Article pubs.acs.org/JAFC
Chemical Constituents with Proprotein Convertase Subtilisin/Kexin Type 9 mRNA Expression Inhibitory Activity from Dried Immature Morus alba Fruits Pisey Pel, Hee-Sung Chae, Piseth Nhoek, Young-Mi Kim, and Young-Won Chin* College of Pharmacy and Integrated Research Institute for Drug Development, Dongguk University-Seoul, 32, Dongguk-lo, Goyang-si, Gyeonggi-do 10326, Korea S Supporting Information *
ABSTRACT: Phytochemical investigation for a chloroform-soluble extract of dried Morus alba fruits, selected by proprotein convertase subtilisin-kexin type 9 (PCSK9) mRNA expression monitoring assay in HepG2 cells, led to the isolation of a new benzofuran, isomoracin D (1), and a naturally occurring compound, N-(N-benzoyl-L-phenylalanyl)-L-phenylalanol (2), along with 13 known compounds (3−15). All of the structures were established by NMR spectroscopic data as well as MS analysis. Of the isolates, moracin C (7) was found to inhibit PCSK9 mRNA expression with an IC50 value of 16.8 μM in the HepG2 cells. KEYWORDS: Morus alba fruits, PCSK9 mRNA expression, isomoracin D, N-(N-phenzoyl-L-phenylalanyl)-L-phenylalanol, moracin C
■
antibody drugs, there are issues related to their costs3,17 and potential side effects.3 Thus, several studies have focused on edible or medicinal plants and proposed a few compounds (berberine, curcumin, and lignans) as PCSK9 expression inhibitors.13,18,19 As part of our ongoing project to discover small molecules with inhibitory activity against PCSK9 expression from edible and medicinal plants,19 we found that the chloroform-soluble extract of dried fruits of M. alba inhibited PCSK9 mRNA expression. So far, there are no reports regarding PCSK9 expression inhibitory compounds from M. alba fruits. Therefore, we conducted follow-up isolation for the chloroform-soluble extract of M. alba fruits and identified two new naturally occurring compounds and 13 known structures. We evaluated all of the isolates for their inhibitory activity against PCSK9 mRNA expression in HepG2 cell lines.
INTRODUCTION Morus alba L. (Moraceae), known as the mulberry tree,1 is widely distributed in Asia including Cambodia,2 China,3 Japan, Thailand, and Korea.4 All parts of this plant have been recognized as medicinally and economically valuable including the leaves, roots, and fruits.5 The fruits of M. alba taste palatable and are used to make wine, juice, marmalade, ice cream, dessert,6 and jam.3 The dried and fresh fruits have also been used traditionally as a mild laxative,2 odontalgic,7 antiaging solution, and fever treatment.3 Recently, both the extracts and individual constituents of M. alba fruits have been reported to possess anti-inflammatory, antioxidant, antiobesity,8 antidiabetic,6 and hypolipidemic properties.3 Also, M. alba fruits were known to prevent cardiovascular disease (CVD)9 and inhibit low-density lipoprotein (LDL) oxidation.3 Phytochemical investigations of the fruits of M. alba have been reported to contain flavonoids,10 lignans,7 pyrrole alkaloids,4 polyphenols, fatty acids,6 and anthocyanin.10 CVD is a leading cause of death causes in developed countries,11 and one of its risk factors is known to be high lowdensity lipoprotein cholesterol (LDL-C).12,13 Thus, inhibitors of cholesterol