Chemical Macrocyclization of Peptides Fused to Antibody Fc Fragments

Jul 19, 2012 - bicyclic peptide, we recombinantly expressed its peptide moiety as a fusion protein to an Fc fragment and subsequently cyclized the pep...
5 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/bc

Chemical Macrocyclization of Peptides Fused to Antibody Fc Fragments Alessandro Angelini,† Philippe Diderich, Julia Morales-Sanfrutos, Sarah Thurnheer, David Hacker, Laure Menin, and Christian Heinis* Institute of Chemical Sciences and Engineering, Ecole Polytechnique Fédérale de Lausanne, CH-1015 Lausanne, Switzerland S Supporting Information *

ABSTRACT: To extend the plasma half-life of a bicyclic peptide antagonist, we chose to link it to the Fc fragment of the long-lived serum protein IgG1. Instead of chemically conjugating the entire bicyclic peptide, we recombinantly expressed its peptide moiety as a fusion protein to an Fc fragment and subsequently cyclized the peptide by chemically reacting its three cysteine residues with tris-(bromomethyl)benzene. This reaction was efficient and selective, yielding completely modified peptide fusion protein and no side products. After optimization of the linker and the Fc fragment format, the bicyclic peptide was fully functional as an inhibitor (Ki = 76 nM) and showed an extended terminal half-life of 1.5 days in mice. The unexpectedly clean reaction makes chemical macrocyclization of peptide-Fc fusion proteins an attractive synthetic approach. Its good compatibility with the Fc fragment may lend the bromomethylbenzene-based chemistry also for the generation of antibody−drug conjugates.

■

INTRODUCTION Bicyclic peptides with desired binding specificities can be isolated with moderate effort, time, and cost from large combinatorial libraries using phage display.1−3 The libraries are generated by displaying linear peptides, containing two cysteines at both ends and one in the middle, on phage and by subsequently reacting the cysteine side chains with the trivalent thiol-reactive compound tris-(bromomethyl)benzene (TBMB).1 TBMB efficiently and selectively reacts with three cysteine residues in peptides under mild conditions in aqueous solution.4 Phage selections using this strategy had yielded bicyclic peptide inhibitors with nanomolar affinities for a range of disease targets including plasma kallikrein,1,3 cathepsin G,1 and a urokinase-type plasminogen activator.2 Depending on the clinical application, the bicyclic peptides need to circulate in the bloodstream at a minimal concentration for an extended time period to achieve good therapeutic effects. While bicyclic peptides were resistant to proteolysis when incubated in human plasma ex vivo,1 they are expected to rapidly clear from the circulation through renal filtration. Cyclic peptides with similar size as the bicyclic peptides were found to have a terminal half-life of less than 30 min upon intravenous injection.5−8 Various strategies had been applied to prolong the circulation time of peptides8 or proteins,9 the most common ones being conjugation or genetic fusion to long-lived serum proteins such as albumin or immunoglobulin, or linkage to large polymers such as poly(ethylene glycol). In this work, we chose to conjugate a bicyclic peptide to the Fc fragment of human IgG1, which has a terminal half-life of © 2012 American Chemical Society

multiple weeks in human. The half-lives of antibodies and antibody Fc fragments are particularly long because of their ability to be recycled in the endosomes through binding to neonatal receptor FcRn. Several protein- and one peptide-Fc fusion proteins are already in clinical use and their terminal halflives are between 4 and 13 days.10 While peptides and proteins can be expressed conveniently as genetic fusions with the Fc fragment, the chemical linkage of synthetic molecules has been more challenging. The molecules are preferentially tethered through activated chemical linkers to lysines on the immunoglobulin surface, to cysteines in the hinge regions, or to cysteines introduced at specific sites on the protein surface. The latter two cysteine-based strategies typically yield a higher degree of uniformity.11−15 Although bicyclic peptides might be synthetized and linked to Fc fragments using a standard chemical conjugation reaction, we tested in this work a new approach in which a peptide is expressed as Fc fusion and subsequently cyclized by a chemical reaction (Figure 1A). We reasoned that such a strategy involving one recombinant protein and a single chemical reaction would be more economical than an approach in which the peptide is first synthesized by solid-phase peptide synthesis, cyclized, activated with a chemical linker, and conjugated to an Fc fragment. As a model bicyclic peptide, we used a recently developed potent and selective inhibitor of human urokinase-type plasminogen Received: April 4, 2012 Revised: June 18, 2012 Published: July 19, 2012 1856

dx.doi.org/10.1021/bc300184m | Bioconjugate Chem. 2012, 23, 1856−1863

Bioconjugate Chemistry

Article

Figure 1. Chemical macrocyclization of homodimeric UK18-Fc fusion protein. (A) Schematic representation of the cyclization reaction based on sulfhydryl alkylation with TBMB. Two of the nine possible regioisomers are shown, including the desired one (lower right drawing). (B) Mass spectra of homodimeric UK18-Fc fusion protein before (upper panel) and after (lower panel) treatment with TBMB. Free cysteine residues in UK18-Fc fusion protein are quantitatively modified by TBMB adding to the monomer and dimer masses of 116 and 232 Da, respectively (see also SI Figure S3). (C) Mass spectra of Fc fragment alone before (upper panel) and after (lower panel) treatment with TBMB. In both spectra, two masses can be seen which correspond to entire Fc fragment and Fc fragment with a truncated N-terminus. No TBMB-modification was observed for Fc fragment (see also SI Figure S4). (D) Reducing SDS-PAGE with unmodified (U) and modified (M) homodimeric UK18-Fc fusion protein and Fc fragment. Covalently linked monomers run more slowly and the extent of cross-linking by TBMB can be seen. 1.5 μg aliquots of each unmodified (U) and modified (M) homodimer have been loaded per well. (E) Inhibition of human uPA by TBMB-modified homodimeric UK18-Fc fusion protein. Residual protease activity was determined with a fluorogenic substrate. The Ki values were calculated per UK18-Fc monomer unit (see also SI Figure S2A,B).

activator (uPA), termed UK18 (K i = 53 nM; N ACSRYEVDCRGRGSACGC).2 Overexpression of the serine protease uPA is a feature of malignancy and is correlated with tumor progression and invasion.16 Extension of the circulation time of UK18 inhibitor would allow testing of its therapeutic effect in vivo.

