Chlorpyrifos Induction of Testicular-Cell Apoptosis through Generation

Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. 2018, 66, 12455−12470

Chlorpyrifos Induction of Testicular-Cell Apoptosis through Generation of Reactive Oxygen Species and Phosphorylation of AMPK Rui Chen, Yang Cui, Xuelian Zhang, Yanghai Zhang, Mingyue Chen, Tong Zhou, Xianyong Lan, Wuzi Dong, and Chuanying Pan* College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi 712100, China

J. Agric. Food Chem. 2018.66:12455-12470. Downloaded from pubs.acs.org by UNIV OF WINNIPEG on 11/30/18. For personal use only.

S Supporting Information *

ABSTRACT: Chlorpyrifos (CPF) is the most frequently applied insecticide. Aside from effects on the neuronal cholinergic system, previous studies suggested a potential relationship between CPF exposure and male infertility; however, the molecular mechanism remains elusive. The aim of this study was to investigate the toxic effect of CPF on testicular cells and the potential mechanism via in vitro and in vivo experiments. The cytotoxic effects of CPF on mouse-derived spermatogonial cell lines (GC1), Sertoli cell lines (TM4) and Leydig cell lines (TM3) were assessed by a CCK-8 assay, flow cytometry, a TUNEL assay, quantitative RT-PCR, and Western blotting. Exposure to CPF (10−50 μM) for 12 or 24 h resulted in significant death in all three testicular cell lines. The number of TUNEL-positive apoptotic cells were dose-dependent and increased with raised CPF concentrations. Further investigation indicated that CPF induced cell-cycle arrest and then promoted cell apoptosis. Additionally, CPF increased reactive-oxygen-species (ROS) production and lipid peroxidation (MDA) and reduced mitochondrial-membrane potential. The mechanism of cell apoptosis induced by CPF involved an increase in phosphorylated-AMP-activated-protein-kinase (p-AMPK) levels in the tested cells. In vivo, the expression of steroidhormone-biosynthesis-related genes in testis, spleen, and lung in F0 and F1 mice were downregulated when there was intraperitoneal injection or dietary supplementation of CPF. This study provides a potential molecular mechanism of CPFinduced toxicity in testicular cells and a theoretical basis for future treatment of male infertility. KEYWORDS: chlorpyrifos, male-reproduction toxicity, testicular cell lines, oxidative stress, AMPK, F0 and F1 mice

■

INTRODUCTION According to Phillips McDougall, part of Agribusiness Intelligence (https://phillipsmcdougall. agribusinessintelligence.informa.com), the global pesticide market has increased from $25.1 billion to $56.6 billion, with an overall growth rate of 125% over the past 14 years. Although the wide use of pesticides brings in more economic value, pesticide residue can cause irreparable damage to the environment and long-term health problems for humans and animals.1 Currently, much effort has been given to study the effects of environmental factors on health, which promotes a healthy environment for the reproduction of healthy offspring. Regrettably, Levine et al. found that the sperm count of western men dropped by 50% over the last half century.2 A major cause for the observed defects in male-reproductive function is exposure to industrial and agricultural toxins and the byproducts of other technological advancements.3 Investigators have hypothesized that the wide use of chemicals, pesticides, heavy metals, and hyperthermia are key factors that result in male infertility.4 O,O-Diethyl-O-(3,5,6-trichloro-2-pyridyl)-phosphorothioate (chlorpyrifos, CPF) is a broad spectrum organophosphorus pesticide (OP) that is commonly used in agricultural, industrial, and domestic applications.5,6 In 2016, the global sales of CPF were $686 million, and it was predicted that the compound annual growth rate (CAGR) of CPF will reach 6.1% between 2014 and 2020 (http://cn.agropages.com/). Initially, CPF was © 2018 American Chemical Society

used for pest control, because the peripheral cholinergic nervous systems of insects are a target of CPF.7,8 CPF is able to inhibit acetylcholinesterase (AChE) activity, which results in an accumulation of acetylcholine and subsequent hyperactivity in the cholinergic system.6 Additionally, it has been reported to cause hepatotoxicity,9 developmental toxicity,10,11 genotoxicity,11 immunological abnormalities,12 and cell-signaling transduction.13 In multicellular organisms, the development of gonads and germ cells is essential for the transmission of genetic information to the next generation and ultimately for the survival of the species.14 As the most important reproductive organ in male individuals, the testes attract a great deal of attention. CPF was administered orally to male mice at different doses for 4 weeks, and the number of live fetuses was decreased in the high-dose group compared with in the control group; this was also accompanied by an increased number of dead fetuses in CPFtreated mice. Additionally, the sperm counts and sperm motility were markedly reduced, and the sperm malformation rates in exposed males also went up significantly.15 This phenomenon was further confirmed by Sai et al. using rats as a model.16 Moreover, Sai et al. also demonstrated that testosterone (T) Received: Revised: Accepted: Published: 12455

June 29, 2018 October 31, 2018 October 31, 2018 October 31, 2018 DOI: 10.1021/acs.jafc.8b03407 J. Agric. Food Chem. 2018, 66, 12455−12470

Article

Journal of Agricultural and Food Chemistry Table 1. Primers Used in qRT-PCR gene names

forward primers (5′ to 3′)

reverse primers (5′ to 3′)

caspase 9 caspase 3 p53 puma CCND1 CCNE1 p21CIP CCNB1 CCNA2 Akt PLZF GDNF Stra8 HSD3B1 HSD17B3 StAR LHR β-actin

CCACTGCCTCATCATCAAC AGTTCCCGGGTGCTGTCTAT ATGCGGTTCGGGTCCAAAAT AGCAGCACTTAGAGTCGCC TGCTGCAAATGGAACTGCTT GTGGCTCCGACCTTTCAGTC CCTGGTGATGTCCGACCTG AAGGTGCCTGTGTGTGAACC GCCTTCACCATTCATGTGGAT ATGAACGACGTAGCCATTGTG CTGCGGAAAACGGTTCCTG TCCAACTGGGGGTCTACGG ACAACCTAAGGAAGGCAGTTTAC TGGACAAAGTATTCCGACCAGA AGGTTCTCGCAGCACCTTTTT GGTTCTCAGCTGGAAGACACT GCCTCAGCCGACTATCACTC TTGCTGACAGGATGCAGAAG

TGTGCCATCTCCATCAAA GCCATGGTCTTTCTGCTCAC CTAAATGGCAGTCGTTCTCTCC CCTGGGTAAGGGGAGGAGT CCACAAAGGTCTGTGCATGCT CACAGTCTTGTCAATCTTGGCA CCATGAGCGCATCGCAATC GTCAGCCCCATCATCTGCG TTGCTGCGGGTAAAGAGACAG TTGTAGCCAATAAAGGTGCCAT GTGCCAGTATGGGTCTGTCT GCCACGACATCCCATAACTTCAT GACCTCCTCTAAGCTGTTGGG GGCACACTTGCTTGAACACAG CATCGCCTGCTCCGGTAATC ACCTCGTCCCCATTCTCCTG GGAGGTTGTCAAAGGCATTAGC ACTCCTGCTTGCTGATCCACAT