biosynthesis, hydroxyl-3-methylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors (simvastatin, atorvastatin, lovastatin, etc.), have been prescribed to lower cholesterol levels.14 Nonetheless, these statins were not successful in some patients with familial hypercholesterolemia (FH) who have inherited autosomal dominant disorders that lead to aberrantly high LDL-C level.15 To overcome this limit, the U.S. Food and Drug Administration approved proprotein convertase subtilisin-kexin type 9 (PCSK9) inhibitors in 2015. Low-density lipoprotein receptor (LDLR) expressed in the cell surface binds to LDL-C and then endocytosis happens. Normally, after endocytosis, LDLR goes back to the cell surface but when LDLR binds to PCSK9, degradation of LDLR is facilitated, resulting in decreasing LDLR and thereby high blood cholesterol levels.16 Despite the high efficacy of approved © XXXX American Chemical Society
■
MATERIALS AND METHODS
General Experimental Procedures. Nuclear magnetic resonance (NMR) spectra using a Varian 400 spectrometer (Varian, CA, USA) 400 MHz spectrometer at 400 MHz for 1H NMR and at 100 MHz for 13 C NMR were obtained. High-resolution mass spectra data from a Waters Xevo G2 Q-TOF mass spectrometer (Waters, MA) were measured. Fourier Transform Infrared (FT-IR) on a ThermoFisher Scientific, Nicolet iS 5 FT-IR spectrometer (ThermoFisher Scientific, Madison, WI) was used. Ultraviolet visible spectroscopy using a Beckman Coulter, DU 730, UV/vis spectrophotometer (Beckman Coulter GmbH, North Rhine-Westphalia, Germany) was used. Semipreparative high performance liquid chromatography (HPLC) with a Gilson 321 pump and Gilson 172 Diode Array Detector (Gilson, Madison, WI) and HPLC columns [YMC-pack Ph, 250 × 20 mm] and [YMC-pack Ph, 250 × 10 mm] (YMC, Kyoto, Japan) was used. Water was purified using a Milli-Q system (Waters Corporation, Milford, MA). Column chromatography on C-18 RP silica gel (Cosmosil, Kyoto, Japan) and Sephadex LH-20 (GE Healthcare, Received: May 4, 2017 Accepted: June 4, 2017
A
DOI: 10.1021/acs.jafc.7b02088 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry Uppsala, Sweden) was conducted, and TLC analysis on silica gel 60 F254 plates (Merck, Darmstadt, Germany) was done. The spots were visualized by spraying with 10% aqueous H2SO4. Plant Material. The dried immature fruits of Morus alba (3 kg) were purchased at the oriental market and identified by one of the authors (H.-S.C.). The raw material (CYWDU-KP0010) was deposited at the College of Pharmacy, Dongguk University-Seoul, Republic of Korea. Extraction and Isolation. The fruits were kept in 9 L of 100% MeOH for 24 h and then filtered three times. We evaporated the resultant extraction solutions in vacuo to produce the MeOH extract (160.4 g). The extract was then suspended in 1.2 L of H2O and partitioned with organic solvents such as CHCl3, EtOAc, and n-butanol, successively, 1.2 L three times for each solvent, to give the residues of CHCl3-soluble extract (47.9 g), EtOAc-soluble extract (5.0 g), n-butanol-soluble extract (13.6 g), and water-soluble extract (89.9 g). The CHCl3-soluble extract (40 g, MAC) was chromatographed with silica column chromatography (5 × 40 cm, 350 g) using gradients of increasing polarity with hexane-EtOAc (20:1−2:1) and