Comparison of different strategies for the development of highly

Subscriber access provided by Grand Valley State | University

Article

Comparison of different strategies for the development of highly sensitive electrochemical nucleic acid biosensors using neither nanomaterials nor nucleic acid amplification Víctor Ruiz-Valdepeñas Montiel, Eloy Povedano, Eva Vargas, Rebeca M. TorrenteRodríguez, María Pedrero, A. Julio Reviejo, Susana Campuzano, and Jose M. Pingarron ACS Sens., Just Accepted Manuscript • DOI: 10.1021/acssensors.7b00869 • Publication Date (Web): 28 Dec 2017 Downloaded from http://pubs.acs.org on December 28, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Sensors is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Comparison of different strategies for the development of highly sensitive electrochemical nucleic acid biosensors using neither nanomaterials nor nucleic acid amplification Víctor Ruiz-Valdepeñas Montiel, Eloy Povedano, Eva Vargas, Rebeca M. Torrente-Rodríguez, María Pedrero, A. Julio Reviejo, Susana Campuzano*‡, José M. Pingarrón*‡ Departamento de Química Analítica, Facultad de CC. Químicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain) KEYWORDS: nucleic acid-based electrochemical sensors, formats, amplification, labeling, RNA/DNA duplexes specific antibodies, ProtA-poly-HRP40, DNA concatamers

ABSTRACT: Currently, electrochemical nucleic acid-based biosensing methodologies involving hybridization assays, specific recognition of RNA/DNA and RNA/RNA duplexes, and amplification systems provide an attractive alternative to conventional quantification strategies for the routine determination of relevant nucleic acids at different settings. A particularly relevant objective in the development of such nucleic acid biosensors is the design of as much as possible affordable, quick and simple methods while keeping the required sensitivity. With this aim in mind, this work reports, for the first time, a thorough comparison between eleven methodologies that involve different assay formats and labeling strategies for targeting the same DNA. The assayed approaches use conventional sandwich and competitive hybridization assays, direct hybridization coupled to bioreceptors with affinity for RNA/DNA duplexes, multi-enzyme labeling bioreagents, and DNA concatamers. All of them have been implemented on the surface of magnetic beads (MBs) and involve amperometric transduction at screen-printed carbon electrodes (SPCEs). The influence of the formed duplex length and of the labeling strategy have also been evaluated. Results demonstrate that these strategies can provide very sensitive methods without the need for using nanomaterials or polymerase chain reaction (PCR). In addition, the sensitivity can be tailored within several orders of magnitude simply by varying the bioassay format, hybrid length or labeling strategy. This comparative study allowed us to conclude that the use of strategies involving longer hybrids, the use of antibodies with specificity for RNA/DNA heteroduplexes and labeling with bacterial antibody binding proteins conjugated with multiple enzyme molecules, provide the best sensitivity.

The development of highly sensitive electrochemical nucleic acid-based biosensors for the rapid and low-cost detection of trace amounts of target biomolecules using simple protocols and portable instrumentation is more and more required in the food and clinical fields.1 Combination of amplified DNA sensing with electrochemical transduction provides a new avenue to develop nucleic acid detection technology widely demanded for routine analysis, point-of-care (POC) and portable device applications.2,3 Different signal amplification methodologies have been reported for this purpose involving target nucleic acid amplification, nanostructured electrode surfaces, post-amplification of the signal produced by the biorecognition events and target recycling via nucleases. As it is wellknown, methods using conventional nucleic acid amplification strategies provide a high sensitivity but involve complex and expensive methodologies of restricted use by specialized personnel in central laboratories. Post-amplification strategies including the use of enzymes,4,5 metal nanoparticles,6,7 and DNA bio-barcode8-10 as amplifying labels,11-13 generally involve multiple assay steps and require the addition of many

exogenous reagents. The nuclease-based target recycling has been widely employed for amplified detection of various targets,14-19 but often suffers from false-positives which may arise during the amplification process, and the complexity of the experimental system. Therefore, it is strongly desirable to develop highly sensitive but as simple as possible electrochemical hybridization assays without the need for using such mentioned signal amplification methodologies. Recently, isothermal and enzyme-free amplification strategies such as the use of DNA concatamers20 and hybridization chain reaction (HCR)21-24 have been described as attractive tools for signal amplification owing to their significant advantages implying simple, cost-effective and isothermal operation.25-28 Other original strategies involving antibodies as biorecognition elements of RNA/DNA and RNA/RNA duplexes in a nucleotide sequence-independent manner, have been used in connection with hybridization assays. These immunological approaches are extremely interesting because they add the highly selective recognition properties of antibodies to the high intrinsic selectivity of hybridization.29,30 These strategies