IgG1 hinge (amino acids 216 to 235, Kabat numbering; EPKSCDKTHTCPPCPAPELLC; underlined cysteine residues were replaced by serine) wherein one clone was produced without hinge and five clones with fractions of the discretely truncated hinge (3, 6, 12, 16, and 20 amino acids). All the synthetic genes contained the additional internal restriction sites ApaI and RsrII to allow substitution of the DNA coding for the peptide. The DNA of the synthetic genes was provided in the bacterial vector pMK (GeneArt). Vector DNA was produced in E. coli DH5α (LB/kanamycin, 50 μg/mL) and subcloned into pEXPR-IBA42 via the restriction sites XbaI/HindIII. A vector for expression of the Fc fragment without any bicyclic peptide or hinge was generated by PCR-amplification of the UK18-Fc gene with the primers Hn-forw (5′-GAGAACCCACTGCTTACTGGC-3′) and Hn-stop-rev (5′-AAACTTAAGCTTATTATCACTAGCCCGGGCTCAGGCTCAGGCTTTTCTGG3′; HindIII underlined) and inserted via the NheI and HindIII restriction sites into pEXPR-IBA42. All constructs were verified by DNA sequencing (Macrogen, Seoul, South Korea) and termed pEXPR-UK18-H0-Fc, pEXPR-UK18-H3-Fc, pEXPRUK18-H6-Fc, pEXPR-UK18-H12-Fc, pEXPR-UK18-H16-Fc, pEXPR-UK18-H20-Fc, and pEXPR-Fc (see DNA sequences in Supporting Information). Vectors for expression of UK18-hingeFc-streptag fusion protein with varying hinge regions and FcN

■

EXPERIMENTAL PROCEDURES Cloning of Mammalian Expression Vectors. All mammalian expression vectors are based on pEXPR-IBA42 (IBA BioTAGnology GmbH, Göttingen, Germany) containing a CMV promoter and an ampicillin antibiotic resistance gene. Constructs for expression of UK18-hinge-Fc fusion protein with varying hinge regions were cloned by inserting de novo synthesized DNA (codon-optimized for expression in mammalian cells; GeneArt, Regensburg, Germany) into pEXPR-IBA42 (SI Figure S1A,B). The synthetic DNA is coding for the BM40 secretion signal (NMRAWIFFLLCLAGRALAC), UK18 peptide, a Gly-Ser dipeptide spacer, a variable hinge region, and an Fc fragment (based on the nucleotide sequence of human IgG1 heavy chain constant regions CH2 and CH3 with an Asn297Ala mutation; amino acids 236 to 446, Kabat numbering; accession number: AAL96263). The hinge regions are based on the human 1857

dx.doi.org/10.1021/bc300184m | Bioconjugate Chem. 2012, 23, 1856−1863

Bioconjugate Chemistry

Article

protein (10 μM), 0.5 mL TBMB (300 μM in 100% v/v ACN) was added and incubated at 30 °C for 1 h. Excess of nonreacted TBMB was removed by gel filtration using a Hiprep 26/10 desalting column equilibrated with buffer Z (10 mM Tris-Cl, pH 7.4, 150 mM NaCl, 10 mM MgCl2, 1 mM CaCl2, 0.22 μm filtered and degassed). The TBMB-modified homo- and heterodimer Fc fusion protein samples were concentrated to 50−500 μM final concentration by using a 10 000 MWCO Vivaspin-20 ultrafiltration device (Sartorius-Stedim Biotech GmbH) at 3000 g and 4 °C. SDS-PAGE and Analytical Gel Filtration. To investigate whether TBMB-treated peptide-Fc fusion proteins were composed of intermolecular or intramolecular covalently linked species, protein samples were analyzed by SDS-PAGE under denaturating and reducing conditions. Each Fc fusion protein, before and after TBMB-modification, was denaturated in ClearPAGE LDS sample buffer (CBS Scientific Company, San Diego, CA, USA) supplemented with 100 mM TCEP. Samples of 1.5 μg Fc fusion protein were treated for 5 min at 90 °C, loaded on a 12% SDS ClearPAGE gel in ClearPAGE SDS-reducing running buffer, and stained with Coomassie G-250 blue solution. Native size and oligomerization state of TBMB-modified peptide-Fc fusion proteins were analyzed by size-exclusion chromatography with a Superdex 75 10/300 GL column (GE Healthcare) connected to an AKTApurifier system and equilibrated with buffer Z. Samples of 100 μL Fc fusion protein (50 μM) were analyzed. Mass Spectrometric Analysis. The molecular mass of Fc fusion proteins before and after modification with TBMB was determined with electrospray ionization mass spectrometry (ESI−MS) performed on a quadrupole time-of-flight mass spectrometer (Q−TOF) Ultima API (Waters, Millford, MA, USA) operated with the standard ESI source and in positive ionization mode. Protein samples were desalted before mass spectrometric analysis as described in the Supporting Information. The ESI-Q-TOF mass spectrometer was calibrated for a range of 500 to 2500 m/z. The mass accurancy was always better than 4 ppm, and it was monitored through continuous and automated reference mass introduction. Ten microliter desalted protein samples (5 μM) were injected for each measurement. Data were acquired, processed, and analyzed using the software MassLynx v 4.1 (Waters). Protease Inhibition Assay. Inhibition of human uPA by the Fc fusion proteins was measured by incubating different concentrations of each Fc fusion protein (2-fold dilutions) with 1.5 nM human uPA (UPA-LMW, from human urine, 33 kDa; Molecular Innovations, Novi, MI, USA). The enzymatic assays were performed at 25 °C in 150 μL volume of buffer Z containing 10 mM Tris-Cl, pH 7.4, 150 mM NaCl, 10 mM MgCl2, 1 mM CaCl2, 0.1% w/v BSA, 0.01% v/v Triton-X100, and 5% v/v DMSO and using the fluorogenic substrate Z-GlyGly-Arg-AMC (50 μM; Bachem, Bubendorf, Switzerland). The initial velocities were monitored as changes in fluorescence intensity during 30 min on a Spectramax Gemini fluorescence plate reader (excitation at 355 nm, emission recording at 460 nm; Molecular Devices, Sunnyvale, CA, USA). Ki values were determined as described in the Supporting Information. Determination of Pharmacokinetics in Mice. All animal studies were carried out according to Swiss regulations under a project license granted by the Service de la Consommation et des Affaires Vétérinaires Vaudois. Female BALB/c mice (Charles River, France) aged 7 to 9 weeks were intravenously injected with 100 μg heterodimeric UK18-H12-Fc-streptag/Fc-his6tag or