CHCl3-MeOH (10:1−1:1) as solvents and then fractionated into 12 subfractions (MAC-1-MAC-12). The MAC-1 fraction (5.3 g) was chromatographed with silica column chromatography (6 × 16 cm, 250 g) using gradients of increasing polarity with hexane-EtOAc (100:1−2:1) and CHCl3-MeOH (10:1−1:1) as solvents, resulting in compounds 13 (1023.9 mg) and 14 (451.2 mg) along with 8 subfractions (MAC-1A to MAC-1H). We separated the MAC-6 fraction (369.9 mg) by MPLC RP on a silica column (25 g) using a mixture of MeOH-H2O (5:95−50:50), giving compound 8 (2.5 mg) and 6 subfractions (MAC-6A to MAC-6F). The MAC-7 fraction (262.3 mg) was fractionated into 8 subfractions (MAC-7A to MAC-7H) by MPLC run using a normal-phase silica gel (25 g) column with MeOH-H2O (95:5−50:50). The MAC-7C fraction (35.2 mg) was subjected to HPLC separation with MeOH-H2O (30:70), 2.0 mL/min, by isocratic elution for 35 min and then 100% MeOH for 6 min, to produce compounds 3 (tR 32.56 min, 1.8 mg), 1 (tR 34.20 min, 4.8 mg), and 6 (tR 35.59 min, 1.1 mg). The MAC-7D fraction (45.1 mg) was subjected to HPLC separation with MeOHH2O (30:70), 2.0 mL/min, by isocratic elution for 35 min and then 100% MeOH for 6 min, to afford compounds 11 (tR 9.55 min, 2.8 mg) and 7 (tR 29.55 min, 2.4 mg). The MAC-7F fraction (22.1 mg) was subjected to HPLC separation with MeOH-H2O (30:70), 2.0 mL/min, by isocratic elution for 35 min and then 100% MeOH for 6 min, to afford compound 5 (tR 28.50 min, 1.4 mg). The MAC-10 fraction (1.89 g) was purified by MPLC RP column (100 g) with MeOH-H2O (50:50−80:20) into 10 subfractions (MAC-10A-MAC-10J). The MAC-10F fraction (14.8 mg) was subjected to HPLC separation with MeOH-H2O (35:65), 2.0 mL/min, by isocratic elution for 35 min and then 100% MeOH for 6 min, to produce compound 4 (tR 25.3 min, 1.1 mg). The MAC-10I fraction (91.8 mg) was subjected to HPLC separation with MeOH-H2O (40:60), 7.0 mL/min, by isocratic elution for 25 min and then 100% MeOH for 6 min, to produce 9 (tR 20.69 min, 1.9 mg) and 10 (tR 21.71 min, 6 mg). The MAC-10G (45.6 mg) was subjected to HPLC separation with MeOH-H2O (50:50), 7.0 mL/min, by isocratic elution for 35 min and then 100% MeOH for 6 min, to produce compounds 2 (tR 20.50 min, 9.7 mg), 12 (tR 22.05 min, 1.7 mg) and 15 (tR 33.04 min, 2.3 mg). Isomoracin D (1). Brown amorphous, [α]D20= +5.72 (c 0.18, (log ε): 275.5 (4.12), 319.5 (4.29). FT-IR (ATR) MeOH). UV λMeOH max vmax 3274, 2973, 1603, 1486, 1151 cm−1. HRESIMS m/z [M + H]+ 309.1118 (calcd for C19H17O4 309.1127). 1H NMR (CD3OD, 400 MHz) δ 6.76 (1H, s, H-3), 6.91 (1H, d, J = 2.1 Hz, H-4), 6.74 (1H, dd, J = 8.4, 2.1 Hz, H-6), 7.34 (1H, d, J = 8.4 Hz, H-7), 6.27 (1H, d, J = 2.0 Hz, H-2′), 6.70 (1H, d, J = 2.0 Hz, H-6′), 6.80 (1H, d, J = 10.0 Hz, H-1″), 5.62 (1H, d, J = 10.0 Hz, H-2″), 1.42 (3H, s, H-4″), 1.42 (3H, s, H-5″); 13C NMR (CD3OD, 100 MHz) δ 157.8 (C-2), 111.9 (C-3), 121.3 (C-3a), 97.0 (C-4), 155.8 (C-5), 105.2 (C-6), 120.7 (C-7), 155.6 (C-7a), 128.4 (C-1′), 103.4 (C-2′), 155.0 (C-3′), 111.2 (C-4′), 153.3 (C-5′), 106.8 (C-6′), 120.2 (C-1″), 127.2 (C-2″), 74.9 (C-3″), 26.3 (C-4″), 26.3 (C-5″). N-(N-Benzoyl-L-phenylalanyl)-L-phenylalanol (2). White powder, (log ε): 280.0 (3.89). [α]D20= −30.63 (c 0.97, MeOH). UV λMeOH max
Figure 1. Structures of compounds 1−15.
