Article pubs.acs.org/est
Chlorine Dioxide Inactivation of Enterovirus 71 in Water and Its Impact on Genomic Targets Min Jin,†,∥ Jinyang Shan,†,∥ Zhaoli Chen,† Xuan Guo,† Zhiqiang Shen,† Zhigang Qiu,† Bin Xue,† Yongguang Wang,‡ Dunwan Zhu,§ Xinwei Wang,† and Junwen Li*,† †
Institute of Health and Environmental Medicine, Key Laboratory of Risk Assessment and Control for Environment & Food Safety, Tianjin 300050, China ‡ Yangzhou University, Yangzhou, Jiangsu Province 225127, China § Tianjin Key Laboratory of Biomedical Materials, Institute of Biomedical Engineering, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin 300192, China S Supporting Information *
ABSTRACT: To control the waterborne transmission of enterovirus 71(EV71), which is associated with hand foot and mouth disease (HFMD), it is essential to know the inactivation effectiveness of disinfectants on EV71 in water. In this article, we present a comparative analysis of the effects on EV71 following exposure to chlorine dioxide (ClO2) under different doses, pH, and temperature conditions. We show that the EV71 exhibited strong resistance to ClO2 (more than the MS2 standard) and that Ct value ranges required for a 4-log reduction of EV71 in buffered, disinfectant demand-free water at pH 7.2 and 20 °C by ClO2 were 4.24−6.62 mg/L·min according to the efficiency factor Hom model. ClO2 inactivation of the virus was temperature- and pHdependent. The virucidal efficiency was higher at pH 8.2 than at pH 5.6 and pH 7.2 and higher at 36 °C than at 4 and 20 °C. In addition, we also observed the impact of ClO2 on the entire viral genome using RT-PCR, which indicated that the 5′ noncoding region (5′-NCR) within the EV71 genome, specifically the 1−118 nt region, was the most easily damaged by ClO2 and correlated with viral infectivity. Our study has not only provided guidelines for EV71 disinfection strategies of waste and drinking water, but also confirmed the importance of the 5′-NCR for EV71 infectivity and may demonstrate a general inactivation by ClO2 of enteric virus by damaging the 5′-NCR. Furthermore, 5′-NCR can be used as a target region for PCR to investigate infectious virus contamination in environmental water and evaluate the inactivation effects of ClO2. pathogens including EV71.12 In addition, the inherent resistance of enteric viruses to the water disinfection processes means that these viruses can be present in drinking water exposing consumers to infection.12 Ji et al. investigated the occurrence of HFMD pathogens such as EV71, coxsackievirus A16, and coxsackievirus A10 in domestic sewage and secondary effluent before disinfection in a wastewater treatment plant in Xi’an, China, using a seminested RT-PCR assay.13 They found that the HFMD pathogens were highly prevalent in domestic wastewater and could also persist, although at lower levels, in the secondary effluent prior to disinfection. With the number of waterborne outbreaks resulting from human rotaviruses (HRV) and noroviruses (NV) contamination of drinking water increasing globally,14−19
1. INTRODUCTION Enterovirus71 (EV71), associated with hand foot and mouth disease (HFMD), aseptic meningitis, encephalitis, and poliomyelitis-like paralysis, can result in rapid clinical deterioration and death among young children.1,2 Outbreaks of severe HFMD caused by EV71 and accompanied by significant mortality have occurred across the Western Pacific region in recent years and it has been a major public health problem in many countries including Singapore, Taiwan, Vietnam, and China.3−10 EV71 is a human enteric virus that is spread via the fecal− oral route. The virus can be shed in extremely high numbers in the feces of infected individuals suffering from HFMD and is known to persist for more than five weeks in the feces of patients after recovery.11 EV71 can be excreted into aquatic environments and spread through water. Enteric viruses have greater environmental stability than other viruses and bacteria. Importantly, conventional activated sludge and membrane filtration processes fail to ensure the complete removal of viral © 2013 American Chemical Society
Received: Revised: Accepted: Published: 4590
December 29, 2012 April 4, 2013 April 5, 2013 April 5, 2013 dx.doi.org/10.1021/es305282g | Environ. Sci. Technol. 2013, 47, 4590−4597
Environmental Science & Technology
Article
was provided by the State Key Laboratory of Pathogens and Biosecurity, Institute of Microbiology and Epidemiology (Beijing, China). Viruses were grown and assayed using the human rhabdomyosarcoma cell line (RD, ATCC CCL-136) as previously described.29 Briefly, following EV71 inoculated onto RD cell monolayer and absorbed for 1 h at 37 °C, viruses were propagated with Eagle’s minimum essential media (EMEM) containing 2% calf serum (CS; HyClone, Beijing, China) at an incubation temperature of 37 °C with 5% CO 2 . At predetermined times of maximum virus titer (based on kinetic studies of each virus), the supernatant was removed and 10 mL of phosphate buffer sodium (PBS) was added to the flask.34 These cell-associated virus preparations were subjected to three freeze−thaw cycles to release viruses followed by centrifugation to remove cell debris. The supernatant was then assayed for infectious EV71 and found to contain 107.75 tissue culture infective doses (TCID50)/ml.28 The viral suspension was stored at −70 °C. Before use, the EV71 suspension was thawed, sonicated for 30 s at 20 kHz (150 W), and filtered through a 0.22 μm pore-size membrane to remove any