1 ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

have been used mainly for miRNAs determination using labelfree29 or enzymatic labeling30-35 approaches, but very scarcely for other nucleic acid targets. Although some papers have focused on the study of some important determinants regarding the probe (length, geometry and density) and the target (length and structure redox-tag placement) sequences in electrochemical nucleic acid based sensors,36-38 there is a lack of systematic studies to compare different hybridization formats and labeling strategies that would be of great interest in guiding the development of electrochemical DNA sensors with high sensitivity and simple operation and, what is more, with no need for using nanomaterials and/or nucleic acid amplification. With this purpose, a thorough and comprehensive comparison between the analytical performance of eleven electrochemical nucleic acidbased biosensors constructed with different formats and labeling strategies, but all using magnetic beads (MBs) as solid supports to perform the affinity reaction and screen-printed carbon electrodes (SPCEs) to perform the amperometric transduction, is reported in this paper. The obtained results provide interesting information about the factors which play a major role in the resulting sensitivity of the biosensors and demonstrate the possibility of designing biosensors of simple handling meeting both the high sensitivity and the portability requirements of future biodetection systems.

Page 2 of 13

enhanced enzymatic label comprising covalent HRP homopolymer), was purchased from antibodies-online. RNA-DNA hybrid antibody (clone: D5H6) (AbRNA/DNA) from Covalab, antifluorescein (FITC) Fab Fragments conjugated with HRP (anti-FITC-POD) from Roche Diagnostics GmbH (Mannheim, Germany), and HRP-labeled antimouse IgG from Abcam were also used. The following buffer solutions, prepared with Milli-Q water (18 MW cm at 25 °C) and sterilized after their preparation to avoid RNAses degradation, were used: phosphate-buffered saline (PBS) consisting of 0.01 M phosphate buffer solution containing 137 mM NaCl and 2.7 mM KCl, pH 7.5, Tris–HCl 0.1 M, pH 7.2, and Binding and Washing buffer (B&W) consisting of 10 mM Tris–HCl solution containing 1 mM EDTA and 2 M NaCl, pH 7.5. Phosphate buffer 0.05 M, pH 6.0, and a commercial blocker casein solution (a ready-to-use, PBS solution of 1 % w/v purified casein) purchased from Thermo Scientific, were also used. All the DNA and RNA synthetic oligonucleotides used were purchased from Sigma-Aldrich and their sequence and role in each format are summarized in Table 1. All of them were reconstituted upon reception in nuclease-free water to a final concentration of 100 µM, divided into small aliquots and stored at −20 or −80 °C. All the biotinylated capture probes used (b-RNACp-24mer, b-RNACp-40mer, b-DNACp and bDNADp) were designed to be fully complementary to the synthetic target DNA (a copy of a specific region of the 851 bp Equus caballus mitochondrial DNA haplotype ID65 Dloop, partial sequence).39 Moreover, to get the optimal hybridization yield in sandwich assays, there was no gap between hybridization sites of the designed probes (b-DNACp and bDNADp) with the target.40,41 MBs modification. MBs modification was different depending on the tested format (Figure 1) using the following protocols: - Sandwich DNA/DNA hybridization formats ((1) and (2)):