his6tag fusion protein for heterodimer production were cloned by inserting PCR-amplified DNA from the above-described constructs into pEXPR-IBA42 (Figure S1C). DNA coding for UK18-hinge-Fc-streptag fusion protein with varying hinge regions was amplified from the above-described synthetic DNA in six separate PCR reactions using the primers Hn-forw (5′GAGAACCCACTGCTTACTGGC-3′) and Hn-strepII-rev (5′-AAACTTAAGCTTATTATCACTATTTTTCGAACTGCGGGTGGCTCCAAGCCGAGCC CGGGCTCAGGCTCAGGCTTTTCTGG-3′; HindIII site underlined), the latter primer attaching a sequence encoding streptag (NWSHPQFEKC) at the C-terminus of the Fc fragment. PCR products were inserted via XbaI and HindIII into pEXPRIBA42. DNA coding for Fc-his6tag fusion protein was amplified from pEXPR-Fc using the primers Hn-forw and Hn-his6-rev (5′AAACTTAAGCTTATTATCACTAGTGATGGTGATGGTGATGTCCCGAGCCCG GGCT CAGGCTCAGGCTTTTCTGG-3′; HindIII site underlined), the latter primer attaching a sequence encoding his6tag (NHHHHHHC) at the C-terminus of the Fc fragment. The PCR product was inserted via NheI and HindIII into pEXPR-IBA42. The correct sequences of the resulting plasmids pEXPR-UK18-H0-Fcstreptag, pEXPR-UK18-H3-Fc-streptag, pEXPR-UK18-H6-Fcstreptag, pEXPR-UK18-H12-Fc-streptag, pEXPR-UK18-H16-Fcstreptag, pEXPR-UK18-H20-Fc-streptag, and pEXPR-Fc-his6tag were confirmed by DNA sequencing (see DNA sequences in Supporting Information). Expression and Purification of Fc Fusion Proteins. Fc fusion proteins were expressed in transiently transfected human embryonic kidney (HEK-293) cells (typically 100 mL cultures). Protocols used for cell culturing and transfection are described in detail in the Supporting Information. After 7 days of expression, cells were removed by centrifugation (2500 rpm for 15 min at 4 °C) and filtration (0.45 μm PES membranes filter) and the proteins in the supernatant purified as follows. The homodimeric UK18-hinge-Fc fusion proteins and the Fc fragment were purified by protein G affinity chromatography (1 mL HiTrap Protein G HP column; GE Healthcare, Uppsala, Sweden) and desalted on a Hiprep 26/10 desalting column (GE Healthcare) using buffer R (20 mM NH4HCO3, 150 mM NaCl, 5 mM EDTA, pH 8.0). The heterodimeric UK18-hinge-Fc-streptag/Fc-his6tag fusion proteins, expressed by cotransfection of two plasmids in equal quantities, were sequentially purified by protein G affinity chromatography, Ni-affinity chromatography (1 mL HisTrap FF column; GE Healthcare), streptavidin-based affinity chromatography (1 mL Strep-Tactin Superflow high capacity H-PR cartridge; IBA, BioTAGnology, GmbH) and desalted on a Hiprep 26/10 desalting column using buffer R. Detailed protocols with information on buffers and volumes are described in the Supporting Information. Chemical Macrocyclization of Peptide Fused to Fc Fragment. Concentrated Fc fusion proteins (5 mL at 20−50 μM) were incubated with 1 mM TCEP (Sigma-Aldrich Chemie GmbH, Steinheim, Germany) in buffer R at 30 °C for 1 h to reduce cysteine side chains of the UK18 peptide. The reducing agent was removed by gel filtration using a Hiprep 26/10 desalting column (GE Healthcare) and buffer M (20 mM NH4HCO3, 5 mM EDTA, pH 8.0, 0.22 μm filtered and degassed). EDTA was used in buffer M to chelate divalent metal cations minimizing oxidation of sulfhydryl groups. Immediately after reduction and purification, the fusion proteins were reacted with 3-fold molar excess of TBMB as follows. To 4.5 mL of reduced homodimer (5 μM) or reduced heterodimeric Fc fusion 1858

dx.doi.org/10.1021/bc300184m | Bioconjugate Chem. 2012, 23, 1856−1863

Bioconjugate Chemistry

Article

homodimeric Fc-his6tag fusion protein. Blood samples (20 μL), collected 5 min, 6 h, and 12 h, as well as 1, 2, 4, and 8 days after injection, were kept at room temperature to coagulate; and serum was recovered after centrifugation at 6000 g for 10 min. UK18-Fc conjugate was quantified by an ELISA assay in which either human uPA or mouse anti-human Fc polyclonal antibody was immobilized on the bottom of a microtiter plate, the serum samples containing Fc protein added and captured protein detected with a goat anti-human-Fc antibody conjugated to HRP. A detailed protocol of the ELISA assay is provided in the Supporting Information.