Drug Treatment. The CPF was purchased from Shanghai Aladdin Bio-Chem Technology Company, Ltd. As a lipophilic molecule, the combination of serum proteins can neutralize CPF activity; therefore, the cells were transferred to a serum-free medium when given CPF treatment.22 The CPF was dissolved in dimethyl sulfoxide (DMSO), and the final concentration of DMSO did not exceed 0.1%. The incubation time for CPF (0−100 μM) treatment ranged from 0 to 24 h and is indicated in the figures. DMSO (0.1%, vehicle) was added to the control group. Cell-Proliferation Assay. The GC-1, TM4, and TM3 cells were seeded into six-well plates overnight. Cells were then treated with CPF (10, 25, or 50 μM) or the vehicle for 12 or 24 h. Subsequently, the cells were harvested with 0.25% trypsin (Gibco) for total-cell counts. The numbers of cells (N) were counted using a hemocytometer. The cell numbers were normalized and graphed as ratios of Nt/N0; the DMSO group was defined as N0, and the treatment group was defined as Nt.23 The analyses were performed in triplicate. Cell-Viability Assay. The cell viabilities of the three cell lines were detected by a Cell Counting Kit 8 (CCK-8, C0037, Beyotime Institute of Biotechnology) after CPF treatment for 12 or 24 h. The viability of the DMSO group was measured as the control. Cells in each well were cultured in serum-free culture medium containing 10 μL of CCK-8 reaction solution for 2 h at 37 °C; then, the absorbance at 450 nm was measured by a microplate reader. Each measurement was repeated three times. The data were calculated according to the following equation: cell viability (%) = [(ODtreatment − ODblank)/(ODcontrol − ODblank)] × 100%.24 Annexin-V-FLUOS and Propidium Iodide (PI) Double Staining Assay. According to the manufacturer’s instructions, the cells were harvested, washed with PBS, and then resuspended in a 500 μL of 1× binding buffer (5 μL of annexin-V-FLUOS and 5 μL of PI, Biobox). Subsequently, cells were incubated for 30 min at room temperature in the dark and analyzed by flow cytometry (BD FACSAria III, BD Biosciences). The data were analyzed using FCS Express 5.0 Software (De Novo Software). Terminal Deoxynucleotidyl Transferase (TdT) dUTP NickEnd Labeling (TUNEL) Staining. The apoptotic cells were measured using an In Situ Cell Death Detection Kit (Vazyme). 4′,6′-Diamidino2-phenylindole (DAPI, CWBIO) was used to visualize nuclei. Digital images were captured using a Nikon Eclipse 80i fluorescence microscope camera.25 Quantitative RT-PCR (qRT-PCR). TRIzol (TaKaRa) was used to collect the RNA samples from the cells after CPF treatment. qRT-PCR was carried out as previously described using the primers presented in Table 1.26

levels decreased, and there was a statistical difference between the treatment group and the control group.16 The association between metabolites of CPF and serum reproductive-hormone levels was also explored in adult men, which showed an inverse association between CPF metabolites and T concentrations.17 In addition, the effect of CPF on testicular oxidative damage was also studied. The expression levels of glutathione (GSH) and antioxidant enzymes presented a downward trend in testes of CPF-treated rats.18 Recently, research indicated that extended exposure to CPF gives rise to damage in the process of spermatogenesis, probably through interference with sex hormones and AchE-enzyme levels, thus resulting in reduction of fertility.19 Adedara et al. also proved that CPF mediated toxicity along the hypothalamic−pituitary−testicular axis in rats via activating lipid peroxidation, decreasing antioxidant-enzyme activities, and causing changes in testicular histology.20 Although the effects of CPF on male-reproduction toxicity have been detected, the mechanisms are unclear. Additionally, only the effects of CPF on the brain in F0- and F1-generation mice have been studied;6,21 other organs have not been reported. This study was designed to explore the potential mechanisms of CPF-induced toxic effects in the three most important cell types in mouse testes: the mouse-derived spermatogonial (GC1), Sertoli (TM4) and Leydig (TM3) cell lines. Additionally, for a deeper understanding of CPF toxicity in vivo, experiments involving intraperitoneal injections and dietary intake of CPF were performed on mice to detect alterations in mouse testes. These results can further extend knowledge of CPF-induced toxicity and provide a theoretical basis for the treatment of male infertility.

■

MATERIALS AND METHODS

Cell Culture. GC-1, TM4, and TM3 cells (ATCC) were cultured in high-glucose medium (Hyclone) supplemented with 10% fetal-bovine serum (FBS, Gibco) and 1% penicillin/streptomycin (Hyclone) under controlled conditions (37 °C and 5% CO2). At 90% confluence, the cells were subcultured with 0.25% trypsin (Gibco) for further experiments. The densities of the cells in the 96-well and 6-well plates were 0.8 × 104 and 20 × 104 cells, respectively. Cells were allowed to attach overnight. 12456

DOI: 10.1021/acs.jafc.8b03407 J. Agric. Food Chem. 2018, 66, 12455−12470

Article

Journal of Agricultural and Food Chemistry

Figure 1. Phenotypes of GC-1, TM4, and TM3 cells after CPF exposure for 12 or 24 h. (A) GC-1 cells treated with CPF at different concentrations for 24 h. (B) TM4 and TM3 cells treated with CPF at different concentrations for 12 h. Scale bar indicates 100 μm. PVDF membranes (Millipore).25 The membranes were stained with the reagents in a Western Bright ECL Kit and then visualized using a Bio-Rad Chemidoc. Animal Feeding. Wild-type C57BL/6 mice (6 weeks) were maintained under a controlled environment (22 ± 2 °C, 55 ± 10% humidity, 12 h reversed light−dark cycle) and fed food and water ad libitum in a pathogen-free facility. The experimental animals and procedures used in this study were approved by the Faculty Animal Policy and Welfare Committee of Northwest A&F University. The care and use of experimental animals fully complied with local animalwelfare laws, guidelines, and policies. Procedures and Experimental Groups for Intraperitoneal Injection of CPF in Mice. Previous findings have shown that CPF given orally to male rats at a dose of 17.5 mg/kg for 30 days could induce severe testicular damage.30 In addition, Sai et al. demonstrated that CPF administered orally to male rats at different dose for 90 days had adverse effects on the reproductive system.31 The daily exposure doses of CPF in developing countries like Sri Lanka is 94 000 ng/kg/ day,32 indicating that exposure levels are lower than 17.5 mg/kg. However, farmers in Sri Lanka use higher levels of CPF than what is recommended for crop protection.19 Therefore, in this study, 3, 6, and 12 mg/kg doses were selected. CPF can be absorbed by the body in different ways, including injection, ingestion, inhalation, and dermal absorption.33 Injection and oral ingestion were selected as the exposure modes in this study. For the CPF-intraperitoneal-injection experiments, animals were randomly divided into four groups that contained six mice each (a control group and three exposure groups). In the exposure groups, different doses of CPF (3, 6, and 12 mg/kg) were injected intraperitoneally into 8 week old mice once a day for 35 days (i.e., it lasted for one spermatogenic cycle). The control mice were administered an equal volume of redistilled water and DMSO. Procedures and Experimental Groups for Dietary Supplementation of CPF in Mice. For the CPF-dietary-supplementation experiments, the amounts of CPF added to the diets corresponded to doses of 3, 6, and 12 mg/kg/day according to a food consumption of approximately 5 g/day for each mouse.34 The CPF diet was administered to 8 week old male and female mice of the F0 generation

Cell-Cycle Assay. Cultures were analyzed for cell cycle after 12 or 24 h. Cells were trypsinized, washed with precooled PBS, and treated with a cell-cycle-staining kit. Finally, cells were analyzed by flow cytometry (Becton Dickinson, FACSCalibur). Data were analyzed using ModFit Software (Verity Software House). Measurement of Reactive-Oxygen-Species (ROS) Production. Intracellular ROS levels were measured by a ROS Assay Kit (S0033, Beyotime Institute of Biotechnology) following the manufacturer’s protocol. When 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) is oxidized by ROS to 2′,7′-dichlorofluorescein (DCF), higher fluorescence intensity can be observed at 530 nm. The cells were suspended with high-glucose medium containing 1 μL of DCFH-DA (final concentration was 10 μM/L) and incubated for 30 min at 37 °C in the dark. Finally, a multidetection microplate reader (Synergy HT, BioTek) was used to quantify the relative levels of fluorescence (485 nm excitation and 535 nm emission).27 Measurement of Malonaldehyde (MDA) Levels. Malonaldehyde was determined by a Lipid Peroxidation MDA Assay Kit (S0131, Beyotime Institute of Biotechnology). The cells were prepared as described in the kit instructions. The MDA concentration of each sample was evaluated by a multidetection microplate reader (SpectramMax M5) at 532 nm, using 490 nm as the control.28 Determination of Mitochondrial-Membrane Potential (MMP). The MMP (ΔΨm) was detected using a fluorescent probe: 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl benzimidazolyl carbocyanine iodide (JC-1; C2006, Beyotime Institute of Biotechnology). The increase in green-fluorescence intensity (FL1) was always accompanied by mitochondrial depolarization, which can be detected by a multidetection microplate reader.29 Western Blot. Antibodies against BAX (2772), BCL2 (3498), and p-AMPK (50081) were purchased from Cell Signaling Technology, and antibodies against p-LKB1 (sc-271924, Santa Cruz Biotechnology) and GAPDH (Cell Signaling Technology) were also employed in the experiments. The cells were washed with PBS and then lysed with RIPA (P0013B, Beyotime Institute of Biotechnology) that contained 1 mmol/L PMSF (ST506, Beyotime Institute of Biotechnology). Then, 10% SDS-PAGE was used to separate the lysates of cells, which were then transferred to 12457