EXPERIMENTAL SECTION Apparatus and electrodes. Amperometric measurements were performed with a CH Instruments (Austin, TX) model 812B potentiostat controlled by software CHI812B. Screenprinted carbon electrodes (SPCEs, DRP-110), consisting of a 4-mm diameter carbon working electrode, a carbon counter electrode and an Ag pseudo-reference electrode, and the specific cable connector (DRP-CAC) which acted as interface between the SPCEs and the potentiostat, were purchased from DropSens (Spain). All the electrochemical measurements were performed at room temperature. A neodymium magnet (AIMAN GZ) embedded in a homemade Teflon casing was used for the reproducible magnetic capture of the modifiedMBs on the surface of the SPCEs. A Bunsen AGT-9 Vortex for solutions homogenization, a Raypa steam sterilizer, a biological safety cabinet Telstar Biostar, an incubator shaker Optic Ivymen® System (Comecta S.A, Sharlab), and a magnetic particle concentrator DynaMag™-2 (123.21D, Invitrogen Dynal AS) were also employed. Reagents and Solutions. All reagents used were of the highest analytical grade. Streptavidin-modified magnetic beads (Strep-MBs, 2.8 µm Ø, 10 mg mL-1, Dynabeads M-280 Streptavidin, 11206D) were purchased from Dynal Biotech ASA. Protein G-modified magnetic beads (ProtG-MBs, 2.8 µm, 30 mg mL−1 Dynabeads Protein G) were acquired from ThermoFisher Scientific. NaCl, KCl, NaH2PO4, Na2HPO4 and Tris–HCl were purchased from Scharlab. Protein A, HRP conjugate (ProtAHRP), a high sensitivity streptavidin-horseradish peroxidase (Strep-HRP) conjugate (Ref 000000011089153001), hydroquinone (HQ), and H2O2 (30%, w/v) were purchased from Sigma-Aldrich. Ethylenediaminetetraacetic acid (EDTA) from Merck (Germany) was also used. Protein A-poly-HRP40 (ProtA-poly-HRP40), a ProtA labeled with a Poly-HRP40 (an

5 µL of the Strep-MBs suspension were dropped in 1.5 mL microcentrifuge tubes and, after two washings with 50 µL of B&W (pH 7.5) buffer, they were resuspended in 25 µL of 0.1 µM b-DNACp solution (prepared in B&W, pH 7.5, buffer) and incubated for 30 min (37 °C, 950 rpm). Thereafter, the supernatant was removed and two additional washings were carried out with 50 µL of blocker casein solution. Subsequently, the as prepared b-DNACp-MBs were resuspended in 25 µL of the synthetic target DNA solution supplemented with 0.25 µM of the b- or FITC-DNADp (prepared in blocker casein solution) and incubated for 30 min (37 ºC, 950 rpm) to allow the formation of the sandwiched duplexes onto the MBs. Thereafter, the supernatant was removed, and two washings were carried out with 50 µL of blocker casein solution. Enzymatic labeling of the captured DNA hybrid was performed by incubation with 25 µL of Strep-HRP (dil. 1/1,000) or antiFITC-HRP (dil. 1/5,000) prepared in blocker casein solution for 30 min (37 ºC, 950 rpm), depending on the type of detector probe used. - Competitive RNA/DNA formats ((3) and (4)): 0.5 µL of the Strep-MBs suspension were placed in 1.5 mL microcentrifuge tubes. After two washing steps with 50 µL of B&W (pH 7.5) buffer, they were resuspended in 25 µL of 2

ACS Paragon Plus Environment

Page 3 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

0.0025 µM b-RNACp (24 or 40-mer, prepared in B&W, pH 7.5, buffer) and incubated for 15 min (37 °C, 950 rpm). Thereafter, the supernatant was removed and two washing steps were carried out with 50 µL of blocker casein solution. Subsequently the b-RNACp-MBs were incubated for 120 min

(37°C, 950 rpm) in 25 µL of a mixture solution prepared in blocker casein solution containing the synthetic target DNA, 0.0025 µM of FITC-Target and anti-FITC-HRP (dil. 1/500) and the supernatant removed.

Table 1. Oligonucleotides used in this work Short name

Sequence 5´ → 3´

Role

Assay format

Target

ATAACACCATACCCACCTGACATGCAATATCTTATG AATGGCCTATGT

Target

All formats (1-11)

b-DNACp

Biotin-ACATAGGCCATTCATAAGATATTG

Capture probe

Sandwich (1,2) Concatamers (5) b-DNADp

CATGTCAGGTGGGTATGGTGTTAT-Biotin

Detector probe

Sandwich (1)

FITC-DNADp

CATGTCAGGTGGGTATGGTGTTAT-FITC

Detector probe

Sandwich (2)

Capture probe

Competitive (3)

Capture probe

Detection AbADN-ARN (10)

Detector probe

Capture AbADN-ARN (6)

Capture probe

Competitive (4)

Capture probe

Detection AbADN-ARN (8,9)

Detector probe

Capture AbADN-ARN (7)

Labeled target

Competitive (3,4)

b-RNACp24mer

b-RNACp40mer

FITC-Target DNADp-Janus

Biotin-ACAUAGGCCAUUCAUAAGAUAUUG

BiotinACAUAGGCCAUUCAUAAGAUAUUGCAUGUCAGGU GGGUAU ATAACACCATACCCACCTGACATGCAATATCTTATG AATGGCCTATGT-FITC CATGTCAGGTGGGTATGGTGTTATATGATGACGGCC ACT

