartl, F. T.; Roskoski, R., Adenosine

cyclic 3',5'-monophosphate dependent protein kinase: kinetic mechanism for the bovine skeletal muscle catalytic subunit. Biochemistry 2002, 21 (23), 5794-5799. DOI: 10.1021/bi00266a011. 30.

Solyakov, L.; Halbert, J.; Alam, M. M.; Semblat, J. P.; Dorin-Semblat, D.;

Reininger, L.; Bottrill, A. R.; Mistry, S.; Abdi, A.; Fennell, C.; Holland, Z.; Demarta, C.; Bouza, Y.; Sicard, A.; Nivez, M. P.; Eschenlauer, S.; Lama, T.; Thomas, D. C.; Sharma, P.; Agarwal, S.; Kern, S.; Pradel, G.; Graciotti, M.; Tobin, A. B.; Doerig, C., Global kinomic and phospho-proteomic analyses of the human malaria parasite Plasmodium falciparum. Nat Commun 2011, 2, 565. DOI: 10.1038/ncomms1558. 31.

Baker, D. A.; Stewart, L. B.; Large, J. M.; Bowyer, P. W.; Ansell, K. H.;

Jimenez-Diaz, M. B.; El Bakkouri, M.; Birchall, K.; Dechering, K. J.; Bouloc, N. S.; 24 ACS Paragon Plus Environment

Page 24 of 35

Page 25 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Coombs, P. J.; Whalley, D.; Harding, D. J.; Smiljanic-Hurley, E.; Wheldon, M. C.; Walker, E. M.; Dessens, J. T.; Lafuente, M. J.; Sanz, L. M.; Gamo, F. J.; Ferrer, S. B.; Hui, R.; Bousema, T.; Angulo-Barturen, I.; Merritt, A. T.; Croft, S. L.; Gutteridge, W. E.; Kettleborough, C. A.; Osborne, S. A., A potent series targeting the malarial cGMP-dependent protein kinase clears infection and blocks transmission. Nat Commun 2017, 8 (1), 430. DOI: 10.1038/s41467-017-00572-x. 32.

Salowe, S. P.; Wiltsie, J.; Liberator, P. A.; Donald, R. G., The role of a

parasite-specific allosteric site in the distinctive activation behavior of Eimeria tenella cGMP-dependent protein kinase. Biochemistry 2002, 41 (13), 4385-91. 33.

Diaz, C. A.; Allocco, J.; Powles, M. A.; Yeung, L.; Donald, R. G.; Anderson, J.

W.; Liberator, P. A., Characterization of Plasmodium falciparum cGMP-dependent protein kinase (PfPKG): antiparasitic activity of a PKG inhibitor. Mol Biochem Parasitol 2006, 146 (1), 78-88. DOI: 10.1016/j.molbiopara.2005.10.020. 34.

Gurnett, A. M.; Liberator, P. A.; Dulski, P. M.; Salowe, S. P.; Donald, R. G.;

Anderson, J. W.; Wiltsie, J.; Diaz, C. A.; Harris, G.; Chang, B.; Darkin-Rattray, S. J.; Nare, B.; Crumley, T.; Blum, P. S.; Misura, A. S.; Tamas, T.; Sardana, M. K.; Yuan, J.; Biftu, T.; Schmatz, D. M., Purification and molecular characterization of cGMPdependent protein kinase from Apicomplexan parasites. A novel chemotherapeutic target. The Journal of biological chemistry 2002, 277 (18), 15913-22. DOI: 10.1074/jbc.M108393200. 35.

Glass, D. B.; Cheng, H. C.; Kemp, B. E.; Walsh, D. A., Differential and

common recognition of the catalytic sites of the cGMP-dependent and cAMPdependent protein kinases by inhibitory peptides derived from the heat-stable inhibitor protein. The Journal of biological chemistry 1986, 261 (26), 12166-71.



36.

Hofmann, F.; Dostmann, W.; Keilbach, A.; Landgraf, W.; Ruth, P., Structure

and physiological role of cGMP-dependent protein kinase. Biochim Biophys Acta 1992, 1135 (1), 51-60. 37.

Hall, K. U.; Collins, S. P.; Gamm, D. M.; Massa, E.; DePaoli-Roach, A. A.;

Uhler, M. D., Phosphorylation-dependent inhibition of protein phosphatase-1 by Gsubstrate. A Purkinje cell substrate of the cyclic GMP-dependent protein kinase. The Journal of biological chemistry 1999, 274 (6), 3485-95. 38.

Whitehouse, S.; Feramisco, J. R.; Casnellie, J. E.; Krebs, E. G.; Walsh, D. A.,

Studies on the kinetic mechanism of the catalytic subunit of the cAMP-dependent protein kinase. The Journal of biological chemistry 1983, 258 (6), 3693-701. 39.