that TBMB had indeed cross-linked two UK18-Fc monomers in a large fraction of the protein (SI Table S1). Most likely, the close spatial proximity of the two UK18 peptides in homodimeric UK18-Fc fusion protein had allowed reaction of one TBMB molecule with cysteines of both monomers. In a protease inhibition assay, the TBMB-modified homodimeric UK18-Fc fusion protein blocked human uPA with a Ki of 3 μM (Table 1). Table 1. Inhibitory Activity of Homo- and Heterodimeric UK18-hinge-Fc Conjugates Towards Human uPAa

■

Ki ± SE (nM)

RESULTS Chemical Cyclization of Peptides Genetically Fused to an Fc Fragment. A fusion protein comprising an N-terminal 17-amino-acid peptide, a 2-amino-acid Gly-Ser spacer, and a Cterminal Fc fragment derived from human IgG1 was transiently expressed in mammalian cells and purified (Figure 1A and SI Figure S2A). From a 100 mL culture, 8−12 mg purified Fc fusion protein could be obtained. The hinge region, containing cysteine residues that form interchain disulfide bridges, was not included in the Fc fusion protein to prevent interference of the thiol groups with the peptide cyclization reaction. The single glycosylation site in the CH2 domain of the Fc fragment was mutated (Asn297Ala) to facilitate monitoring of chemical modifications of the fusion protein by mass spectrometry. The 17-amino-acid peptide with the sequence N ACSRYEVDCRGRGSACGC is derived from the bicyclic peptide UK18 described above. The fusion protein of the peptide with human IgG Fc fragment is termed “UK18-Fc” in the following. UK18-Fc fusion protein was treated with the negatively charged reducing agent TCEP to favor reduction of cysteine residues in the solvent-exposed N-terminal peptide appendix over the less accessible intrachain disulfide bridges present in the CH2 and CH3 domains of Fc fragment. After TCEP removal, sulfhydryl groups were reacted with the cyclization reagent TBMB (Figure 1A). Mass spectrometric analysis revealed two products, the first one showing a mass of 25 799 Da, corresponding to UK18-Fc monomer modified with a single TBMB molecule (mass increase of 116 Da), and the second one showing a mass of 51 600 Da corresponding to homodimeric UK18-Fc fusion protein modified with two TBMB molecules (mass increase of 232 Da) (Figure 1B). A sequence-identical Fc fragment without any N-terminal peptide was expressed in parallel and used as a control to verify if any groups of Fc fragment are modified by TBMB. Expression of this Fc fragment yielded two products, one with the expected mass and one with a 215 Da smaller mass, corresponding to Fc fragment with a proteolytically truncated Nterminus (lacking Ala-Ser-Gly; Figure 1C). The homodimeric Fc fragment was not modified with TBMB, even at a 10-fold higher TBMB concentration (Figure 1C and SI Figure S5). In the mass spectrum, only Fc monomer can be seen, indicating that the two subunits of the homodimeric Fc fragment completely dissociate during mass spectrometric analysis. Following this observation, we wondered whether, in TBMB-modified homodimeric UK18Fc fusion protein, the two monomers were covalently crosslinked as suggested by one of the mass peaks (Figure 1B). SDSPAGE analysis of TBMB-modified homodimeric UK18-Fc fusion protein under reducing conditions showed two bands with the minor band having a molecular weight corresponding to a UK18-Fc monomer (∼26 kDa) and the major band to a homodimeric UK18-Fc fusion protein (∼52 kDa) (Figure 1D). The presence of a dimer under denaturing conditions showed

hinge

UK18-hinge-Fc homodimer

UK18-hinge-Fc heterodimer

H0 H3 H6 H12 H16 H20

3079 ± 112 990 ± 24 310 ± 10 128 ± 6 149 ± 10 145 ± 9

619 ± 39 202 ± 15 158 ± 14 76 ± 4 87 ± 1 83 ± 2

a

The conjugates tested contain linkers of different lengths that are based on the amino acid sequence of the human IgG1 hinge (see the sequences in Figure 2A and SI Figure S1). The indicated name of the hinge reflects the number of amino acids in the linker. The Ki values of the Fc homo- and heterodimers were determined at 25 °C and physiological pH (7.4), using the fluorogenic Z-Gly-Gly-Arg-AMC substrate at a concentration of 50 μM. Averages from at least three measurements are indicated. S.E., standard error.