Article


Figure 2. (A−C) Cell viability and (A′−C′) total cell numbers of GC-1, TM4, and TM3 cells after CPF treatment for 12 or 24 h. Values with different letters (a−d) differ significantly at P < 0.05 or P < 0.01. NS indicates no significant differences. for 80 consecutive days. The offspring (F1 generation) of F0 mice were sacrificed at the time of weaning. At the end of the treatment period, mice were subjected to a 3 h fast before being deeply anesthetized with carbon dioxide prior to being euthanized. The tissue samples of the mice were fixed in Bouin’s solution or transferred into TRIzol (TaKaRa) for molecular analysis. Hematoxylin and Eosin (H&E) Staining. Testis samples collected from mice were fixed in Bouin’s solution overnight before being dehydrated and embedded in paraffin. The 5 μm cross-sections were adhered to precoated glass slides. H&E staining of the paraffinembedded sections was conducted to observe histology.35 For the CPF-intraperitoneal-injection experiments, the samples of the control group and of the 3 and 6 mg/kg CPF injection groups were collected after 2 weeks and 35 days, and three samples were taken for each group. For the 12 mg/kg CPF injection group, sampling occurred after 2 weeks, but the mice were not in good condition after 18 days and thus were not reared for the full 35 days; instead, samples at 18 days were taken (n = 3). For the CPF-dietary-supplementation experiments, the testis samples of the control group and of the 3, 6, and 12 mg/kg/day CPF-diet-fed F0 mice were collected after 80 days of feeding. Three samples in each group were taken. The offspring (F1 generation) of the F0 mice were sacrificed at the time of weaning, and three samples were collected from each group. Statistical Analysis. Statistical treatment of the data was performed with SPSS 19.0 software using one-way ANOVA and Student’s t test. Student’s t test was used for the two-group comparisons, whereas ANOVA with Tukey’s HSD post hoc test was applied to multigroup comparisons.36 All data were expressed as the means ± standard errors (SE) of three independent experiments and were considered statistically significant when the P value was less than 0.05 (*) or 0.01 (**).

and TM3 cells at different treatment times to evaluate the toxicity of CPF. As CPF is a lipophilic molecule, the combination of CPF and serum proteins may compromise CPF activity; therefore, the cells were transferred to a serum-free medium when given CPF treatment.22 In order to avoid the negative effects of long-term serum starvation during CPF treatment, the GC-1 cells were exposed for 24 h, whereas the TM4 and TM3 cells were exposed for 12 h. Cell viability decreased with raised concentrations and prolonged treatment of CPF. Because 100 μM CPF resulted in a decrease in cell viability greater than 50% for GC-1 and TM4 cells (data not shown), 50 μM and lower concentrations were chosen for further assays in the subsequent experiments. As shown in Figure 1, a low CPF concentration (10 μM) had no obvious effect on cell morphology. Nevertheless, the shapes and density of the cells changed with raised CPF concentrations, resulting in lower cell density, cell shrinkage, round cells, and a shedding morphology. Cell viability was also assessed in this study using a CCK-8 assay. The results from the CCK-8 assay showed that the 10 and 25 μM concentrations of CPF significantly decreased the viability of GC-1 and TM4 cells, and this response was still present at higher concentrations (Figure 2A,B). The viability of TM3 cells was slightly affected by CPF (Figure 2C). To further assess the CPF-induced cytotoxicity in the three cell types, the total cell numbers were counted. Consistent with the cell-viability results, CPF (0−50 μM) concentrationdependently decreased the total cell numbers of GC-1 and TM4 cells (Figure 2A′,B′). Unlike the moderate decrease in cell viability, the total number of TM3 cells was significantly decreased with raised concentrations of CPF (Figure 2C′). CPF Promotion of Cell Apoptosis. TUNEL staining was used to assess whether cell apoptosis caused morphological changes of CPF-treated cells. The principle TUNEL is to attach

■

RESULTS CPF Induction of Morphological Changes and Cytotoxicity. The dose-responsive effects for CPF concentrations ranging from 0 to 100 μM were tested on GC-1, TM4, 12458


Article


Figure 3. TUNEL staining of (A) GC-1, (B) TM4, and (C) TM3 cell lines treated with different concentrations of CPF. Red indicates TUNELpositive cells; blue indicates nuclei (DAPI counterstaining of DNA).

dUTPs to the 3′ ends of double- and single-stranded DNA breaks using the TdT enzyme in cells.37 The 25 μM CPF concentration dramatically increased the number of TUNELpositive cells in the GC-1 cell line, and this response was still present at higher concentrations (50 μM, Figure 3A). When TM4 cells were exposed to 50 μM CPF, the number of TUNEL-

positive cells was obviously increased, compared with those of the control group and the 10 and 25 μM CPF-treated groups (Figure 3B). Nevertheless, no significant changes were observed in the TM3 cells when exposed to different concentrations of CPF (Figure 3C). The above experimental results hinted that the sensitivities of these three cell lines to CPF were different. 12459


Article


Figure 4. (A,C,E) Flow cytometry for the detection of apoptosis in (A) GC-1, (C) TM4, and (E) TM3 cells after CPF treatment. Early-apoptotic cells are in the green squares, and late-apoptotic cells are in the red squares. (B,D,F) Percentages of apoptotic cells in (B) GC-1, (D) TM4, and (F) TM3 cells after CPF treatment.

GC-1 cells were the most sensitive, followed by TM4 cells, whereas TM3 cells were the least sensitive. Subsequently, cell apoptosis was further monitored with an annexin V−PI stain followed by flow-cytometry analysis in the tested cells. The translocation of phospholipid phosphatidylserine to the outer plasma membrane was regarded as an early feature of apoptosis.25 In GC-1 cells treated with 0, 10, 25, and 50 μM CPF, the percentages of cells undergoing early apoptosis (annexin V+, PI−) were 2.635, 2.770, 2.255, and 2.880%, respectively (Figure 4A,B and Table 2). There was an upward trend in the percentages of cells undergoing late apoptosis (annexin V+, PI+) when cells were exposed to 0, 10, 25, and 50 μM CPF (10.200, 13.450, 22.400, and 32.400%, respectively; Figure 4A,B and Table 2). Unlike in GC-1 cells, no obvious changes in the percentages of cells undergoing late apoptosis (annexin V+, PI+) were observed in TM4 cells, whereas very significant increases in the percentages of cells undergoing early apoptosis (annexin V+, PI−) were detected when TM4 cells were exposed to 0, 10, 25, and 50 μM CPF (18.867, 18.800, 29.200, and 29.750%, respectively; Figure 4C,D and Table 2). For TM3 cells treated with 0, 10, 25, and 50 μM CPF, the percentages of cells undergoing early apoptosis (annexin V+,

PI−) were 3.715, 3.410, 7.005, and 10.900%, respectively (Figure 4E,F and Table 2). A very significant increasing trend in the percentages of cells undergoing late apoptosis (annexin V +/PI+) was detected when TM3 cells were exposed to 0, 10, 25, and 50 μM CPF (1.625, 1.075, 2.950, and 8.620%, respectively; Figure 4E,F and Table 2). Next, the expression of apoptosis-related genes was also detected in GC-1 and TM4 cells. The results demonstrated that the expression levels of the cell-apoptosis genes p53, puma, caspase 3, and caspase 9 had at least a 2-fold increases in both cell lines when the cells were exposed to high concentrations of CPF, compared with those in the control groups (Figures 5A and 6A). As shown in Figures 5 and 6, verification at the protein level further proved that cell apoptosis was significantly induced by CPF in GC-1 and TM4 cells. The 10 and 25 μM concentrations of CPF led to decreases in BCL2 expression, and there was noticeable change in BAX expression in GC-1 cells (Figure 5C). Importantly, the ratio of BAX/BCL2 was increased, and the expression of Caspase 9 increased when GC-1 cells were exposed to CPF (Figure 5B,C). Similarly, the ratio of BAX/ BCL2 increased in TM4 cells. In contrast to that in GC-1 cells, 12460