FITC-AP1

FITC-GCACCTGGGGGAGTAAGTGGCCGTCATCAT

FITC-AP2

ACTCCCCCAGGTGCATGATGACGGCCACT-FITC

Detector probeJanus Auxiliary probe 1 Auxiliary probe 2

Concatamers (5) Concatamers (5) Concatamers (5)

Format number in brackets corresponds to that in Figure 1.

tion for 15 min (37 ºC, 950 rpm) and, subsequently, the supernatant was removed. - Formats using AbRNA/DNA as capture bioreceptor ((6) and (7)): RNA/DNA heterohybrids were formed by hybridization in homogeneous solution of the synthetic target DNA supplemented with 0.05 µM of the b-RNACp (24 or 40-mer) in PBS for 45 min (37 °C, 950 rpm). 2.5 µL of the ProtG-MBs suspension were placed in a 1.5 mL microcentrifuge tube, washed two times with 50 µL PBS and incubated for 45 min (37 ºC, 950 rpm) with 25 µL of 2 µg mL-1 AbRNA/DNA solution prepared in PBS. After removing the supernatant and performing two washing steps with 50 µL PBS, the AbRNA/DNA-MBs were incubated for 45 min (37 ºC, 950 rpm) in 25 µL of the RNA/DNA heterohybrid preincubated solution. Subsequently, the supernatant was removed and two washings were carried out with 50 µL of blocker casein solution. The enzymatic labeling of the captured heterohybrid

- Format using DNA concatamers (5): 5 µL of the Strep-MBs suspension were deposited in 1.5 mL microcentrifuge tubes. After two washing steps with 50 µL of B&W (pH 7.5) buffer, they were modified with the b-DNACp by incubation for 30 min (37 °C, 950 rpm) in 25 µL of a 0.1 µM solution (prepared in B&W, pH 7.5, buffer). Thereafter, the supernatant was removed and two washings were made with 50 µL of Tris-HCl (0.1 M, pH 7.2). DNA concatamers were formed by preparing a solution containing the synthetic target DNA, 0.05 µM DNADp-Janus, 0.1 µM FITC-AP1 and 0.1 µM FITC-AP2 in Tris-HCl and incubating for 30 min at room temperature. The b-DNACp-MBs were resuspended in 25 µL of the pre-incubated concatamers solution and incubated for 15 min (37 ºC, 950 rpm). Subsequently, the supernatant was removed and two washings were carried out with 50 µL of blocker casein solution. The enzymatic labeling was accomplished by incubation with 25 µL of anti-FITC-HRP (dil. 1/5,000) prepared in blocker casein solu3


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 13

was performed by incubating the modified MBs during 30 min (37 °C, 950 rpm) with 25 µL of a Strep-HRP solution (dil. 1/25,000, prepared in blocker casein solution). Thereafter, the supernatant was removed.

Figure 1. Schematic display of the different nucleic acid hybridization formats and labeling strategies compared in this work. - Formats using AbRNA/DNA as detector bioreceptor ((8), (9), formed in a laminar flow cabinet to avoid RNase contamina(10) and (11)): tion and prevent RNA probes degradation. Amperometric detection. In all cases, the modified MBs 5 µL of the Strep-MBs suspension were dropped in a 1.5 mL were magnetically captured on the working carbon electrode microcentrifuge tube and, after two washings with 50 µL of surface in a reproducible and stable way by pipetting 50 µL of B&W (pH 7.5) buffer, incubated for 60 min (37 °C, 950 rpm) the modified MBs suspension onto the SPCE upon allocating in 25 µL of 0.1 µM b-RNACp (24 or 40-mer) solution preit on a homemade Teflon casing with an encapsulated neopared in B&W, pH 7.5, buffer. Subsequently, the supernatant dymium magnet. Then, the SPCE/magnet holding block enwas removed, two washings with 50 µL of blocker casein semble was immersed into an electrochemical cell containing solution were carried out, and the b-RNACp-MBs was incu10 mL of 0.05 M phosphate buffer of pH 6.0 and 1.0 mM HQ bated for 30 min (37 °C, 950 rpm) in 25 µL of a solution con(prepared just before performing the electrochemical meastaining the synthetic target (prepared in blocker casein soluurement). Amperometric measurements in stirred solutions tion). Thereafter, the supernatant was removed and two addiwere made at −0.20 V vs. Ag pseudo-reference electrode. tional washing steps with 50 µL of blocker casein solution Once the background current was stabilized, 50 µL of a 0.1 M were carried out. The selective recognition of the RNA/DNA H2O2 solution were added and the generated current recorded heterohybrids captured onto the MBs and their enzymatic until the steady-state current was reached (∼ 100 s). The amlabeling were performed in a single step by incubating the perometric measurements given through the whole manuscript modified MBs during 30 min (37 ºC, 950 rpm) in 25 µL of a correspond to the difference between the steady-state and the mixture solution, prepared in blocker casein solution, contain-1 background currents and are the average of at least three repliing the AbRNA/DNA (2 µg mL ) and the corresponding enzymatcates, with the confidence intervals calculated for α = 0.05. ic labeling reagent (IgG-HRP (dil. 1/ 2,500), ProtA-HRP (dil. 1/1,000) or ProtA-poly-HRP40 (dil. 1/50). Thereafter, the supernatant was removed. Before performing the amperometric detection, all the modified-MBs were washed twice with 50 µL of blocker casein solution and re-suspended in 50 µL of 0.05 M sodium phosphate buffer solution (pH 6.0). It is worth mentioning that all the MBs manipulations carried out before the amperometric measurements were per-