The Ki was calculated based on the concentration of an UK18-Fc monomer to facilitate a direct comparison with the activity of synthetic UK18. This activity is about 60-fold weaker than that of synthetic bicyclic peptide UK18 (Ki = 53 nM)2 (Figure 1E). Optimizing the Linker Length Between UK18 and Fc Fragment. Speculating that a longer linker between the peptide and the Fc fragment could reduce the cross-linking, we cloned and expressed UK18-Fc fusion proteins containing 3, 6, 12, 16, or 20 amino acids of the wild-type IgG1 hinge region in addition to the flexible Gly-Ser spacer (Figure 2A). The cysteine residues in these truncated hinges were replaced by serine to prevent undesired reactions with TBMB. SDS-PAGE analysis of the different Fc fusion proteins before and after modification with TBMB showed that the degree of cross-linking was gradually reduced with linker lengthening (Figure 2B). The monomer-todimer ratio of constructs with hinges of 12 or more amino acids was estimated to be around 3:1 (SI Table S1). Mass spectrometric analysis of the Fc fusion proteins showed Oglycosylation of constructs with linkers equal or longer than 12 amino acids (addition of 162, 203, and 291 Da; Figure 2C). Mass spectrometric analysis of the homodimeric UK18-hinge-Fc fusion proteins after TBMB-treatment showed that each of the monomers had reacted with one TBMB and the dimers with two TBMB. Similar to experiments with the initial UK18-Fc fusion protein, no incomplete or unspecific reaction could be detected. The inhibitory activities of the new constructs were found to improve significantly with linker lengthening (Figure 2D and Table 1). The fusion protein with a 12-amino-acid hinge was 20fold more potent (Ki = 128 nM) than the initial construct having just a Gly-Ser spacer. Extending the hinge region to 16 or 20 amino acids did not further improve the inhibitory activity. Generation of Fc Fragments with a Single Bicyclic Peptide. To completely prevent peptide cross-linking, we generated heterodimeric Fc fusion protein in which only one of the Fc monomers is displaying the UK18 peptide (Figure 3A). 1859

dx.doi.org/10.1021/bc300184m | Bioconjugate Chem. 2012, 23, 1856−1863

Bioconjugate Chemistry

Article

Figure 2. continued corresponds to the mass change upon reaction with one TBMB molecule. NeuAc stands for N-acetylneuraminic acid (sialic acid), HexNAc for N-acetylhexosamine, and Hex for hexose (see also SI Figure S8). Mass spectra of constructs with different hinge lengths are shown in SI Figures S6, S7, S9, and S10. (D) Inhibitory activities of the homodimeric UK18-hinge-Fc fusion proteins after modification with TBMB. Residual activity of human uPA was measured at different protein concentrations and Ki values were determined (see Table 1). Averages from at least three measurements are indicated (see also SI Figure S2A,B).

We coexpressed a UK18-Fc fusion protein having a C-terminal strep-tag (streptag) and an Fc fragment without any peptide having a C-terminal polyhistidine tag (his6tag). The heterodimeric Fc fusion protein was extracted by sequential affinity purification on immobilized protein G, nickel, and streptavidin, respectively, and further purified by gel filtration. From a 100 mL culture, 1−2 mg of purified Fc fusion protein was obtained. A total of six different heterodimeric Fc fusion proteins were produced, each having a different hinge length. All the constructs were modified with TBMB and analyzed by SDS-PAGE and mass spectrometry (Figure 3B). Both the TBMB-modified and unmodified Fc fusion proteins migrated exclusively as monomers in a denaturing polyacrylamide gel, indicating that the two monomers were not cross-linked. This observation could be confirmed by mass spectrometry, showing that only the Fc fragment with the UK18 peptide was modified with TBMB (Figure 3C). The difference in mass was 116 Da, corresponding to the expected change due to the TBMB modification. Similar to what we had observed before with the Fc homodimers, the fusion proteins with longer linkers showed more potent inhibition (Figure 3D). This observation indicated that the activity of the initial UK18-Fc homodimer was impaired not only due to peptide cross-linking, but also due to a shorter linker which may sterically hinder binding of the bicyclic peptide to the target protein. The constructs with the best inhibitory activity were again those having hinge regions of 12, 16, and 20 amino acids (Ki of 76, 87, and 83 nM; Figure 3D and Table 1). Plasma Half-Life and Stability of the Bicyclic PeptideFc Conjugate in Mice. The plasma half-life of the heterodimeric UK18-hinge-Fc fusion protein with the 12amino-acid linker (UK18-H12-Fc-streptag/Fc-his6tag) showing the highest inhibitory activity was assessed in mice. UK18 inhibits mouse uPA around 1000-fold weaker than human uPA,2 and this weak binding was expected not to influence the pharmacokinetics of the conjugate. 100 μg of Fc fusion protein was injected intravenously, and levels of the bicyclic peptide-Fc conjugate were quantified by ELISA after 5 min, 6 h, and 12 h as well as 1, 2, 4, and 8 days. Fc fusion protein in serum samples was captured in microtiter plates coated with human uPA and detected with an anti-human Fc antibody−peroxidase conjugate. This assay format assured that only Fc fusion protein with functional UK18 was quantified. The conjugate was cleared in two phases wherein the terminal half-life of the construct was 43 h (Figure 4). In a second ELISA assay, the concentration of human Fc fragment in the mouse blood samples was quantified by capturing the protein with a polyclonal anti-human Fc antibody and detecting with anti-human monoclonal antibody. In this assay format, any human Fc fragment was detected irrespective of the presence or absence of UK18. This experiment showed a similar clearance curve with a terminal half-life of 36 h