Article


that control the progression of cells through the cell cycle.38 In the three kinds of cells, the expression levels of the genes for p53 and the cyclin-dependent kinase inhibitor p21CIP, a product of a p53-activated gene, increased when cells were exposed to CPF (Figure 8).39,40 For GC-1 cells, decreases in the expression levels of CCND1 (encoding cyclin D1) and CCNE1 (encoding cyclin E1) were observed (Figure 8A). Furthermore, the expression levels of CCNA2 (encoding cyclin A2) and CCNB1 (encoding cyclin B1) were decreased in CPF-treated TM4 and TM3 cells (Figure 8B,C). These data suggest that CPF suppressed cell proliferation via cell-cycle arrest. CPF Upregulation of ROS Levels and Promotion of AMPK Phosphorylation. To elucidate the underlying mechanism of cell apoptosis induced by CPF, the phosphorylation of AMP-activated protein kinase (AMPK) was analyzed. The presence of p-AMPK was evaluated by a Western-blot analysis with specific antibodies of GC-1 and TM4 cells exposed to CPF at different concentrations for 12 or 24 h. As shown in Figure 9A, the 25 and 50 μM concentrations of CPF induced a significant increase in AMPK phosphorylation in GC-1 cells compared with that of the control group, whereas there was no change in the 10 μM CPF concentration group. Many environmental compounds can modify the oxidative balance, which leads to the inhibition of cell proliferation and the induction of apoptosis;41 therefore, we also detected whether CPF could affect the redox balance in GC-1 cells. ROS generation while GC-1 cells were treated with different concentrations of CPF was studied, and significant increases in cells treated with CPF were also noticed, compared with the levels in the control group (Figure 9D−F). As the reduction of MMP is often associated with apoptosis,42 MMP during CPF treatment was evaluated. The results revealed that the addition of CPF could reduce MMP in GC-1 cells (Figure 9B). Moreover, elevated MDA levels were associated with increases in the concentration of CPF (Figure 9C). These data suggested that ROS production was involved in the regulation of CPFinduced cell apoptosis. To prove whether AMPK and ROS regulated the survival of TM4 cells after CPF treatment, p-AMPK and ROS levels in TM4 cells were detected. Consistent with the results from GC-1 cells, the addition of 25 μM CPF resulted in upregulation of pAMPK (Figure 10A,B), and ROS levels also increased in TM4 cells compared with those in the control (Figure 10C). Reduction of the Cell Numbers of Testicular Seminiferous Tubules by Intraperitoneal Injection of CPF. There were no significant differences in the organ coefficients, and morphologic changes were observed in the testes in the 3 and 6 mg/kg CPF injection groups compared with those of the control group at 2 weeks and 35 days (Figure S1 and Tables S1 and S2). Interestingly, one mouse died after the intraperitoneal injection at 18 days in the 12 mg/kg group. The neural reflexes of the other mice in that group were slow, and the numbers of cells in the testicular seminiferous tubules were also decreased compared with those of the control; the percentage of damaged seminiferous tubules was 28.54% (Figure 11A,B). The qRTPCR results certified that the expression of germ-, Sertoli-, and Leydig-cell genes and apoptosis-related genes was altered in the 12 mg/kg CPF injection group (Figure 11C). These data suggested that acute toxicity from accumulation of CPF may damage male reproduction in mice. Expression Changes in Steroid-Hormone-Biosynthesis-Related Genes in F0 and F1 Mice from Dietary Supplementation of CPF. In 2006, Meeker et al. analyzed the

Table 2. Percentages of Different Stages of Cell Apoptosis in GC-1, TM4, and TM3 Cells Exposed to Different Concentrations of CPFa group DMSO CPF (10 μM) CPF (25 μM) CPF (50 μM) DMSO CPF (10 μM) CPF (25 μM) CPF (50 μM) DMSO CPF (10 μM) CPF (25 μM) CPF (50 μM)

early apoptosis (%)

late apoptosis (%)

total apoptosis (%)

GC-1 Cells 2.635 ± 0.085b 10.200 ± 0.100d 2.770 ± 0.050b 13.450 ± 0.450c

12.835 ± 0.185c 16.220 ± 0.400c

2.255 ± 0.155ab

22.400 ± 0.600b

24.655 ± 0.755b

2.880 ± 1.010a

32.400 ± 1.400a

35.280 ± 2.410a

18.867 ± 1.425b 18.800 ± 0.900b

TM4 Cells 2.480 ± 0.384b 2.185 ± 0.145b

21.947 ± 1.808b 20.985 ± 1.045b

29.200 ± 1.500a

1.610 ± 0.210b

30.610 ± 1.490a

29.750 ± 0.350a

4.995 ± 0.495a

34.745 ± 0.845a

3.715 ± 0.745c 3.410 ± 0.580c

TM3 Cells 1.625 ± 0.885b 1.075 ± 0.085b

5.340 ± 1.630c 4.485 ± 0.495c

7.005 ± 0.395b

2.950 ± 0.680b

9.955 ± 1.075b

10.900 ± 0.400a

8.620 ± 0.200a

19.520 ± 0.600a

a

Values with different letters (a−d) within the same column differ significantly at P < 0.05 or P < 0.01.

the expression of BCL2 was not influenced by CPF in TM4 cells, but there was upregulation of BAX in TM4 cells (Figure 6B). CPF Induction of Cell-Cycle Arrest. An additional study was carried out to explore the effects of CPF on the cell cycle in the three cell lines. To evaluate this action, the cell cycle was assessed by PI staining and measured by flow cytometry. For GC-1 cells, the percentage of cells in G1 phase was dosedependent and increased with increases in the CPF concentration (Figure 7A,B). The proportion of GC-1 cells in G1 phase ranged from 43.447 to 71.053% in the 10 to 50 μM CPF treatments, respectively, and that of the control group was 33.247% (Table 3). Additionally, the increased percentage of cells in G1 phase was accompanied by decreased percentages of cells in both S and G2 phases (Figure 7A,B). For TM4 cells, CPF induced S cell-cycle arrest in a concentration-dependent manner (Figure 7C,D). Exposure to CPF dramatically shuffled the cells in the cell-cycle compartments, as evidenced by a considerable accumulation of cells in S phase (19.807, 19.233, 44.880, and 52.237% with 0, 10, 25, and 50 μM CPF, respectively) and remarkable reductions in the proportions of cells in G1 phase (54.013, 56.723, 44.343, and 40.217% with 0, 10, 25, and 50 μM CPF, respectively) and G2 phase (26.180, 24.047, 10.773, and 7.550% with 0, 10, 25, and 50 μM CPF, respectively; Table 3). For TM3 cells, consist with the results for TM4 cells, a significant increase in the proportion of cells in S phase was observed with 50 μM CPF treatment (35.595%, Table 3), compared with that of the control group (11.460%). In addition, CPF resulted in a decreased proportion of G1-phase cells, although no statistically significant differences were detected at G2 phase (Figure 7E,F). In light of the above observations, the expression of the cellcycle regulators was examined in GC-1, TM4, and TM3 cells with or without CPF treatment. Cyclin is a family of proteins 12461


Article


Figure 5. qPCR and Western blots were used to detect the expression of apoptosis-related genes and proteins in CPF-treated GC-1 cells. (A) Expression of p53, puma, caspase 3, and caspase 9 in GC-1 cells after CPF treatment. (B) Expression of cleaved Caspase 9 protein in GC-1 cells. Intensity analysis of the cleaved Caspase 9 ratio was performed in ImageJ. **P < 0.01. (C) Expression of BAX and BCL2 protein detected in GC-1 cells after CPF treatment for 24 h. Intensity analysis of the BAX/BCL2 ratio was performed in ImageJ. Values with different letters (a−d) differ significantly at P < 0.05 or P < 0.01.

treatment group compared with that of the control group (Figure 12B). Figure 12C provides an overview of the effects of dietary CPF on other organs in mice. Overall, the expression of StAR, HSD3B1, and HSD17B3 decreased in the testis, spleen, and lung in the F0 generation after the mice were fed 12 mg/kg CPF for 80 days compared with that of the control group. In the kidney, the expression of HSD3B1 and HSD17B3 showed a downward trend in the CPF-treatment group compared with that of the control group, but interestingly, StAR expression levels were

association of male reproductive hormones with CPF and its metabolic product.17 In this study, the expression of steroidhormone-biosynthesis-related genes, such as StAR, HSD3B1, and HSD17B3, was detected. The results showed that the expression of these three genes was markedly reduced in the F0 generation after the mice were fed CPF for 80 days (Figure 12A). Additionally, the expression of genes that are associated with steroid-hormone synthesis, the development of germ cells, Sertoli cells, and Leydig cells, and cell proliferation and apoptosis showed a downward trend in the 12 mg/kg CPF 12462


Article


Figure 6. qPCR and Western blots were used to detect the expression of apoptosis-related genes and proteins in CPF-treated TM4 cells. (A) Expression of p53, puma, caspase 3, and caspase 9 in TM4 cells after CPF treatment. (B) Expression of BAX and BCL2 protein detected in TM4 cells after CPF treatment for 12 h. Values with different letters (a−d) differ significantly at P < 0.05 or P < 0.01.