large clumps or aggregates of virus. ClO2 Production and Measurement. The preparation of ClO2 solutions was performed as previously described.35 Briefly, a 25% (w/v) solution of NaClO2 was pumped at a feed rate of 2−3 mL/min into a gas-generating bottle containing 12 mol/L of H2SO4. This bottle was connected to a chlorine scrubber bottle containing a 10% (w/v) solution of NaClO2. The scrubber was connected to a ClO2 collection bottle filled with deionized distilled water. At the end of the series, an additional ClO2 trap bottle with 10% (w/v) of KI was present to trap any remaining ClO2. Overall, the stock ClO2 solution purity averaged 99%. The stock ClO2 solution was diluted to obtain a concentration of 1 g/L to facilitate the addition of low concentrations of ClO2 to water samples. Diluted ClO2 stock solutions were stored in headspace free 50 mL amber vials at 4 °C in the dark. The residual chlorine and ClO2 concentrations were both measured as previously described.28 Disinfection Experiments. Microbial inactivation experiments were conducted in sterile 500 mL glass bottles containing sterile PBS buffer solution. Test viruses/bacteria were added to each bottle respectively at the following final concentrations: EV71, 105 to 106 TCID50/ml; MS2, 106 to 107 PFU/ml; E. coli 106 to 107 CFU/ml. ClO2 was then added to all vials (except to control vials) at the desired disinfectant dose. The samples were mixed on a shaker at 150 rpm. One milliliter samples were collected at various time points (i.e., 0 s, 15 s, 30 s, 1 min, 2 min, 5 min, 10 min, 15 min, 20 min, 25 min, 30 min) and immediately neutralized with 0.1 mol/L sodium thiosulfate for the determination of viral titers/bacterial numbers or for viral RNA extraction. An additional 1 mL sample was also collected for ClO2 residual measurements at each sampling time point and immediately analyzed to calculate Ct values. Each ClO2 dose experiment was performed in triplicate in a temperature controlled incubator. EV71 Infectivity. The titer of EV71 infectivity was determined as TCID50/ml. After disinfection, samples collected at selected time intervals were serially diluted (from 10−1 to 10−7) and inoculated onto RD cells grown in 96-well plates. Each dilution was prepared in 10 replicates. The 96-well plates were incubated for six days at 37 °C and then the TCID50 values were measured by quantifying the cytopathic effect on the infected RD cells by microscopy (Leica, German). Survival
it has become more and more important to examine the effectiveness of different modes of water disinfection against pathogens such as EV71. Chlorine dioxide (ClO2), a strong oxidant, has gained popularity as a suitable large-scale disinfectant of human drinking water in recent years.20−23 ClO2 does not produce the harmful byproducts such as trihalomethane that are formed by chlorine usage in addition to possessing viral inactivation superior to that of chlorine. Many studies have demonstrated that ClO2 can effectively inactivate several viruses in water and sewage, such as enteric adenovirus (ADV), poliovirus (PV), and human rotavirus (HRV).24−27 However, there is presently no available information about the inactivation of EV71 in water by ClO2. The inactivation kinetics of EV71 and the impact of pH and temperature conditions on ClO2-induced EV71 inactivation have not been reported. In addition, with demands to develop molecular methods such as polymerase chain reaction (PCR) and quantitative real time PCR (qPCR) to investigate infectious virus contamination in water increasing, it has also become more and more important to investigate the relationship between EV71 infection and the integrity of the viral genome with respect to disinfection. In previous studies, it was determined that ClO2 inactivated PV1 and hepatitis A virus (HAV) primarily by disrupting the 5′-NCR of the viral genome.24,27,28 Despite this finding, the relationship between EV71 infectivity and the integrity of the EV71 genome following ClO2 treatment has yet to be unexplored. The RNA genome of EV71 is about 7400 nt. It encodes a large polyprotein with a single open reading frame flanked by a 5′- and 3′- noncoding region (NCR). The polyprotein is divided into three regions: P1 containing capsid proteins VP1, VP2, VP3, and VP4, and P2 and P3 containing nonstructural proteins (2A, 2B, 2C, 3A, 3B, 3C, and 3D) crucial to virus replication.29 The 745 nt region of the 5′-NCR contains a cloverleaf structure (Domain I, 1−90 nt region) essential for viral RNA replication, an internal ribosome entry site (IRES, domain II−VI, 129−636) element that contains five major stem-loops (SL) and directs initiation of translation in capindependent manner and a linker region 637−745.30 For other enteroviruses, the contributions of 5′-NCR in viral replication and virulence have been shown.31,32 Yeh et al. correlated the virulence of two EV71 clinical isolates with viral 5′-NCR in a mouse infection model.29 They demonstrated that the molecular determinants responsible for this differential virulence were located in the upper SL II of EV71. With these in mind, in this study we first investigated the inactivation of EV71 by ClO2 over a range of disinfectant concentrations, pH, and temperature levels to provide guidelines for the disinfection of EV71. The relationship between viral infectivity and the integrity of the viral genome following ClO2 treatment was then further studied to explore whether ClO2 inactivation of the enteric virus involved the damage of 5′-NCR.