Figure 2. Fc fusion proteins with different peptidic linkers between the peptide and the Fc fragment. (A) Schematic representation of protein constructs. The peptidic linkers with different lengths are based on the amino acid sequence of the human IgG1 hinge region wherein cysteines were replaced by serines. The sequences are indicated as well as a name that reflects the number of amino acids (e.g., H3 contains 3 amino acids of the hinge) (see also SI Figure S1A,B). (B) Migration of homodimeric UK18-hinge-Fc fusion proteins with different linker lengths on a reducing SDS-PAGE. 1.5 μg of each unmodified and modified homodimeric Fc fusion proteins have been loaded per well. U = unmodified, M = TBMB-modified (see also SI Table S1). (C) Mass spectra of homodimeric UK18-hinge-Fc fusion protein with the H12 linker before (upper panel) and after (lower panel) modification with TBMB. Due to O-glycosylation of the hinge region, several molecular masses can be observed. All the masses are shifted by 116 Da, which 1860

dx.doi.org/10.1021/bc300184m | Bioconjugate Chem. 2012, 23, 1856−1863

Bioconjugate Chemistry

Article

Figure 3. Macrocyclization of a single peptide fused to Fc fragment. (A) Schematic representation of UK18-hinge-Fc/Fc heterodimer and cyclization of the peptide with TBMB. The two different affinity tags polyhistidine-tag (his6tag) and streptavidin-tag (streptag) allowed the purification of heterodimer after coexpression of both Fc fusion proteins (see also SI Figure S1C). (B) Migration of the two subunits from the heterodimeric Fc fusion proteins on a reducing SDS-PAGE. The different hinge lengths of the fusion proteins are indicated. 1.5 μg of each unmodified (U) and modified (M) heterodimeric Fc fusion protein has been loaded per well. U = unmodified, M = TBMB-modified. (C) Mass spectra of UK18-hinge-Fc-Streptag/Fc-His6tag fusion protein before (upper panel) and after (lower panel) modification with TBMB. The analyzed Fc fusion protein contains a 12-amino-acid hinge region (H12) that was O-glycosylated. The mass of the Fc fusion protein after reaction with TBMB is shifted by 116 Da that corresponds to the mass change upon reaction with one TBMB molecule. The mass of this polyhistidine-tagged Fc fragment is unchanged (see also SI Figure S14). Mass spectra of constructs with different hinge lengths are shown in SI Figures S11, S12, S13, S15, S16, and S17. (D) Inhibitory activities of the heterodimeric Fc fusion proteins after modification with TBMB. Residual activity of human uPA was measured at different protein concentrations and Ki values were determined (see Table 1). Averages from at least three measurements are indicated (see also SI Figure S2C,D).

volume of distribution are indicated in Table 2. For comparison, the pharmacokinetics of an Fc fragment without bicyclic peptide was assessed. The homodimer of Fc-his6tag had a similar terminal half-life (33 h).

■

DISCUSSION In contrast to the generation of disulfide-cyclized peptide-Fc fusion proteins, the formation of bicyclic peptide-Fc fusions posed a greater challenge since it involved (i) an intermolecular reaction between the peptide and the cyclization reagent, (ii) Table 2. Pharmacokinetic Parameters of UK18-H12-Fcstreptag/Fc-his6tag after Intravenous Administration of 100 μg Protein (around 5.5 mg/kg) in Micea

Figure 4. Pharmacokinetics of a bicyclic peptide UK18-H12-Fc-streptag/ Fc-his6tag in female BALB/c mice. Serum concentrations of the heterodimer were measured with two different ELISA assays at the indicated time points. In the first assay, Fc fragment with functional UK18 was quantified by capturing the heterodimer with human uPA and detection with a monoclonal anti-human Fc antibody (●). In the second assay, all heterodimeric Fc fusion protein was quantified by capturing with a polyclonal anti-human Fc antibody and detection with a monoclonal anti-human Fc antibody (○). Averages obtained from experiments with 2 mice are shown. Standard deviations are indicated.

UK18-H12-Fc-streptag/Fc-his6tag Cmax (μg/mL) t1/2 β (h) AUC0−8days (h·μg/mL) CL (mL/h) Vd (mL)

with functional UK18

with Fc domains

83.5 43.3 1873 0.064 4

74.8 36.5 1825 0.07 3.7

a

The plasma concentration of Fc fusion protein with functional K18 or of total Fc was quantified by EA. The fusion protein was captured on microtitre plates coated with human uPA or polyclonal anti-human Fc antibody. Cmax was measured at 5 min.

(Figure 4), suggesting that the bicyclic peptide UK18 linked to Fc fragment remained essentially functional for several days in circulation. Pharmacokinetic parameters including clearance and 1861

dx.doi.org/10.1021/bc300184m | Bioconjugate Chem. 2012, 23, 1856−1863

Bioconjugate Chemistry

Article

The terminal half-life of the bicyclic peptide-Fc conjugate was 1.5 days and therefore around 100-fold longer than peptide macrocycles of the size of UK18. Compared to the nonglycosylated human IgG1 Fc fragment, having a terminal half-life of 2.5 days in mice,24 the bicyclic peptide-Fc fusion was cleared more rapidly. The slightly shorter plasma half-life might result from a lower stability due to the lack of interdomain disulfide bridges. Human IgG1 Fc fragment glycosylated at Asn297 has a half-life of around 6 days, and it is likely that the circulation time of UK18-Fc could significantly be prolonged by using the glycosylated analogue.24 The two ELISA formats that detected either Fc fragment with functional UK18 or Fc fragment irrespective of UK18 showed similar plasma half-lives. This finding indicated that the bicyclic peptide remained largely intact while circulating in the bloodstream of mice. This outcome was pleasing, since peptide macrocycles are not necessarily stable for extended time periods in vivo. For example, the cyclic atrial natriuretic peptide that was recently linked to the Fc fragment by native chemical ligation appeared to be degraded more rapidly than the Fc fragment was cleared from the circulation.21 The long circulation time of the bicyclic peptide UK18 allows its testing in an animal tumor model. The 3-fold smaller molecular mass of the bicyclic peptide-Fc fusion protein compared to antibodies should allow it to penetrate better into tumors. Conjugates promising even better diffusion properties may be generated by fusing bicyclic peptides to recently developed monomeric Fc protein.25 The clean and efficient reaction of TBMB with Fc fragment suggests that bromomethyl-benzene groups can also be applied for other chemical modifications in antibodies or antibody fragments. For example, Fc fusions of phage-selected monocyclic peptides cyclized with bis-(bromomethyl)benzene linkers may be generated similarly to the bicyclic peptide fusions. Furthermore, antibody−drug conjugates that are increasingly being developed may be generated by linking chemically synthesized bromomethylbenzene-functionalized drugs to antibodies containing free cysteine residues. TBMB was proven to quantitatively modify peptides even if applied only at a small molar excess (e.g., at a ratio of peptide:TBMB = 1:1.2 at medium to high micromolar concentrations). This suggests that compounds functionalized with bromomethyl-benzene groups can be reacted with equimolar concentrations of antibody and compound, making the coupling economical. In summary, we have shown that bicyclic peptide-Fc conjugates can be efficiently produced by post-translationally cyclizing a peptide-Fc fusion protein. The bicyclic peptide conjugated to Fc fragment having nearly the same activity as the synthetic bicyclic peptide and a terminal half-life of more than one day will allow testing its therapeutic effect in animal disease models. In addition, the chemical reaction might be applied to cyclize other formats of peptides fused to antibody fragments or to conjugate synthetic molecules to antibody Fc fragments or to entire antibodies.