Various stressors, including pesticides, exist in the environment and are able to cause DNA damage.45 Researchers demonstrated that the percentage of sperm with DNA damage in CPF-exposed animals was significantly higher than in the control group.1 This phenomenon was also proved by using CPF and cypermethrin combined in a rat model. Significant increases in sperm-DNA-fragmentation indices were manifested in the exposure group.46 In addition, CPF-induced DNA damage and apoptosis were observed in larval Drosophila midgut tissues, which was proved by a marked increase in the Comet parameters, namely, the tail length (mm), TM (arbitrary units), and tail DNA (%) of the exposed individuals.43 In 2015, Li et al. indicated that the addition of CPF to the culture medium induced a dramatic concentration- and time-dependent augmentation of HeLa- and HEK293-cell apoptosis, which was also accompanied by single-strand DNA breaks in CPFtreated cells compared with in the control.47 Normally, p53 plays a pivotal role in cell-cycle regulation, and the induction of apoptosis when mammalian cells are subjected to stress conditions, such as hypoxia, radiation, chemotherapeutic drugs, or DNA damage.48,49 In the process of the cell cycle, the cyclin-dependent kinase inhibitor p21CIP ( a down-

significantly elevated in the CPF-treated kidney samples compared with those in the control group. F1-generation samples were collected at the time of weaning (3 or 4 weeks). There were no significant differences in the body and tissue weights following 3 and 6 mg/kg CPF exposure for any of the mice (Table S3). Nevertheless, in 3 week old F1 mice, the expression of HSD3B1 and HSD17B3 showed a downward trend with increases in CPF concentration (Figure 13A). However, no significant differences were observed in 4 week old F1 mice (Figure 13B). Additionally, no significant differences in morphologic changes were observed using H&E staining in either F0- or F1-mouse testis tissue (data not shown).

■

DISCUSSION

Chlorpyrifos (CPF) is extensively used for various purposes. The widespread use of CPF has stimulated research on the possible existence of effects related to reproductive toxic activity.4,43,44 However, male-reproductive-toxicity mechanisms induced by CPF have not been thoroughly studied. In this study, the toxic effects of CPF in vitro and in vivo were detected. 12463


Article


Figure 7. CPF modifications to the cell-cycle distributions of (A,B) GC-1, (C,D) TM4, and (E,F) TM3 cells. Cells were exposed to CPF (10, 25, and 50 μM) or vehicle for 12 or 24 h. Cells were then stained with propidium iodide (PI) and analyzed for DNA content by flow cytometry. Values with different letters (a−d) differ significantly at P < 0.05 or P < 0.01. NS indicates no significant differences.

stream gene of p53) could be combined with a series of cyclin− cdk complexes to inhibit the activity of protein kinases, thereby arresting the cell cycle.39,40 Additionally, the p53 tumor suppressor could also mediate apoptosis through Bax transactivation, the release of mitochondrial cytochrome c, and caspase 9 activation, which is usually followed by the activation of caspases 3, 6, and 7.50 In this study, the addition of CPF to the culture medium led to decreases in cell numbers and cell viability in GC-1, TM4, and TM3 cells. The expression of p53 and p21CIP increased when testicular cells were exposed to CPF. Moreover, the expression levels of cell-apoptosis-related genes (p53, puma, caspase 3, and caspase 9) increased when GC-1 and TM4 cells were exposed to high concentrations of CPF, compared with those of the control groups. Afterward, the effect of the CPF on the cell cycle was studied. The results showed that CPF could induce G1-phase, Sphase, and S-phase arrest in GC-1, TM4, and TM3 cells, respectively. In addition, consistent with the results of flow cytometry, decreases in the expression levels of CCND1 (encoding cyclin D1) and CCNE1 (encoding cyclin E1) in GC-1 cells as well as decreases in the expression levels of CCNA2

Table 3. Cell-Cycle Distributions of GC-1, TM4, and TM3 Cells after CPF Treatmenta group DMSO CPF (10 μM) CPF (25 μM) CPF (50 μM) DMSO CPF (10 μM) CPF (25 μM) CPF (50 μM) DMSO CPF (10 μM) CPF (25 μM) CPF (50 μM)

G1 (%)

S (%)

GC-1 Cells 33.247 ± 0.964d 46.587 ± 2.222a 43.447 ± 1.191c 41.730 ± 1.168a 55.543 ± 0.987b 35.987 ± 1.698b 71.053 ± 0.919a 23.707 ± 1.669c TM4 Cells 54.013 ± 0.238a 19.807 ± 0.855c 56.723 ± 0.644a 19.233 ± 0.456c 44.343 ± 0.367b 44.880 ± 0.921b 40.217 ± 0.519c 52.237 ± 0.524a TM3 Cells 63.500 ± 0.970a 11.460 ± 0.550c 64.047 ± 0.158a 12.043 ± 0.358c 52.610 ± 0.771b 24.140 ± 0.573b 41.265 ± 0.005c 35.595 ± 0.145a

G2 (%) 20.167 ± 1.380a 14.827 ± 0.815b 8.473 ± 1.042c 5.240 ± 0.780c 26.180 ± 0.635a 24.047 ± 0.259a 10.773 ± 0.703b 7.550 ± 0.448c 25.040 ± 1.520 23.910 ± 0.219 23.253 ± 0.327 23.140 ± 0.140

a

Values with different letters (a−d) within the same column differ significantly at P < 0.05 or P < 0.01. 12464


Article


Figure 8. Gene expression of cell-cycle regulators (p21CIP, CCND1, CCNE1, CCNA2, and CCNB1) in CPF-treated (A) GC-1, (B) TM4, and (C) TM3 cells were detected using qRT-PCR. Values with different letters (a−d) differ significantly at P < 0.05 or P < 0.01.

(encoding cyclin A2) and CCNB1 (encoding cyclin B1) in both TM4 and TM3 cells were also observed. The differences in the results were related to the different cell types. These data indicated that CPF may induce DNA damage first by arresting the cell cycle, suppressing cell proliferation, and promoting cell apoptosis, until finally there is a reduction in the number of GC1, TM4, and TM3 cells. Future studies should investigate the DNA damage induced by CPF in these cells. Although no information about CPF-induced oxidative stress on testicular cells was reported, the in vivo experiments were extensive. The activation of lipid peroxidation and decreases in antioxidant-enzyme activities were observed in CPF-treated rats.20 An association between reproductive toxicity and the activities of the antioxidant enzymes catalase, superoxide dismutase (SOD), glutathione peroxidase (GPx), and glutathione S-transferase (GST), as well as glutathione (GSH) levels, have been demonstrated in rats exposed to CPF compounds.51 Consistent with this, an obvious positive correlation between ROS generation and CPF addition was detected in this study.52,53 To further examine the causes of CPF-induced oxidative stress, MMP was measured. The data indicated that CPF-mediated cell apoptosis was associated with a reduction in MMP. Lipid peroxidation is a free-radical-driven reaction that leads to membrane damage via a reaction between oxygen and polyunsaturated fatty acids.54 Previous studies also indicated that an increase in MDA content was correlated with cellularmembrane damage in exposed cells, which could then lead to cell death.55 Augmentation of MDA was detected when GC-1

cells were exposed to CPF at a dose capable of increasing the ROS production. The aforementioned results showed that the addition of CPF could promote cell apoptosis. The mechanism involved in CPFinduced cell apoptosis was also examined in this study. Numerous studies have revealed that the activation of MAPK and EGFR/ERK1/2 is involved in CPF-induced apoptosis. CPF can induce human-neuroblastoma-SH-SY5Y-cell apoptosis through the MAPK pathway.55 A recent study proved that CPF inhibits breast-cancer-MCF-7- and MDA-MB-231-cell proliferation via increases in phosphorylated ERK1/2 levels, which are mediated by oxidative stress.5 In contrast, the function of AMP-activated protein kinase (AMPK) in CPF -induced toxic reactions has not been reported. AMPK is a crucial enzyme that links energy induction with metabolic reactions, and it is also involved in regulating the processes of glycometabolism, fat metabolism, and protein metabolism and in maintaining energy homeostasis in cells.56 There are increasing indications that some types of cellular stress activate AMPK by ROS such as H2O2.56 In cultured cells, AMPK is activated by reactive oxygen species (ROS) such as H2O2. In 2008, research indicated that Britannin (Bri) could induce apoptosis in liver-cancer cell lines via AMPK activation that was regulated by ROS.57 Moreover, Chen et al. proved that hypoxia treatment triggered AMPK activation in H9c2 cells in a time-dependent manner and led to cardiomyocyte injury.58 Consistent with this, AMPK was activated when testicular cells were exposed to CPF in this study. Although this study confirmed the role of AMPK in CPF12465