Mohanty, S.; Kennedy, E. J.; Herberg, F. W.; Hui, R.; Taylor, S. S.; Langsley,

G.; Kannan, N., Structural and evolutionary divergence of cyclic nucleotide binding domains in eukaryotic pathogens: Implications for drug design. Biochim Biophys Acta 2015, 1854 (10 Pt B), 1575-85. DOI: 10.1016/j.bbapap.2015.03.012. 40.

Herberg, F. W.; Taylor, S. S.; Dostmann, W. R., Active site mutations define

the pathway for the cooperative activation of cAMP-dependent protein kinase. Biochemistry 1996, 35 (9), 2934-42. DOI: 10.1021/bi951647c. 41.

Wolfe, L.; Francis, S. H.; Landiss, L. R.; Corbin, J. D., Interconvertible cGMP-

free and cGMP-bound forms of cGMP-dependent protein kinase in mammalian tissues. The Journal of biological chemistry 1987, 262 (35), 16906-13. 42.

Veron, M.; Radzio-Andzelm, E.; Tsigelny, I.; Ten Eyck, L. F.; Taylor, S. S., A

conserved helix motif complements the protein kinase core. Proceedings of the National Academy of Sciences of the United States of America 1993, 90 (22), 1061822. 43.

Leon, D. A.; Herberg, F. W.; Banky, P.; Taylor, S. S., A stable alpha-helical

domain at the N terminus of the RIalpha subunits of cAMP-dependent protein kinase 26 ACS Paragon Plus Environment

Page 26 of 35

Page 27 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


is a novel dimerization/docking motif. The Journal of biological chemistry 1997, 272 (45), 28431-7. 44.

Laemmli, U. K., Cleavage of structural proteins during the assembly of the

head of bacteriophage T4. Nature 1970, 227 (5259), 680-5. 45.

Moll, D.; Prinz, A.; Gesellchen, F.; Drewianka, S.; Zimmermann, B.; Herberg,

F. W., Biomolecular interaction analysis in functional proteomics. J Neural Transm (Vienna) 2006, 113 (8), 1015-32. DOI: 10.1007/s00702-006-0515-5. 46.

Hanke, S. E.; Bertinetti, D.; Badel, A.; Schweinsberg, S.; Genieser, H. G.;

Herberg, F. W., Cyclic nucleotides as affinity tools: phosphorothioate cAMP analogues address specific PKA subproteomes. New biotechnology 2011, 28 (4), 294-301. DOI: 10.1016/j.nbt.2010.12.001.

Table 1. EC50 values for cGMP binding deficient mutants of PfPKG.

FP

His-PfPKG

EC50 ± SD (nM)

401-853FP

43 ± 7

401-853SPR

24 ± 2

401-853 R492KSPR

> 100000

158-853FP

78 ± 9

158-853 R250KFP

58 ± 6

158-853 R492KFP

115 ± 30

mean values of the EC50 for cGMP determined using FP solution competition

assay with standard deviation (SD) of n ≥ 4 experiments. SPR

mean values of the EC50 for cGMP determined using SPR solution competition

assay with standard deviation (SD) of n ≥ 4 experiments.

Figure Legends 27 ACS Paragon Plus Environment


Page 28 of 35

Figure 1. Domain organization and cGMP-dependent activation of PfPKG. (A) Schematic representation of the domain organization in PfPKG. PfPKG contains four cyclic nucleotide binding domains (CNBs A, B, C and D and a putative N-terminal autoinhibitory sequence (IS). The conserved arginine residues (R132 in CNB-A, R250 in CNB-B and R492 in CNB-D) associated with high-affinity cGMP binding are highlighted. (B) Specific activity of PfPKG deletion constructs (519-853: catalytic domain with αC-helix of CNB-D, 401-853: catalytic domain with CNB-D, 275-853: catalytic domain with CNB-C/D and 158-853: catalytic domain with CNB-B/C/D) as determined by the spectrophotometric assay. A final concentration of 200-300 nM of the respective PfPKG construct was used. Bar diagram depicting basal activity (-cGMP) in black and specific activity (+cGMP, 100 µM) in white. To test the effect of the autoinhibitory sequence (IS), pre-activated PfPKG 401-853 and PfPKG 158-853 (with 100 µM cGMP), were incubated with 500 µM IS peptide, respectively (grey). (C) cGMP activation by microfluidic mobility-shift assay (MSA) for truncated (401-853: catalytic domain with CNB-D, 275-853: catalytic domain with CNB-C/D, 158-853: catalytic domain with CNB-B/C/D and 32-853: without putative IS) and full length PfPKG (1-853). A final concentration of 4-10 nM of the respective PfPKG construct was used. Activation constant (Kact) is defined as the cGMP concentration where half-maximal kinase activity is observed. Kinase activity corresponds to substrate (PKStide, 1 mM) conversion. Normalized data were fitted to a sigmoidal doseresponse plot. (D) Hill slopes as determined from the activation data using GraphPad Prism 6. Hill slope change from 0.7 to 1.6 with CNB-B and CNB-A showing positive cooperativity. Standard errors are specified as SD (standard deviation) of n ≥ 4 experiments.