Figure 2. Key HMBC (→) and 1H-1H COSY (−) correlations of compound 1. FT-IR (ATR) vmax 3285, 3059, 2926, 1634, 1530 cm−1. HRESIMS m/z [M + H]+ 403.2027 (calcd for C25H27N2 O3 403.2022). MTT Assay for Cell Viability. Cells were seeded into 96-well plates at a density of 5 × 104 cells/well and incubated with growth media in the presence of test compounds. Following incubation for 24 h, 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT; 5 mg/mL in saline) was added and incubated for a further 4 h. MTT was converted by mitochondrial succinate dehydrogenase in live cells converts MTT into visible formazan crystals during incubation. The formazan crystals were then solubilized in dimethyl sulfoxide, and the absorbance was measured at 540 nm using an enzyme-linked immunosorbent assay (ELISA) microplate reader (Benchmark, Bio-Rad Laboratories, CA). Relative cell viability was calculated by comparison with the absorbance of the untreated control group. All experiments were performed in triplicate. Quantitative Real-Time PCR. We isolated total cellular RNA using a TRIzol RNA extraction kit according to the manufacturer’s instructions. Briefly, we ran PCRs using 1 μL of cDNA and 9 μL of master mix containing iQ SYBR Green Supermix (Bio-Rad, Seoul, Korea), 5 pmol of forward primer, and 5 pmol of reverse primer in a CFX384 Real-Time PCR Detection System (Bio-Rad) with the following conditions: 3 min at 95 °C followed by 40 cycles of 10 s at B
DOI: 10.1021/acs.jafc.7b02088 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
Figure 3. Effects of extracts and compounds 1−15 on the PCSK9 mRNA expression in the HepG2 cells. A. The expression of PCSK9 mRNA was assayed by qRT-PCR in cells treated with MeOH extract (T), CHCl3 (C), EtOAc (E), butanol (B), water-soluble extract (W) (40 μg/mL), berberine (Ber 100 μg/mL), and atorvastatin (AS 100 μg/mL) for 24 h. B. Expression of PCSK9 mRNA was assayed by qRT-PCR in cells treated with compounds 1−15 (20 μM) and atorvastatin (AS 100 μg/mL) for 24 h. * p < 0.05, ** p < 0.01 as compared to nontreated group by Dunnett’s t test. 95 °C, and then 30 s at 55 °C followed by plate reading. We measured the fluorescence signal generated with SYBR Green I DNA dye during the annealing steps and confirmed the specificity of the amplification using melting curve analysis. We collected and recorded the data using CFX Manager Software (Bio-Rad) and expressed the values as functions of the threshold cycle (CT). We then normalized the relative quantities of the genes of interest to the relative quantities of GAPDH (ΔΔCT). We calculated the mRNA in the sample using the eq 2-(ΔΔCT). We used the following specific primer sets (5′ to 3′): GAPDH: GAAGGTGAAGGTCGGAGTCA (forward), AATGAAGGGGTCATTGATGG (reverse); PCSK9GGGCATTTCACCATTCAAAC (forward), TCCAGAAAGCTAAGCCTCCA (reverse). The gene-specific primers had been custom-synthesized by Bioneer (Bioneer Corporation, Daejeon, Korea). Immunoblot Analysis. We assessed protein expression using Western blot analysis according to standard procedures. Briefly, HepG2 cells were cultured in 60 mm culture dishes (2 × 106/mL) and then pretreated with various concentrations of compounds. Cells were washed twice in ice-cold PBS (pH 7.4). The cell pellets were then resuspended in lysis buffer on ice for 15 min, after which the cell debris was removed by centrifugation. We then determined protein concentrations using Bio-Rad protein assay reagent according to the manufacturer’s instructions. Protein (20−30 μg of whole cell) was mixed 1:1 with 2× sample buffer (20% glycerol, 4% SDS, 10% 2-ME, 0.05% bromophenol blue, and 1.25 M Tris [pH 6.8]), loaded onto an 8% or 15% SDS-PAGE gel, and run at 150 V for 90 min.
Cell proteins were transferred onto an ImmunoBlot polyvinylidene difluoride membrane (PVDM) using a Bio-Rad semidry transfer system according to the manufacturer’s instructions. The PVDM was then incubated overnight with primary Ab (diluted 1:500−1:1000) in 5% milk in Tris-buffered saline containing 0.1% Tween 20. The blots were washed three times with Tris-buffered saline (0.1% Tween 20) and incubated for 1 h with HRP-conjugated secondary anti-IgG Ab (diluted 1:2000−1:20 000). The blots were washed again three times with Tris-buffered saline (0.1% Tween 20), and immunoreactive bands were developed using the chemiluminescent substrate ECL Plus (Amersham Biosciences, Piscataway, NJ). Statistical Analysis. Data from the experiments are presented as the mean ± SEM. We determined the level of statistical significance using analysis of variance (ANOVA) and Dunnett’s t test for multiple comparisons and considered P values less than 0.05 to be significant. Reagents. The solvents for extraction and isolation (methanol, ethyl acetate, n-butanol, chloroform, n-hexane, etc.) were purchased from SK Chemical (Seoul, Korea). The solvents for HPLC-grade acetonitrile (MeCN) and methanol were also purchased from SK Chemical. The solvent for NMR (CD3OD) was obtained from Cambridge Isotope Laboratories, Inc. (Andover, MA).