2. MATERIALS AND METHODS Organism Preparation and Detection. Escherichia coli (ATCC 25922), bacteriophage MS2, and its host strain E. coli (ATCC 15597) were purchased from the American Type Culture Collection. E. coli (ATCC 25922) was grown on Endo Agar LES (BD Co., USA) plates at 37 °C. Bacteriophage MS2 was prepared and detected according to standard methods.33 EV71 isolated from the feces of patients with HFMD in 2009 4591
dx.doi.org/10.1021/es305282g | Environ. Sci. Technol. 2013, 47, 4590−4597
Environmental Science & Technology
Article
Table 1. Primers Used To Amplify the EV71 Genome: F, Forward Primer; R, Reverse Primer sequence (5′ → 3′)
site (nt)
1F:TTAAAACAGCTGTGGGTTGC 1R:ACTTCCAGTACCATCCCTTG 2F: ATAGTCGGCTATGGTGAGTG 2R: AGTGAGTGTTGCTGATCCATG 3F: TGTTCACTGGGTCCTTTATGG 3R:ACCAGCATAATTTGGGTTGG 4F:TACCATTCATGTCACCTGCG 4R:CTAGATACGACACATTCCCAAA 5F:ATCAGCAAATTCATGGATTGGC 5R:ATGACATACACTAGCGATACAAC 6F:TGCTTGTCATGCAATCCATC 6R:CCTCCATGCTCATTTGAGAG 7F:ACCAAGCTAGAACCCAGTGT 7R:GAGCCAATTGCGTCTAAGATT 8F:AAATCTTAGACGCAATTGGCT 8R:TGCTATTCTGGTTATAACAAATTTACC
1−20 1173−1192 1043−1062 2220−2240 2071−2091 3262−3281 3022−3030 4303−4324 4148−4169 5273−5295 5238−5257 6211−6230 6001−6020 7291−7311 7291−7311 7380−7406
5′-1Ra:TGCTGCTTCTAAGTTTCACT 5′-2Fb:AGAAGCAGCAAACCACGATC 5′-2R:GGGTGGTCACAGAATTCAGG 5′-3Fc:GGTTTTGTACCATTAACCCTG
99−118 111−130 691−710 672−692
primer primer pair 1 primer pair 2 primer pair 3 primer pair 4 primer pair 5 primer pair 6 primer pair 7 primer pair 8 5′-NCR primers
a For the amplification of region 1−118 nt, this primer was matched with primer 1F. bFor the amplification of region111−710 nt, this primer was matched with 5′-2R. cFor the amplification of region 672−1192 nt, this primer was matched with primer 1R.
Primers Design for PCR. Eight pairs of primers were designed to amplify the whole genome of EV71 by using the Oligo 6.53 software and the sequence data of the EV71 genome available in Genbank (Accession number, HQ891929.1). Each pair included a forward (F) and reverse (R) primer and covered a region of between 1000 and 2000 nt in length. To accurately locate the region of the viral genome that had been damaged by ClO2, three additional primer sets were designed to further divide the 5′-NCR into a total of three smaller regions. Detailed information for all primers is presented in Table 1. RT-PCR. Different regions of the viral genome were amplified by RT-PCR. First, extracted RNA was reverse transcribed with random primers and oligo-dT primers by using a commercially available avian myeloblastosis virus-based RNA PCR kit (Takara, China) and following the manufacturer’s instructions. Reverse transcription was carried out in a thermal cycler (Eppendorf, Hamburg, Germany) at 42 °C for 60 min followed by 95 °C for 5 min. The cDNA product was used as a template for PCR amplification of different target regions with respective primers. Each 50 μL reaction mixture contained 1 μL of cDNA template, 25 μL Taq polymerase mixture (Takara, China), 1 μL of each primer (5 μmol/L), and 22 μL of distilled water. The thermal cycler conditions used were: one cycle of initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 90 s, followed by a final elongation step of 5 min at 72 °C. All PCR products were analyzed by electrophoresis through 2% (w/v) agarose gels stained with ethidium bromide. The DNA markers used were DL2000 and λ-HindIII digest (Takara, China). Data Analysis. The Statistical Package for the Social Sciences 19.0 (SPSS Inc., Chicago, IL, USA) was used to perform statistical analyses on the data collected.