Article


Figure 9. Expression of p-AMPK, mitochondrial-membrane potentials, ROS levels, and MDA levels were detected in GC-1 cells after CPF treatment. (A) Expression of p-AMPK protein in CPF-treated GC-1 cells. (B) Detection of mitochondrial-membrane potentials. (C) Detection of MDA levels. (D) Oxidative stress after CPF treated, determined using flow cytometry. (E,F) ROS levels in CPF-treated cells compared with those in the control group.

Figure 10. Expression of p-AMPK and ROS levels were detected in TM4 cells after CPF treatment. (A) Western-blot analysis of p-AMPK expression in CPF-treated TM4 cells. (B) p-AMPK-intensity analysis calculated in ImageJ. **P < 0.01. (C) Detection of ROS levels.

induced reproductive toxicity, the upstream and downstream signaling pathways of AMPK are unknown and need to be studied further. CPF inhibits AchE activity and reduces monoamine levels that are needed for adequate hypothalamic−pituitary−gonadalaxis (HPGA) activity, which in turn directs the toxicity of male hormones, induces sperm-DNA damage, and causes sperm epigenetic changes.4,17 To this point, differential expression of steroid-hormone-biosynthesis-related genes was detected in this

study between the CPF-treatment group and the control group. The data from the in vivo experiments initially demonstrated that the expression of steroid-hormone-biosynthesis-related genes in the testis, spleen, and lung of F0 mice was downregulated when there was intraperitoneal injection or dietary supplementation of CPF. It is worth noting that intraperitoneal injection of CPF in mice led to significant increasing trends in the expression of StAR in the CPF-treatment 12466


Article


Figure 11. Cell numbers in testicular seminiferous tubules reduced by intraperitoneal injection of CPF. (A) H&E staining results of mouse testes from the control group and the 12 mg/kg group after 18 days of CPF injections. Black arrows indicate the damaged cells in testicular seminiferous tubules. Scale bar indicates 100 μm. (B) Percentage of damaged seminiferous tubules. (C) Expression of germ-cell, Sertoli-cell, and Leydig-cell genes, as well as apoptosis related genes after 18 days of CPF injections.

■

group, compared with that of the control group. Nevertheless, the exact mechanism needs to be studied further. For the F1 generation, the expression of HSD3B1 and HSD17B3 showed a downward trend with increasing CPF concentrations of 3 week old mice, whereas no significant differences were observed in 4 week old F1 mice. The expression of these two genes in testis is related to the development of Leydig cells, which show an increasing tendency during the transition from progenitor Leydig cells (PLCs), around postnatal day 14, to immature Leydig cell (ILCs), around postnatal day 28.59,60 It is well-known that cells with lower differentiation degrees are more sensitive to drugs. In our study, compared with ILCs, PLCs were more sensitive to CPF. Thus, the number of PLCs decreased in 3 week old mice, which resulted in decreased expression of these two genes. In conclusion, we propose a model for the regulation of CPF for the survival of testicular cells (Figure 14). The addition of CPF to the culture medium results in a reduction in cell number and cell viability. CPF decreases the membrane potential of mitochondria, upregulates the levels of ROS and MDA, and activates the phosphorylation of AMPK, thereby arresting the cell cycle, suppressing cell proliferation, promoting cell apoptosis, and regulating the survival of testicular cells. In vivo, the expression of steroid-hormone-biosynthesis-related genes in the testes, spleens, and lungs of F0 and F1 mice was downregulated when there was intraperitoneal injection or dietary supplementation of CPF. This study improves the research on CPF in the regulation of male reproduction and provides a theoretical basis for the treatment of male infertility in the future.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Tel.: 86-13772098751. ORCID

Chuanying Pan: 0000-0002-1732-7128 Funding

This work was supported by the Key Research and Development Program of Shaanxi Province (agricultural field, No. 2017NY064) and National Natural Science Fund (regional project, No. 31760650). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED CPF, chlorpyrifos; OP, organophosphorus pesticide; AChE, acetylcholinesterase; GC-1, mouse-derived spermatogonial cell lines; TM4, mouse Sertoli cell lines; TM3, mouse Leydig cell lines; DMSO, dimethyl sulfoxide; qRT-PCR, quantitative RTPCR; ROS, reactive oxygen species; MDA, malonaldehyde; SOD, superoxide dismutase; GPx, glutathione peroxidase; pAMPK, phosphorylated AMP-activated protein kinase; DCFHDA, dichlorodihydrofluorescein diacetate; DCF, dichlorofluorescein; T, testosterone; FSH, follicle-stimulating hormone; LH, luteinizing hormone; GSH, glutathione; SHBG, sex-hormonebinding globulin; ILCs, immature Leydig cell; PLCs, progenitor Leydig cells; HPGA, hypothalamic−pituitary−gonadal axis; TUNEL, terminal deoxynucleotidyl transferase (TdT) dUTP nick-end labeling.

■

REFERENCES

(1) Babazadeh, M.; Najafi, G. Effect of chlorpyrifos on sperm characteristics and testicular tissue changes in adult male rats. Vet. Res. Forum 2017, 8, 319−326. (2) Levine, H.; Jørgensen, N.; Martino-Andrade, A.; Mendiola, J.; Weksler-Derri, D.; Mindlis, I.; Pinotti, R.; Swan, S. H. Temporal trends in sperm count: a systematic review and meta-regression analysis. Hum. Reprod. Update 2017, 23, 646−659. (3) Jenardhanan, P.; Panneerselvam, M.; Mathur, P. P. Effect of environmental contaminants on spermatogenesis. Semin. Cell Dev. Biol. 2016, 59, 126−140.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.8b03407. H&E-staining results, organ coefficients, and body and tissues weights of the F0 and F1 generation (PDF) 12467


Article


Figure 12. Expression changes of steroid-hormone-biosynthesis-related genes in F0 mice after dietary supplementation with CPF. (A) Expression of steroid-hormone-synthesis-related genes in testes of the F0 generation after the mice were fed different concentrations CPF for 80 days. (B) Expression of steroid-hormone-synthesis-related genes, proliferation- and apoptosis-related genes, and germ-cell- and Sertoli-cell-related genes in testes of the F0 generation after the mice were fed 12 mg/kg CPF for 80 days. (C) Expression of steroid-hormone-synthesis-related genes in testes, spleens, lungs, and kidneys of the F0 generation after the mice were fed 12 mg/kg CPF for 80 days. NC-Testis, testis of the control group; 12-Testis, testis of the 12 mg/kg group; and so on.