■
RESULTS AND DISCUSSION Isolation of Compounds 1−15 from Morus alba. We investigated the chemical constituents of dried immature fruits C
DOI: 10.1021/acs.jafc.7b02088 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry of M. alba from 100% methanol extract and isolated new benzofuran, isomoracin D (1), and a naturally occurring peptide, N-(N-benzoyl-L-phenylalanyl-L-phenylalanol (2), along with 13 known compounds (3−15; Figure 1). We identified the structure of known compounds (3−15) by comparison of their spectroscopic data with the literature on moracin D (3),20 scopoletin (4),21 6,7-dimethylesculetin (5),22 2′,4′-dihydroxy-7′methoxy-8-prenylflavan (6),23 moracin C (7),1 4-hydroxybenzaldehyde (8),24 (+)-demethoxypinoresinol (9),25 (+)-pinoresinol (10),26 umbellic acid (11),27 4-hydroxy phenylacetic acid methyl aster (12),28 linoleic acid (13),29 methyl linoleate (14),29 and (9S, 10E, 12E)-9-hydroxy-10,12-octadecadienoic acid (15).30 Although compound 2 had been reported previously as a synthetic compound31 but from natural resources, this study, however, is the first report to isolate compound 2 from a natural source and complete full assignments of compound 2 based on 2D NMR (Supporting Information). Structure Elucidation of the New Compound. Compound 1 was obtained as brown amorphous and determined its molecular formula to be C19H16O4 by a quasimolecular ion [M + H]+ at m/z 309.1118 on HRESIMS. The 1H NMR data of 1 displayed signals for eight aromatic protons at δH 7.34 (1H, d, J = 8.4 Hz, H-7), 6.91 (1H, J = 2.1 Hz, H-4), 6.80 (1H, d, J = 10.0 Hz, H-1″), 6.76 (1H, s, H-3), 6.74 (1H, dd, J = 8.4, 2.1 Hz, H-6), 6.70 (1H, d, J = 2.0 Hz, H-6′),6.27 (1H, d, J = 2.0 Hz, H-2′), and δH 5.62 (1H, d, J = 10.0 Hz, H-2″) and a signal for two methyls at δH 1.42 (6H, s, H-4″ and 5″), suggesting that compound 1 is structurally similar to moracin D (3)20 except for the different location of a hydroxyl group in the benzofuran moiety. In moracin D (3), the position of a hydroxyl group was located at C-6 but a hydroxyl group in compound 1 was located at C-5 by the observed HMBC and 1 H−1H COSY correlations shown in Figure 2. The HMBC correlations of δH 6.91 (H-4) to δC 111.9 (C-3), 121.3 (C-3a), 155.6 (C-7a) and δC 155.8 (C-5); δH 7.34 (H-7) to δC 105.2 (C-6), 121.3 (C-3a), 155.6 (C-7a) and 155.8 (C-5); and sequential COSY correlations of H-6/H-7, supported the hydroxyl group was attached at H-5 in the benzofuran ring of 1. Additionally, the HMBC correlation of H-4″ and 5″ to δC 74.9 (C-3″) and 127.2 (C-2″) supported that dimethyl was connected to benzopyran moiety at C-3″. Finally, the HMBC correlations of δH 6.27 (H-2′) to δC 106.8 (C-6′), 111.2 (C-4′), 153.3(C-3′) and 157.8 (C-2); δH 6.70 (H-6′) to δC 103.4 (C-2′), 111.2 (C-4′), 153.3 (C-5′) and 157.8 (C-2) indicated that the benzopyran moiety was connected to C-2. Therefore, this compound was characterized as the structure 1 shown in Figure 1, and named isomoracin D. Effect of Extracts and Compounds 1−15 on PCSK9 mRNA Expressions. The crude methanolic extract of dried immature M. alba fruits and its solvent-soluble fractions (chloroform, ethyl acetate, butyl alcohol, and water-soluble extracts) were tested for its inhibitory activities against PCSK9 mRNA expression in HepG2 cells, and the results are shown in Figure 3A. It was found that the methanolic extract inhibited PCSK9 mRNA expression, and of its solvent-soluble fractions, only the chloroform-soluble extract showed inhibitory activity similar to that of the methanolic extract. We also tested all compounds 1−15 that we had isolated from the chloroformsoluble extract according to the same protocol. Of tested compounds, compounds 1 (31.3% inhibition), 7 (50.1% inhibition), and 9 (19.7% inhibition) appeared to downregulate PCSK9 mRNA expression at a concentration of 20 μM compared with the normal group. We selected compound 7 (moracin C) in
Figure 4. Effect of compound 7, moracin C (Com 7), on the PCSK9 inhibition in the HepG2 cells. (A) The cell viability of compounds 1, 7, and 9 in HepG2 cells. Cells grown in growth medium were treated with 20 μM of each compounds for 24 h, and cell viability was assessed by the MTT assay, as described in the Materials and Methods section. (B) The expression of PCSK9 was assayed by qRT-PCR in cells treated with moracin C (7) (4, 10, and 20 μM) and atorvastatin 100 μg/mL) for 24 h. (C) The expression of PCSK9 was assayed by Western blot in cells treated with moracin C (4 and 20 μM) and atorvastatin (AS100 μg/mL) for 24 h. (D) Immunoblot signals were quantified using Molecular Analyst/PC densitometry software (version 4.6, Bio-Rad, Hercules, CA). * p < 0.05, ** p < 0.01 as compared to nontreated group by Dunnett’s t test.