Page 29 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Binding of cGMP to CNB-D is critical for activation of PfPKG. cGMP activation data determined with a microfluidic mobility-shift assay (MSA) using PKStide as substrate (1 mM). Recombinant mutant proteins PfPKG 401-853 R492K and PfPKG 158-853 R492K show increased the Kact values for cGMP about 600-fold. A final concentration of 4-10 nM of the respective PfPKG construct was used. Standard errors are specified as SD (standard deviation) of n ≥ 4 experiments.

Figure 3. cGMP binding to chimeric protein construct of PfPKG. (A) Sequence alignment of the individual phosphate binding cassettes (PBCs) of cyclic nucleotide binding domains (CNBs A, B, C and D). Residues corresponding to the capping triad (R484, Q532 and D533) of CNB-D are marked in yellow. (B) Chimeric recombinant protein constructs of PfPKG: top: 401-853, bottom: 158-294/540-853, color code as follows: catalytic domain (black), CNB-B (blue), αC-helix of CNB-B (violet), CNB-D (red) and αC-helix of CNB-D (green). (C) cGMP binding affinity of PfPKG constructs (4-8 nM) as determined by fluorescence polarization (FP) competition. Bar diagrams depicting the EC50 values with standard deviation (at least 4 experiments) for cGMP. When replacing the CNB-D (401-542) by the CNB-B (158-294/540-853), a 10-fold higher cGMP affinity was observed compared to PfPKG 401-853 (catalytic domain with CNB-D). Data for the isolated CNB-B (158-294) were taken from Kim et al. 18.

Figure 4. Unique salt bridge forming residues (Y480, R528 and D597) are crucial for cGMP-dependent activation in PfPKG. (A) Crystal structures of the isolated cyclic nucleotide binding domain D (CNB-D, PfPKG 401-542) in complex with cGMP (PDB code: 4OFG) and (B) of the full length PfPKG without cGMP (PDB code: 5DYK). The structure of the CNB-D with cGMP bound (A) shows an interaction between a critical Arg residue (R528) on the αC helix (in red) with a Tyr residue 29 ACS Paragon Plus Environment


Page 30 of 35

(Y480) in the phosphate binding cassette (PBC in yellow). In contrast, in the full length structure without cGMP (B), R528 forms a hydrogen bond with an Asp residue (D597) on the catalytic domain (in green). Recombinant protein constructs are shown in a cartoon representation with the secondary structure elements and cGMP shown as sticks. (C) Specific activity of recombinant proteins expressed by PfPKG mutant constructs as determined by the spectrophotometric assay with 1 mM substrate (PKStide). Basal activity was determined without cGMP and maximum activity using 100 µM cGMP with a final protein concentration of 200-300 nM. R528K has a severe impact on the specific activity and the respective construct can only be 3-fold activated with cGMP compared to wt (PfPKG 401-853; 30-fold activation). (D) Kact values for PfPKG mutant protein constructs (4-10 nM) using MSA. The mutant proteins Y480F show a 5-fold increased and D597N as well as R528K a 6-fold decreased Kact value compared to wt (PfPKG 401-853). For all measurements, the standard errors are specified as SD of n ≥ 4 experiments. All structures were visualized using PyMOL v1.3 (Schrödinger LLC).