of the viruses was determined by calculating the log10(Nt/N0), where N0 is the titer of the virus at time zero and Nt is the titer at a given contact time t. Kinetic Modeling. Chlorine decay constants (k′) for each experiment were calculated using the Solver function in Microsoft Excel 2007 (Microsoft Corp.) to regress the firstorder kinetic eq 1 using the least-squares method.
C = C0 exp( −k′t )
(1)
where C and C0 are the ClO2 residual (in mg/L) at time t (in minutes) and time 0.25 min (the closest possible measurement to time zero) respectively, and k′ is the first-order disinfectant decay rate constant (per minute).26,36 Ct values were calculated by integration of the disinfectant residual concentration (C) up to the given sampling time (t) according to Chauret et al.35 The natural log values of the survival ratio based on cell culture assays for each experiment were fit to the efficiency factor Hom (EFH) model using the following eq 2. ln Nt /N0 = −kC0 nt m([1 − e{−nk ′ t / m}]/[nk′t /m])m
(2)
where C0 and k′ were determined from eq 1, k is the inactivation rate constant, n is the coefficient of dilution, m is Hom’s exponent. Parameter values for the model were determined by minimizing the error sum of squares (ESS) between the observed and predicted ln Nt/N0 for viral disinfection experiments using Microsoft Excel Solver, and were then used to calculate the Ct values for 2-, 3-, and 4-log (99%, 99.9%, and 99.99%, respectively) inactivation for ClO2. The EFH model was chosen among the Chick−Watson, modified Chick−Watson, and EFH models because it appeared to be the best fit for the inactivation data (Tables S1−S3 of the Supporting Information). Extraction of Viral RNA. The viral RNA was extracted and further purified by using RNeasy columns (Qiagen, USA) according to the manufacturer’s instructions. 4592
dx.doi.org/10.1021/es305282g | Environ. Sci. Technol. 2013, 47, 4590−4597
Environmental Science & Technology
Article
Table 2. Summary of Estimated Parameters for Fitted EFH Model of the EV71 Disinfection Process under Various Experimental Conditions Parameter N0a 5.9 5.5 3.6 4.0 5.8 5.1 6.3
× × × × × × ×
5
10 105 105 105 105 105 105
C0b
Tc
pHd
k′e
kf
ng
mh
R2
0.50 1.50 2.00 1.50 1.50 1.50 1.50
20 20 20 20 20 4 36
7.2 7.2 7.2 5.6 8.2 7.2 7.2
0.057 0.057 0.050 0.056 0.080 0.074 0.082
0.9667 0.9652 0.0368 0.8985 0.9516 0.8797 0.8794
0.1371 1.5317 6.1582 0.3718 2.1515 1.2240 2.1289
0.5372 0.5812 0.7732 0.5466 0.6442 0.5739 0.6756
0.9950 0.9969 0.9860 0.9932 0.9972 0.9949 0.9993
a Initial EV71(TCID50/ml) concentration. bInitial disinfectant concentration, mg/L. cTemperature (°C). dPotential of hydrogen. eAverage disinfectant decay constant for replicate experiments. fInactivation rate constant. gCoefficient of dilution. hHom̀ s exponent.
Figure 1. Observed and EFH model EV71 inactivation curves under ClO2 concentration of 0.5 mg/L (a), 1.5 mg/L (b), 2.0 mg/L (c), at pH 7.2 and 20 °C.
Table 3. Ct Value Ranges Observed from Inactivation Experiment, Ct Values Calculated by Fitting the EFH Model for 2-, 3-, and 4-Log Viral Inactivation under Various Experimental Conditions Ct values (mg/L·min) required for reduction of: 2-log
a
targets
dose (mg/L)
Ta
pHb
E. coli MS2 EV71
0.1 0.5 0.5 1.5 2.0 1.5 1.5 1.5 1.5
20 20 20 20 20 20 20 4 36
7.2 7.2 7.2 7.2 7.2 5.6 8.2 7.2 7.2
obsd >0.04 >0.08 >1.44 >0.98 >0.74 >1.65 >0.43 >0.91 >0.84
to to to to to to to to to
0.84
to to to to to to to to to
4-log EFH model
1.62
to to to to to to to to to