particular for further evaluation because it was the most potent of the compounds we tested. D
DOI: 10.1021/acs.jafc.7b02088 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
lipoprotein; Ber100, berberine 100 μg/mL; AS100, atorvastatin 100 μg/mL
Effect of Compound 7 (Moracin C) on PCSK9 mRNA and Protein Expressions. We further tested moracin C (7), the most potent, at a range of concentrations (4−20 μM) for its inhibition of PCSK9 mRNA and protein expression in HepG2 cells, and the results are shown in Figure 4. We found that moracin C (7) inhibited PCSK9 mRNA expression with an IC50 value of 16.8 μM (positive control, berberine, IC50 17.2 μM). In further Western blotting analysis, moracin C (7) also reduced PCSK9 protein expression. Even though the tested structures were limited, compared with structurally similar isomoracin D (1) and moracin D (3), the noncyclized isoprenyl moiety and thus the additional hydroxyl group in moracin C (7) appeared to make a difference in activity. Previously, moracin C (7) was only known to possess antiinflammatory,32,33 antimicrobial,1,33 and antioxidant activity.33 The present study suggest for the first time that moracin C (7) could potentially lower cholesterol levels by suppressing PCSK9 expression. This finding might partially explain the hypolipidemic effects of mulberry fruit that have been reported in the literature.3,8 In conclusion, we found that the crude extract of dried immature M. alba fruits and its solvent-soluble fraction, the chloroform-soluble extract, inhibited PCSK9 mRNA expression. From the chloroform-soluble extract of the dried M. alba fruits, we isolated and identified two naturally occurring new compounds and 13 known compounds. In addition, we propose that moracin C (7) with a benzofuran structure is an active compound that is responsible in part for inhibiting of PCSK9 expression, which could lower cholesterol levels.
■
■
(1) Kim, Y. J.; Sohn, M. J.; Kim, W. F. Chalcomoracin and moracin C, new inhibitors of Staphylococcus aureus enoyl-acyl carrier protein reductase from Morus alba. Biol. Pharm. Bull. 2012, 35, 791−795. (2) Kham, L. Medicinal Plants of Cambodia: Habitat, Chemical Constituents and Ethnobotanical Uses; NHBS Ltd.: Devon, U.K., 2004. (3) Yang, X.; Yang, L.; Zheng, H. Hypolipidemic and antioxidant effect of mulberry (Morus alba L.) fruit in hyperlipidaemia rats. Food Chem. Toxicol. 2010, 48, 2374−2379. (4) Kim, S. B.; Chang, B. Y.; Jo, Y. H.; Lee, S. H.; Han, S. B.; Hwang, B. Y.; Kim, S. Y.; Lee, M. Y. Macrophage activating activity of pyrrole alkaloids from Morus alba fruits. J. Ethnopharmacol. 2013, 145, 393− 396. (5) Jeong, J. Y.; Jo, Y. H.; Kim, S. B.; Liu, Q.; Lee, J. W.; Mo, E. J.; Lee, K. Y.; Hwang, B. Y.; Lee, M. K. Pancreatic lipase inhibitory constituents from Morus alba leaves and optimization from extraction conditions. Bioorg. Med. Chem. Lett. 2015, 25, 2269−2274. (6) Pawlowska, A. M.; Oleszek, W.; Braca, A. Quali-quantitive analyses of flavonoids of Morus nigra L. and Morus alba L. (Moraceae) fruits. J. Agric. Food Chem. 2008, 56, 3377−3380. (7) Lee, S. R.; Park, J. Y.; Yu, J. S.; Lee, S. O.; Ryu, J.