Page 31 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Domain organization and cGMP-dependent activation of PfPKG. (A) Schematic representation of the domain organization in PfPKG. PfPKG contains four cyclic nucleotide binding domains (CNBs A, B, C and D and a putative N-terminal autoinhibitory sequence (IS). The conserved arginine residues (R132 in CNB-A, R250 in CNB-B and R492 in CNB-D) associated with high-affinity cGMP binding are highlighted. (B) Specific activity of PfPKG deletion constructs (519-853: catalytic domain with αC-helix of CNB-D, 401-853: catalytic domain with CNB-D, 275-853: catalytic domain with CNB-C/D and 158-853: catalytic domain with CNBB/C/D) as determined by the spectrophotometric assay. A final concentration of 200-300 nM of the respective PfPKG construct was used. Bar diagram depicting basal activity ( cGMP) in black and specific activity (+cGMP, 100 µM) in white. To test the effect of the autoinhibitory sequence (IS), pre-activated PfPKG 401 853 and PfPKG 158 853 (with 100 µM cGMP), were incubated with 500 µM IS peptide, respectively (grey). (C) cGMP activation by microfluidic mobility-shift assay (MSA) for truncated (401-853: catalytic domain with CNB-D, 275-853: catalytic domain with CNB-C/D, 158-853: catalytic domain with CNB-B/C/D and 32-853: without putative IS) and full length PfPKG (1-853). A final concentration of 4-10 nM of the respective PfPKG construct was used. Activation constant (Kact) is defined as the cGMP concentration where half-maximal kinase activity is observed. Kinase activity corresponds to substrate (PKStide, 1 mM) conversion. Normalized data were fitted to a sigmoidal dose-response plot. (D) Hill slopes as determined from the activation data using GraphPad Prism 6. Hill slope change from 0.7 to 1.6 with CNBB and CNB-A showing positive cooperativity. Standard errors are specified as SD (standard deviation) of n ≥ 4 experiments. 141x97mm (300 x 300 DPI)



Figure 2. Binding of cGMP to CNB-D is critical for activation of PfPKG. cGMP activation data determined with a microfluidic mobility-shift assay (MSA) using PKStide as substrate (1 mM). Recombinant mutant proteins PfPKG 401 853 R492K and PfPKG 158-853 R492K show increased the Kact values for cGMP about 600-fold. A final concentration of 4-10 nM of the respective PfPKG construct was used. Standard errors are specified as SD (standard deviation) of n ≥ 4 experiments. 76x54mm (300 x 300 DPI)


Page 32 of 35

Page 33 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. cGMP binding to chimeric protein construct of PfPKG. (A) Sequence alignment of the individual phosphate binding cassettes (PBCs) of cyclic nucleotide binding domains (CNBs A, B, C and D). Residues corresponding to the capping triad (R484, Q532 and D533) of CNB D are marked in yellow. (B) Chimeric recombinant protein constructs of PfPKG: top: 401 853, bottom: 158 294/540 853, color code as follows: catalytic domain (black), CNB B (blue), αC helix of CNB B (violet), CNB D (red) and αC-helix of CNB D (green). (C) cGMP binding affinity of PfPKG constructs (4-8 nM) as determined by fluorescence polarization (FP) competition. Bar diagrams depicting the EC50 values with standard deviation (at least 4 experiments) for cGMP. When replacing the CNB D (401-542) by the CNB B (158-294/540-853), a 10-fold higher cGMP affinity was observed compared to PfPKG 401-853 (catalytic domain with CNB-D). Data for the isolated CNBB (158 294) were taken from Kim et al. 2015 [18]. 95x46mm (300 x 300 DPI)



Figure 4. Unique salt bridge forming residues (Y480, R528 and D597) are crucial for cGMP-dependent activation in PfPKG. (A) Crystal structures of the isolated cyclic nucleotide binding domain D (CNB-D, PfPKG 401-542) in complex with cGMP (PDB code: 4OFG) and (B) of the full length PfPKG without cGMP (PDB code: 5DYK). The structure of the CNB-D with cGMP bound (A) shows an interaction between a critical Arg residue (R528) on the αC helix (in red) with a Tyr residue (Y480) in the phosphate binding cassette (PBC in yellow). In contrast, in the full length structure without cGMP (B), R528 forms a hydrogen bond with an Asp residue (D597) on the catalytic domain (in green). Recombinant protein constructs are shown in a cartoon representation with the secondary structure elements and cGMP shown as sticks. (C) Specific activity of recombinant proteins expressed by PfPKG mutant constructs as determined by the spectrophotometric assay with 1 mM substrate (PKStide). Basal activity was determined without cGMP and maximum activity using 100 µM cGMP with a final protein concentration of 200-300 nM. R528K has a severe impact on the specific activity and the respective construct can only be 3-fold activated with cGMP compared to wt (PfPKG 401853; 30-fold activation). (D) Kact values for PfPKG mutant protein constructs (4-10 nM) using MSA. The mutant proteins Y480F show a 5-fold increased and D597N as well as R528K a 6-fold decreased Kact value compared to wt (PfPKG 401-853). For all measurements, the standard errors are specified as SD of n ≥ 4 experiments. All structures were visualized using PyMOL v1.3 (Schrödinger LLC). 154x121mm (300 x 300 DPI)


Page 34 of 35

Page 35 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Abstract Graphic 41x22mm (300 x 300 DPI)


cGMP binding domain D mediates a unique activation mechanism in

Recommend Documents