RESULTS AND DISCUSSION As commented in the Introduction section, the aim of this work was to perform a systematic comparison of different hybridization formats and labeling strategies to construct electrochemical nucleic acid sensors able to exhibit high sensitivity without the need for using nanomaterials and/or nucleic acid amplification. With this purpose, we have compared eleven different nucleic acid sensing approaches implemented 4


Page 5 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

on the surface of MBs for the determination of the same target DNA (a 40-mer fragment of the mitochondrial DNA D-loop region of horse).39,42 We have examined the role played by variables such as the bioassay format, the length of the hybrid formed and the bioreagent used for the enzymatic labeling, on the analytical performance of the resulting electrochemical nucleic acid-based biosensors. A schematic display of all the strategies compared in this work is given in Figure 1. They include conventional sandwich DNA/DNA hybridization (strategies 1 and 2) and combined with DNA concatamers (5), competitive DNA/RNA (3 and 4) and direct DNA/RNA hybridization assays coupled with the use of a commercial antibody with high affinity towards RNA/DNA hybrids used both as capture (6, 7) and detector bioreceptor (8-11). Apart from evaluating the influence of the length of the hybrid formed between the target DNA and a complementary DNA or RNA probe, different labeling strategies involving the use of conventional Strep-HRP or less common labeling bioreagents such as HRP-specific labeled antibodies and bacterial antibody binding proteins conjugated with a single molecule of HRP or an homopolymer containing multiple HRP molecules were compared. Optimization of the experimental conditions. It is worth to remark that, while MBs-based formats involving the use of antibodies specific to DNA/RNA heterohybrids (formats 6-11) have been pioneering developed and fully optimized by our research group, the other evaluated strategies, involving sandwich, competitive and concatamers-hybridization formats (approaches 1-5), although described in the literature, have been optimized also in this work for the detection of the selected target DNA. The selection criterion used for these optimizations was the largest ratio between the amperometric signals measured in the presence of the target DNA (S) and in its absence (B). The tested variables and the values selected for further work regarding the optimizations carried out in this work or in previous papers are summarized in Table S1 (in the Supporting Information). As indicated in Table S1, while some experimental variables were taken from our previous works,33,35,42,43 the influence of most of them on the obtained biosensors responses has been specifically evaluated in this work. As illustrative examples, the results obtained in the optimization of the MBs amount and the concentration of b-Cp40mer immobilized onto the functionalized MBs, using the sandwich DNA/DNA (format (2)) and the competitive DNA/RNA (format (4)) hybridization formats, are shown in Figure 2. Figure 2b) shows as, in the sandwich format, for low b-Cp concentrations no significant differences were apparent between the B signals but the current measured for 5.0 nM of the target DNA increased significantly with the b-Cp concentration up to 0.1 µM, showing poor S/B ratios for larger b-Cp40mer concentrations. This behavior is most likely due to the restricted hybridization efficiency when large amounts of the b-Cp are immobilized.1,44 The similar study using the competitive format (Figure 2d)) allowed us to conclude that the optimal S/B ratio was reached at a much lower capture probe concentration. The much larger b-Cp concentration in the sandwich format is in agreement with the fact that high capture probe loading density is usually desired for a typical

sandwich assay, since more target DNA would be bound on the electrode surface. Conversely, in a competitive assay a high loading density may hinder the sensitivity.45 Since a larger amount of MBs also implies a larger amount of immobilized b-Cp, a similar trend was observed when the volume of the used MBs was optimized with the two formats (Figures 2a) and c)), showing that the sandwich configuration required a 10 times larger amount of MBs to achieve the optimal S/B ratio.