Figure 13. Expression of steroid-hormone-synthesis-related genes in testicular tissues in the F1 generation. F1-WT-3W, testicular tissue of F1generation 3 week old mice in the control group; F1-3-3W, testicular tissue of F1-generation 3 week old mice in the 3 mg/kg treatment group; and so on. (4) Mima, M.; Greenwald, D.; Ohlander, S. Environmental toxins and

phosphorylation in breast cancer cell lines. Chemosphere 2015, 120,

male fertility. Curr. Urol. Rep. 2018, 19, 50. (5) Ventura, C.; Venturino, A.; Miret, N.; Randi, A.; Rivera, E.; Núñez,

343−350. (6) Pallotta, M. M.; Ronca, R.; Carotenuto, R.; Porreca, I.; Turano,

M.; Cocca, C. Chlorpyrifos inhibits cell proliferation through ERK1/2

M.; Ambrosino, C.; Capriglione, T. Specific effects of chronic dietary 12468


Article


(15) Farag, A. T.; Radwan, A. H.; Sorour, F.; El Okazy, A.; El-Agamy, E.-S.; El-Sebae, A. E.-K. Chlorpyrifos induced reproductive toxicity in male mice. Reprod. Toxicol. 2010, 29, 80−85. (16) Sai, L.; Li, X.; Liu, Y.; Guo, Q.; Xie, L.; Yu, G.; Bo, C.; Zhang, Z.; Li, L. Effects of chlorpyrifos on reproductive toxicology of male rats. Environ. Toxicol. 2014, 29, 1083−1088. (17) Meeker, J. D.; Ryan, L.; Barr, D. B.; Hauser, R. Exposure to nonpersistent insecticides and male reproductive hormones. Epidemiology 2006, 17, 61−68. (18) Mosbah, R.; Yousef, M. I.; Maranghi, F.; Mantovani, A. Protective role of Nigella sativa oil against reproductive toxicity, hormonal alterations, and oxidative damage induced by chlorpyrifos in male rats. Toxicol. Ind. Health 2016, 32, 1266−1277. (19) Peiris, D. C.; Dhanushka, T. Low doses of chlorpyrifos interfere with spermatogenesis of rats through reduction of sex hormones. Environ. Sci. Pollut. Res. 2017, 24, 20859−20867. (20) Adedara, I. A.; Owoeye, O.; Ajayi, B. O.; Awogbindin, I. O.; Rocha, J. B. T.; Farombi, E. O. Diphenyl diselenide abrogates chlorpyrifos-induced hypothalamic-pituitary-testicular axis impairment in rats. Biochem. Biophys. Res. Commun. 2018, 503, 171−176. (21) Venerosi, A.; Tait, S.; Stecca, L.; Chiarotti, F.; De Felice, A.; Cometa, M. F.; Volpe, M. T.; Calamandrei, G.; Ricceri, L. Effects of maternal chlorpyrifos diet on social investigation and brain neuroendocrine markers in the offspring - a mouse study. Environ. Health 2015, 14, 32. (22) Lee, J. E.; Park, J. H.; Shin, I. C.; Koh, H. C. Reactive oxygen species regulated mitochondria-mediated apoptosis in PC12 cells exposed to chlorpyrifos. Toxicol. Appl. Pharmacol. 2012, 263, 148−162. (23) Zakharevich, M.; Kattan, J. M.; Chen, J. L.; Lin, B. R.; Cervantes, A. E.; Chung, D. D.; Frausto, R. F.; Aldave, A. J. Elucidating the molecular basis of PPCD: Effects of decreased ZEB1 expression on corneal endothelial cell function. Mol. Vis. 2017, 23, 740−752. (24) Yang, Z. R.; Liu, M.; Peng, X. L.; Lei, X. F.; Zhang, J. X.; Dong, W. G. Noscapine induces mitochondria-mediated apoptosis in human colon cancer cells in vivo and in vitro. Biochem. Biophys. Res. Commun. 2012, 421, 627−633. (25) Liu, T.; Chen, X.; Li, T.; Li, X.; Lyu, Y.; Fan, X.; Zhang, P.; Zeng, W. Histone methyltransferase SETDB1 maintains survival of mouse spermatogonial stem/progenitor cells via PTEN/AKT/FOXO1 pathway. Biochim. Biophys. Acta, Gene Regul. Mech. 2017, 1860, 1094−1102. (26) Chen, R.; Du, J.; Ma, L.; Wang, L. Q.; Xie, S. S.; Yang, C. M.; Lan, X. Y.; Pan, C. Y.; Dong, W. Z. Comparative microRNAome analysis of the testis and ovary of the Chinese giant salamander. Reproduction 2017, 154, 269−279. (27) Zhu, Z.; Ren, Z.; Fan, X.; Pan, Y.; Lv, S.; Pan, C.; Lei, A.; Zeng, W. Cysteine protects rabbit spermatozoa against reactive oxygen speciesinduced damages. PLoS One 2017, 12, e0181110. (28) Zhan, Y.; Gong, K.; Chen, C.; Wang, H.; Li, W. P38 MAP kinase functions as a switch in MS-275-induced reactive oxygen speciesdependent autophagy and apoptosis in human colon cancer cells. Free Radical Biol. Med. 2012, 53, 532−543. (29) Xin, H.; Liu, X. H.; Zhu, Y. Z. Herba leonurine attenuates doxorubicin-induced apoptosis in H9c2 cardiac muscle cells. Eur. J. Pharmacol. 2009, 612, 75−79. (30) Joshi, S. C.; Mathur, R.; Gulati, N. Testicular toxicity of chlorpyrifos (an organophosphate pesticide) in albino rat. Toxicol. Ind. Health 2007, 23, 439−444. (31) Sai, L.; Li, X.; Liu, Y.; Guo, Q.; Xie, L.; Yu, G.; Bo, C.; Zhang, Z.; Li, L. Effects of chlorpyrifos on reproductive toxicology of male rats. Environ. Toxicol. 2014, 29, 1083−1088. (32) Phung, D. T.; Connell, D.; Miller, G.; Chu, C. Probabilistic assessment of chlorpyrifos exposure to rice farmers in Viet Nam. J. Exposure Sci. Environ. Epidemiol. 2012, 22, 417−423. (33) Salazar-Arredondo, E.; de Jesús Solís-Heredia, M.; Rojas-García, E.; Hernández-Ochoa, I.; Quintanilla-Vega, B. Sperm chromatin alteration and DNA damage by methyl-parathion, chlorpyrifos and diazinon and their oxon metabolites in human spermatozoa. Reprod. Toxicol. 2008, 25, 455−460.

Figure 14. Schematic diagram of the regulation of CPF on the maintenance of testicular-cell-line survival in vitro. The addition of CPF to the culture medium results in a reduction of cell numbers and cell viability. Meanwhile, CPF remarkably suppresses cell proliferation, promotes the cell apoptosis, decreases the membrane potential of mitochondria, upregulates the levels of ROS and MDA, and activates the phosphorylation of AMPK, thus regulating the survival of these cells.

exposure to chlorpyrifos on brain gene expression-a mouse study. Int. J. Mol. Sci. 2017, 18, 2467. (7) Mileson, B. E.; Chambers, J. E.; Chen, W. L.; Dettbarn, W.; Ehrich, M.; Eldefrawi, A. T.; Gaylor, D. W.; Hamernik, K.; Hodgson, E.; Karczmar, A. G.; Padilla, S.; Pope, C. N.; Richardson, R. J.; Saunders, D. R.; Sheets, L. P.; Sultatos, L. G.; Wallace, K. B. Common mechanism of toxicity: a case study of organophosphorus pesticides. Toxicol. Sci. 1998, 41, 8−20. (8) Parran, D. K.; Magnin, G.; Li, W.; Jortner, B. S.; Ehrich, M. Chlorpyrifos alters functional integrity and structure of an in vitro BBB model: co-cultures of bovine endothelial cells and neonatal rat astrocytes. NeuroToxicology 2005, 26, 77−88. (9) Goel, A.; Dani, V.; Dhawan, D. K. Chlorpyrifos-induced alterations in the activities of carbohydrate metabolizing enzymes in rat liver: the role of zinc. Toxicol. Lett. 2006, 163, 235−241. (10) Howard, A. S.; Bucelli, R.; Jett, D. A.; Bruun, D.; Yang, D.; Lein, P. J. Chlorpyrifos exerts opposing effects on axonal and dendritic growth in primary neuronal cultures. Toxicol. Appl. Pharmacol. 2005, 207, 112−124. (11) Tian, Y.; Ishikawa, H.; Yamaguchi, T.; Yamauchi, T.; Yokoyama, K. Teratogenicity and developmental toxicity of chlorpyrifos. Maternal exposure during organogenesis in mice. Reprod. Toxicol. 2005, 20, 267− 270. (12) Rahman, M. F.; Mahboob, M.; Danadevi, K.; Saleha Banu, B.; Grover, P. Assessment of genotoxic effects of chloropyriphos and acephate by the comet assay in mice leucocytes. Mutat. Res., Genet. Toxicol. Environ. Mutagen. 2002, 516, 139−147. (13) Schuh, R. A.; Lein, P. J.; Beckles, R. A.; Jett, D. A. Noncholinesterase mechanisms of chlorpyrifos neurotoxicity: altered phosphorylation of Ca2+/cAMP response element binding protein in cultured neurons. Toxicol. Appl. Pharmacol. 2002, 182, 176−185. (14) Dolci, S.; Campolo, F.; De Felici, M. Gonadal development and germ cell tumors in mouse and humans. Semin. Cell Dev. Biol. 2015, 45, 114−123. 12469