three rather than one covalent bonds to be formed, and (iii) a reaction type which is less chemoselective than the oxidative coupling of thiols to disulfides. An additional challenge in the modification of sulfhydryl groups in peptides linked to Fc fragment was the presence of intradomain disulfide bridges in CH2 and CH3 that could potentially be reduced and modified. Despite this increased complexity, the modification of cysteines in peptide-Fc fusion proteins was surprisingly selective and efficient. Initial problems resulting from cross-linking of spatially close peptides in UK18-Fc homodimers could be resolved by expressing a heterodimeric Fc fragment with only one subunit carrying a peptide. A number of elegant strategies have been developed to generate Fc heterodimers. Carter and co-workers had developed Fc heterodimers by introducing ″knob-into-hole″ mutations in the CH3 domain.17 Yan and co-workers had enhanced Fc heterodimer formation by placing complementary charges at the CH3 domain interface.18 Here, we chose a strategy based on differently tagged monomers that are sequentially purified by affinity chromatography. This approach gave smaller yields but guaranteed that all assembled Fc fragments were heterodimers. Peptides of these heterodimers were all correctly cyclized and a maximal inhibitory activity (Ki) of 76 nM could be observed which is comparable to the activity of chemically synthesized UK18 (53 nM). Coexpression of two different monomers may also allow the generation of Fc fragments with two bicyclic peptides, each one at a different end of the dimer to prevent cross-linking by TBMB. The bicyclic peptide could optionally have different sequences to generate bispecific ligands. The cross-linking of subunits by TBMB might alternatively be prevented by linking the peptides to the N-termini of a full-size IgG antibody. In this case, the Y-shape of immunoglobulin could be exploited to spatially separate the two peptides from each other. A key parameter in the development of potent Fc-linked bicyclic peptide inhibitors was the length of the hinge region connecting the bicyclic peptide and the Fc fragment. Lengthening the hinge in homo- and heterodimeric UK18-Fc fusion protein significantly increased the inhibitory activity of the conjugates, indicating clearly that short linkers impair binding to uPA. Similar effects resulting from linker variation were previously reported for a number of peptide- or protein-Fc fusions.19−21 In constructs with hinge regions equal to or longer than 12 amino acids, glycosylation occurred which was not anticipated. Mutation of the cysteine residues in the hinge of IgG1 (NEPKSCDKTHTCPPCPAPELLC) generates a sequence rich in proline and serine, which is known as a preferred Oglycosylation substrate.22 The sequence with the cysteine to serine mutations is actually similar to the hinge sequence of IgA1 (NPSTPPTPSPSTPPTPSPSC) which is O-glycosylated.23 Each of the glycosylated UK18-hinge-Fc fusion proteins was similarly modified having one, two, three, or four sugar units attached. On the basis of the mass spectrometric pattern, the glycosylation was composed of one N-acetylhexosamine, one hexose, and two Nacetylneuraminic acid units. On the basis of common Oglycosylation patterns in the IgA1 hinge and the mass spectrometry results, the units are most likely assembled in a branched structure as shown in Figure 2C with N-acetylhexosamine being N-acetylgalactosamine and hexose being galactose. The three conjugates that were glycosylated had the highest uPA inhibitory activity, but it is not clear if glycosylation had influenced the activity. It is more likely that their high activity results from the longer linkers.

■

ASSOCIATED CONTENT

S Supporting Information *

Detailed procedures for the expression, purification, and characterization of Fc fusion proteins. Supplementary analytical data such as gel filtration chromatograms and mass spectra are also provided. This material is available free of charge via the Internet at http://pubs.acs.org. 1862