-Y.; Choi, S.-Z.; Kang, K. S.; Yamabe, N.; Kim, K. H. Odisolane, a novel oxolane derivative, and antiangiogenic constituents from the fruit of mulberry (Morus alba). J. Agric. Food Chem. 2016, 64, 3804−3809. (8) Choi, J. W.; Synytsya, A.; Capek, P.; Bleha, R.; Pohl, R.; Park, Y. I. Structural analysis and anti-obesity effect of a pectic polysaccharide isolated from Korean mulberry fruit Oddi (Morus alba L.). Carbohydr. Polym. 2016, 146, 187−196. (9) Chang, J.-J.; Hsu, M.-J.; Huang, H.-P.; Chung, D.-J.; Chang, Y.C.; Wang, C.-J. Mulberry anthocyanins inhibit oleic acid induced lipid accumulation by reduction of lipogenesis and promotion of hepatic lipid clearance. J. Agric. Food Chem. 2013, 61, 6069−6076. (10) Kim, S. B.; Chang, B. Y.; Hwang, B. Y.; Kim, S. Y.; Lee, M. K. Pyrrole alkaloids from the fruits of Morus alba. Bioorg. Med. Chem. Lett. 2014, 24, 5656−5659. (11) Strong, A.; Rader, D. J. Clinical implications of lipid genetics for cardiovascular disease. Curr. Cardiovasc. Risk Rep. 2010, 4, 461−468. (12) Xiao, H.-B.; Sun, Z.-L.; Zhang, H.-B.; Zhang, D.-S. Berberine inhibits dyslipidemia in C57BL/6 mice with lipopolysaccharide induced inflammation. Pharmacol. Rep. 2012, 64, 889−895. (13) Cameron, J.; Ranheim, R.; Kulseth, M. A.; Leren, T. P.; Berge, K. E. Berberine decreases PCSK9 expression in HepG2 cells. Atherosclerosis 2008, 201, 266−273. (14) Tobert, J. A. Lovastatin and beyond: The history of the HMGCOA reductase inhibitors. Nat. Rev. Drug Discovery 2003, 2, 517−526. (15) Strong, A.; Rader, D. J. Clinical implications of lipid genetics for cardiovascular disease. Curr. Cardiovasc. Risk Rep. 2010, 4, 461−468. (16) Peterson, A. S.; Fong, L. G.; Young, S. G. PCSK9 function and physiology. J. Lipid Res. 2008, 49, 1152−1156. (17) Zimmerman, M. P. How do PCSK9 inhibitors stack up to statins for low-density lipoprotein cholesterol control? Am. Health Drug Benefits 2015, 8, 436−442. (18) Tai, M.-H.; Chen, P.-K.; Chen, P.-Y.; Wu, M.-J.; Ho, C.-T.; Yen, J.-H. Curcumin enhances cell-surface LDLR level and promotes LDL uptake through downregulation of PCSK9 gene expression in HepG2 cells. Mol. Nutr. Food Res. 2014, 58, 2133−2145. (19) Pel, P.; Chae, H.-S.; Nhoek, P.; Yeo, W.; Kim, Y.-M.; Chin, Y.W. Lignans from the fruits of Schisandra chinensis (Turcz.) Baill inhibit proprotein convertase subtilisin/kexin type 9 expression. Phytochemistry 2017, 136, 119−124. (20) Yang, Z.; Wang, Y.; Wang, Y.; Zhang, Y. Bioassay-guided screening and isolation of α-glucosidase and tyrosinase inhibitors from leaves of Morus alba. Food Chem. 2012, 131, 617−625. (21) Imai, F.; Itoh, K.; Kishibuchi, N.; Kinoshita, T.; Sankawa, U. Constituents of the root bark of Murraya paniculata collected in Indonesia. Chem. Pharm. Bull. 1989, 37, 119−123.