Article

Journal of Agricultural and Food Chemistry (34) Venerosi, A.; Tait, S.; Stecca, L.; Chiarotti, F.; De Felice, A.; Cometa, M. F.; Volpe, M. T.; Calamandrei, G.; Ricceri, L. Effects of maternal chlorpyrifos diet on social investigation and brain neuroendocrine markers in the offspring - a mouse study. Environ. Health 2015, 14, 32. (35) Heidari, B.; Rahmati-Ahmadabadi, M.; Akhondi, M. M.; Zarnani, A. H.; Jeddi-Tehrani, M.; Shirazi, A.; Naderi, M. M.; Behzadi, B. Isolation, identification, and culture of goat spermatogonial stem cells using c-kit and PGP9.5 markers. J. Assist. Reprod. Genet. 2012, 29, 1029−1038. (36) Cui, Y.; Yan, H.; Wang, K.; Xu, H.; Zhang, X.; Zhu, H.; Liu, J.; Qu, L.; Lan, X.; Pan, C. Insertion/deletion within the KDM6A gene is significantly associated with litter size in goat. Front. Genet. 2018, 9, 91. (37) Fayzullina, S.; Martin, L. J. Detection and analysis of DNA damage in mouse skeletal muscle in situ using the TUNEL method. J. Visualized Exp. 2014, 16, 94. (38) Galderisi, U.; Jori, F. P.; Giordano, A. Cell cycle regulation and neural differentiation. Oncogene 2003, 22, 5208−5219. (39) Imamura, K.; Ogura, T.; Kishimoto, A.; Kaminishi, M.; Esumi, H. Cell cycle regulation via p53 phosphorylation by a 5′-AMP activated protein kinase activator, 5-aminoimidazole-4-carboxamide-1-beta-Dribofuranoside, in a human hepatocellular carcinoma cell line. Biochem. Biophys. Res. Commun. 2001, 287, 562−567. (40) Jones, R. G.; Plas, D. R.; Kubek, S.; Buzzai, M.; Mu, J.; Xu, Y.; Birnbaum, M. J.; Thompson, C. B. AMP-activated protein kinase induces a p53-dependent metabolic checkpoint. Mol. Cell 2005, 18, 283−293. (41) Itziou, A.; Kaloyianni, M.; Dimitriadis, V. K. Effects of organic contaminants in reactive oxygen species, protein carbonylation and DNA damage on digestive gland and haemolymph of land snails. Chemosphere 2011, 85, 1101−1107. (42) Hung, J. H.; Chen, C. Y.; Omar, H. A.; Huang, K. Y.; Tsao, C. C.; Chiu, C. C.; Chen, Y. L.; Chen, P. H.; Teng, Y. N. Reactive oxygen species mediate Terbufos-induced apoptosis in mouse testicular cell lines via the modulation of cell cycle and pro-apoptotic proteins. Environ. Toxicol. 2016, 31, 1888−1898. (43) Gupta, S. C.; Mishra, M.; Sharma, A.; Deepak Balaji, T. G.; Kumar, R.; Mishra, R. K.; Chowdhuri, D. K. Chlorpyrifos induces apoptosis and DNA damage in Drosophila through generation of reactive oxygen species. Ecotoxicol. Environ. Saf. 2010, 73, 1415−1423. (44) Eaton, D. L.; Daroff, R. B.; Autrup, H.; Bridges, J.; Buffler, P.; Costa, L. G.; Coyle, J.; McKhann, G.; Mobley, W. C.; Nadel, L.; Neubert, D.; Schulte-Hermann, R.; Spencer, P. S. Review of the toxicology of chlorpyrifos with an emphasis on human exposure and neurodevelopment. Crit. Rev. Toxicol. 2008, 38, 1−125. (45) Wilson, D. M., III; Sofinowski, T. M.; McNeill, D. R. Repair mechanisms for oxidative DNA damage. Front. Biosci., Landmark Ed. 2003, 8, d963−981. (46) Alaa-Eldin, E. A.; El-Shafei, D. A.; Abouhashem, N. S. Individual and combined effect of chlorpyrifos and cypermethrin on reproductive system of adult male albino rats. Environ. Sci. Pollut. Res. 2017, 24, 1532−1543. (47) Li, D.; Huang, Q.; Lu, M.; Zhang, L.; Yang, Z.; Zong, M.; Tao, L. The organophosphate insecticide chlorpyrifos confers its genotoxic effects by inducing DNA damage and cell apoptosis. Chemosphere 2015, 135, 387−393. (48) Wang, X. W.; Harris, C. C. p53 tumor-suppressor gene: clues to molecular carcinogenesis. J. Cell. Physiol. 1997, 173, 247−255. (49) Horn, H. F.; Vousden, K. H. Coping with stress: multiple ways to activate p53. Oncogene 2007, 26, 1306−1316. (50) Cheng, W. L.; Lin, T. Y.; Tseng, Y. H.; Chu, F. H.; Chueh, P. J.; Kuo, Y. H.; Wang, S. Y. Inhibitory effect of human breast cancer cell proliferation via p21-mediated G1 cell cycle arrest by araliadiol isolated from Aralia cordata Thunb. Planta Med. 2011, 77, 164−168. (51) Abolaji, A. O.; Ojo, M.; Afolabi, T. T.; Arowoogun, M. D.; Nwawolor, D.; Farombi, E. O. Protective properties of 6-gingerol-rich fraction from Zingiber officinale (Ginger) on chlorpyrifos-induced oxidative damage and inflammation in the brain, ovary and uterus of rats. Chem.-Biol. Interact. 2017, 270, 15−23.

(52) Fleury, C.; Mignotte, B.; Vayssière, J. L. Mitochondrial reactive oxygen species in cell death signaling. Biochimie 2002, 84, 131−141. (53) Loh, K. P.; Huang, S. H.; De Silva, R.; Tan, B. K.; Zhu, Y. Z. Oxidative stress: apoptosis in neuronal injury. Curr. Alzheimer Res. 2006, 3, 327−337. (54) Barrera, G. Oxidative stress and lipid peroxidation products in cancer progression and therapy. ISRN Oncol 2012, 2012, 137289. (55) Ziech, D.; Franco, R.; Georgakilas, A. G.; Georgakila, S.; Malamou-Mitsi, V.; Schoneveld, O.; Pappa, A.; Panayiotidis, M. I. The role of reactive oxygen species and oxidative stress in environmental carcinogenesis and biomarker development. Chem.-Biol. Interact. 2010, 188, 334−339. (56) Hardie, D. G.; Ross, F. A.; Hawley, S. A. AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 2012, 13, 251−262. (57) Cui, Y. Q.; Liu, Y. J.; Zhang, F. The suppressive effects of Britannin (Bri) on human liver cancer through inducing apoptosis and autophagy via AMPK activation regulated by ROS. Biochem. Biophys. Res. Commun. 2018, 497, 916−923. (58) Chen, X.; Li, X.; Zhang, W.; He, J.; Xu, B.; Lei, B.; Wang, Z.; Cates, C.; Rousselle, T.; Li, J. Activation of AMPK inhibits inflammatory response during hypoxia and reoxygenation through modulating JNK-mediated NF-κB pathway. Metab., Clin. Exp. 2018, 83, 256−270. (59) Oh, Y. S.; Seo, J. T.; Ahn, H. S.; Gye, M. C. Expression of cubilin in mouse testes and Leydig cells. Andrologia 2016, 48, 325−332. (60) Ye, L.; Li, X.; Li, L.; Chen, H.; Ge, R. S. Insights into the development of the adult Leydig cell lineage from stem Leydig cells. Front. Physiol. 2017, 8, 430.

12470


Chlorpyrifos Induction of Testicular-Cell Apoptosis through Generation

Recommend Documents