dx.doi.org/10.1021/bc300184m | Bioconjugate Chem. 2012, 23, 1856−1863

Bioconjugate Chemistry

■

Article

(16) Andreasen, P. A., Egelund, R., and Petersen, H. H. (2000) The plasminogen activation system in tumor growth, invasion, and metastasis. Cell. Mol. Life Sci. 57, 25−40. (17) Ridgway, J. B., Presta, L. G., and Carter, P. (1996) ’Knobs-intoholes’ engineering of antibody CH3 domains for heavy chain heterodimerization. Protein Eng. 9, 617−21. (18) Gunasekaran, K., Pentony, M., Shen, M., Garrett, L., Forte, C., Woodward, A., Ng, S. B., Born, T., Retter, M., Manchulenko, K., Sweet, H., Foltz, I. N., Wittekind, M., and Yan, W. (2010) Enhancing antibody Fc heterodimer formation through electrostatic steering effects: applications to bispecific molecules and monovalent IgG. J. Biol. Chem. 285, 19637−46. (19) Bitonti, A. J., and Dumont, J. A. (2006) Pulmonary administration of therapeutic proteins using an immunoglobulin transport pathway. Adv. Drug Delivery Rev. 58, 1106−18. (20) Dumont, J. A., Low, S. C., Peters, R. T., and Bitonti, A. J. (2006) Monomeric Fc fusions: impact on pharmacokinetic and biological activity of protein therapeutics. BioDrugs 20, 151−60. (21) Mezo, A. R., McDonnell, K. A., Low, S. C., Song, J., Reidy, T. J., Lu, Q., Amari, J. V., Hoehn, T., Peters, R. T., Dumont, J., and Bitonti, A. J. (2012) Atrial natriuretic peptide-Fc, ANP-Fc, fusion proteins: semisynthesis, in vitro activity and pharmacokinetics in rats. Bioconjugate Chem. 23, 518−26. (22) Gupta, R., and Brunak, S. (2002) Prediction of glycosylation across the human proteome and the correlation to protein function. Pacific Symposium on Biocomputing, 310−22. (23) Yoo, E. M., and Morrison, S. L. (2005) IgA: an immune glycoprotein. Clin. Immunol. 116, 3−10. (24) Kim, J. K., Firan, M., Radu, C. G., Kim, C. H., Ghetie, V., and Ward, E. S. (1999) Mapping the site on human IgG for binding of the MHC class I-related receptor, FcRn. Eur. J. Immunol. 29, 2819−25. (25) Ying, T., Chen, W., Gong, R., Feng, Y., and Dimitrov, D. S. (2012) Soluble Monomeric IgG1 Fc. J. Biol. Chem. 287, 19399−408.

AUTHOR INFORMATION

Corresponding Author

*E-mail address: christian.heinis@epfl.ch. Present Address

† David H. Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge MA, 02139, United States.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank Dr. Christoph Rader for kindly providing a vector for the expression of IgG1 Fc fragment. The financial contributions from the Swiss National Science Foundation (SNSF Professorship PP00P3_123524/1 to C.H.), the National Competence Center for Biomolecular Imaging (NCCBI; PhD fellowship to P.D.), and Ministerio de Educacion del Gobierno de Espana (postdoc fellowship to J.M.S.) are gratefully acknowledged.

■ ■

ABBREVIATIONS TBMB, tris-(bromomethly)benzene; TCEP, tris-(carboxyethyl)phosphine; uPA, urokinase-type plasminogen activator REFERENCES

(1) Heinis, C., Rutherford, T., Freund, S., and Winter, G. (2009) Phage-encoded combinatorial chemical libraries based on bicyclic peptides. Nat. Chem. Biol. 5, 502−7. (2) Angelini, A., Cendron, L., Chen, S., Touati, J., Winter, G., Zanotti, G., and Heinis, C. (2012) Bicyclic peptide inhibitor reveals large contact interface with a protease target. ACS Chem. Biol. 7, 817−21. (3) Baeriswyl, V., Rapley, H., Stace, C., Pollaro, L., Teufel, D., Walker, E., Chen, S., Winter, G., Tite, J., and Heinis, C. (2012) Bicyclic peptides with optimized ring size inhibit human plasma kallikrein and its orthologs while sparing paralogous proteases. ChemMedChem,. (4) Timmerman, P., Beld, J., Puijk, W. C., and Meloen, R. H. (2005) Rapid and quantitative cyclization of multiple peptide loops onto synthetic scaffolds for structural mimicry of protein surfaces. ChemBioChem 6, 821−4. (5) Matzke, G. R., Zhanel, G. G., and Guay, D. R. (1986) Clinical pharmacokinetics of vancomycin. Clinical Pharmacokinetics 11, 257−82. (6) Tan, A. C., Russel, F. G., Thien, T., and Benraad, T. J. (1993) Atrial natriuretic peptide. An overview of clinical pharmacology and pharmacokinetics. Clinical Pharmacokinetics 24, 28−45. (7) Cockshott, I. D. (2000) Clinical pharmacokinetics of goserelin. Clinical Pharmacokinetics 39, 27−48. (8) Pollaro, L., and Heinis, C. (2010) Strategies to prolong the plasma residence time of peptide drugs. MedChemComm 1, 319−324. (9) Kontermann, R. E. (2011) Strategies for extended serum half-life of protein therapeutics. Curr. Opin. Biotechnol. 22, 868−76. (10) Huang, C. (2009) Receptor-Fc fusion therapeutics, traps, and MIMETIBODY technology. Curr. Opin. Biotechnol. 20, 692−9. (11) McDonagh, C. F., Turcott, E., Westendorf, L., Webster, J. B., Alley, S. C., Kim, K., Andreyka, J., Stone, I., Hamblett, K. J., Francisco, J. A., and Carter, P. (2006) Engineered antibody-drug conjugates with defined sites and stoichiometries of drug attachment. Protein Eng., Des. Sel. 19, 299−307. (12) Carter, P. J., and Senter, P. D. (2008) Antibody-drug conjugates for cancer therapy. Cancer j. 14, 154−69. (13) Senter, P. D. (2009) Potent antibody drug conjugates for cancer therapy. Curr. Opin. Chem. Biol. 13, 235−44. (14) Alley, S. C., Okeley, N. M., and Senter, P. D. (2010) Antibodydrug conjugates: targeted drug delivery for cancer. Curr. Opin. Chem. Biol. 14, 529−37. (15) Lyon, R. P., Meyer, D. L., Setter, J. R., and Senter, P. D. (2012) Conjugation of anticancer drugs through endogenous monoclonal antibody cysteine residues. Methods Enzymol. 502, 123−38. 1863

dx.doi.org/10.1021/bc300184m | Bioconjugate Chem. 2012, 23, 1856−1863