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.7b02088. Supplementary data (1D and 2D NMR spectra, HRESIMS, UV, and IR for compounds 1−2) and the structures of compounds 1−15 associated with this article (PDF)
■
REFERENCES
AUTHOR INFORMATION
Corresponding Author
*Tel.:+82-31-961-5218. Fax: +82-31-961-5218. E-mail: f2744@ dongguk.edu. Author Contributions
P.P. and H.-S.C. performed most of the isolation work and biological work, respectively. Structure elucidation was conducted by P.P., P.N., Y.-M.K., and Y.-W.C. Y.-W.C. conceived the project and designed the experiment. P.P. and Y.-W.C. drafted the manuscript. All authors have given approval to the final version of the manuscript. Funding
This study was supported by a grant from the National Research Foundation of Korea (NRF), funded by the Korean government (MSIP; NRF-2015R1A2A201006736). Notes
The authors declare no competing financial interest.
■
ABBREVIATIONS USED M. alba, Morus alba; PCSK9, proprotein convertase subtilisinkexin type 9; CVD, cardiovascular disease; LDL, low-density E
DOI: 10.1021/acs.jafc.7b02088 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry (22) Jerezano, A.; Jiménez, R.; Cruz, M. D. C.; Montiel, L. E.; Delgado, F.; Tamariz, J. New approach for the construction of the coumarin frame and application in the total synthesis of natural products. Helv. Chim. Acta 2011, 94, 185−198. (23) Yang, Y.; Yang, X.; Xu, B.; Zeng, G.; Tan, J.; He, X.; Hu, C.; Zhou, Y. Chemical constituents of Morus alba L. and their inhibitory effect on 3T3-L1 preadipocyte proliferation and differentiation. Fitoterapia 2014, 98, 222−227. (24) Magano, J.; Chen, M. H.; Clark, J. D.; Nussbaumer, T. 2(diethylamino)ethanethiol, a new reagent for the odorless deprotection of aromatic methyl ethers. J. Org. Chem. 2006, 71, 7103−7105. (25) Mohamed, K. M. Chemecal constituents of Gladiolus segetum Ker-Gaw. Bull. Pharm. Sci., Assiut University 2005, 28, 71−78. (26) Jung, H. W.; Mahesh, R.; Lee, J. G.; Lee, S. H.; Kim, Y. S.; Park, Y.-K. Pinoresinol from the fruits of Forsythia koreana inhibits inflammatory responses in LPS-activated microglia. Neurosci. Lett. 2010, 480, 215−220. (27) Abdel-Kader, M. S. New ester and furocoumarins from the roots of Pituranthos tortuosus. J. Braz. Chem. Soc. 2003, 14, 48−51. (28) Bose, D. S.; Narsaiah, A. V. An efficient asymmetric synthesis of (S)-atenolol: using hydrolytic kinetic resolution. Bioorg. Med. Chem. 2005, 13, 627−630. (29) Meyer, M. P.; Klinman, J. P. Synthesis of linoleic acids combinatorially labeled at the vinylic positions as substrates for lipoxygenases. Tetrahedron Lett. 2008, 49, 3600−3603. (30) Wu, J.; Fushimi, K.; Tokuyama, S.; Ohno, M.; Miwa, T.; Koyama, T.; Yazawa, K.; Nagai, K.; Matsumoto, T.; Hirai, H.; Kawagishi, H. Functional-food constituents in the fruiting bodies of Stropharia rugosoannulata. Biosci., Biotechnol., Biochem. 2011, 75, 1631−1634. (31) Xu, B.; Huang, Z.; Liu, C.; Cai, Z.; Pan, W.; Cao, P.; Hao, X.; Liang, G. Synthesis and anti-hepatitis B virus activities of Matijing-Su derivatives. Bioorg. Med. Chem. 2009, 17, 3118−3125. (32) Yao, X.; Wu, D.; Dong, N.; Ouyang, P.; Pu, J.; Hu, Q.; Wang, J.; Lu, W.; Huang, J. Moracin C, a phenolic compound isolated from Artocarpus heterophyllus, suppresses lipopolysaccharide-activated inflammatory responses in murine raw264.7 marophages. Int. J. Mol. Sci. 2016, 17, 1199. (33) Wei, H.; Zhu, J.-J.; Liu, X.-Q.; Feng, W.-H.; Wang, Z.-M.; Yan, L.-H. Review of bioactive compounds from root barks of Morus plants (Sang-Bai-Pi) and their pharmacological effects. Cogent Chemistry 2016, 2, 1−16.
F
DOI: 10.1021/acs.jafc.7b02088 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