Figure 2. Influence of the Strep-MBs suspension volume (a, c) and the immobilized b-Cp concentration (b, d) on the amperometric responses obtained in the absence (B) and in the presence of 1,000 (a, b) and 5,000 (c, d) pM of the target DNA (S), as well as the resulting S/B current ratios. The nucleic acid-based biosensors were prepared using the DNA/DNA sandwich (format (2), a) and b)) and RNA/DNA competitive (format (4), c) and d)) hybridization strategies. Error bars estimated as triple of the standard deviation of three replicates. Analytical performance of the biosensing strategies and the influence of different variables involved in the bioassays. Once the experimental variables were optimized for each configuration, the analytical characteristics obtained for the determination of the synthetic target DNA were calculated for the eleven biosensing strategies evaluated. The results are summarized in Table 2. LOD and LQ values were estimated according to the 3×sb/m and 10×sb/m criteria, respectively, with sb being estimated as the standard deviation (n = 10) for the measurements made with no target DNA and m the slope value of the corresponding calibration plot constructed for target DNA standards. As it can be seen in Table 2, the reproducibility of the amperometric measurements carried out with different biosensors prepared in the same manner for the target DNA at the indicated concentration level, provided relative standard deviation (RSD) values that ranged in all cases between 2.2 and 7.5 %, thus proving the good reproducibility of all the immunoassay and amperometric transduction protocols used. In the following sections, the effect of various variables involved on the analytical performance of the biosensing strategies tested is discussed to better evaluate their performance and how they compare.

5


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 13

Table 2. Analytical characteristics obtained for the determination of the target DNA with of all the biosensors evaluated Assay format

Sandwich DNA/DNA

Competitive DNA/RNA

Concatamers

Capture AbDNA-RNA

Detector AbDNA-RNA

Enzymatic labeling

StrepHRP

anti-FITC-HRP

antiFITCHRP

Strep-HRP

IgGHRP

ProtAHRP

ProtA-HRP40

Heterohybrid size

40 bp

24 bp

40 bp

40 bp

24 bp

40 bp

40 bp

40 bp

24 bp

40 bp

Format number

(1)

(2)

(3)

(4)

(5)

(6)

(7)

(8)

(9)

(10)

(11)

r2

0.9992

0.9991

0.9935

0.9968

0.9987

0.9997

0.9991

0.9983

0.9992

0. 9987

0.998

Slope / nA nM-1

119.0 ± 1.3

4,155 ± 31

-394 ± 8

-747 ± 11

33,522 ± 432

6,752 ± 32

9,448 ± 83

23,529 ± 78

9,986 ± 80

40,629 ± 297

91,79 6± 728

Intercept / nA

86 ± 27

117 ± 13

3,101 ± 20

5,099 ± 27

31 ± 18

72 ± 4

214 ± 10

58± 13

51 ± 4

206 ± 25

244 ± 20

Amplification factor vs conventional



35

3.3

6.3

282

57

79

198

84

341

771

LR / pM

81250,000

161,000

1,4755,000

1,0415,000

1.2 - 100

9.0-250

7.3 250

1.2 100

2.5 100

1.4 250

0.39 - 75

LOD / pM

157

4.8

442

312

0.3

2.7

2.2

0.4

0.8

0.4

0.12

RSD (n=8) (Target, pM)

4.7 (25,000)

7.5 (250)

6.6 (3,000)

3.7 (3,000)

6.0 (50)

6.4 (100)

4.8 (100)

4.8 (10)

2.2 (50)

3.7 (100)

4.0 (5)

Analysis time, min

60

60

120

120

60

120

120

60

60

60

60

AntiFITCHRP

Effect of the bioassay format. The performance of the biosensors constructed using conventional sandwich and competitive hybridization assays as well as direct hybridization assays involving the use of RNA/DNA hybrids specific antibody, all of them forming 40-mer hybrids (formats (2), (4), (7) and (9), respectively) was compared. Figure 3 shows clearly as the assays using the AbRNA/DNA provided a much better S/B ratio due to the high affinity of the antibody for RNA/DNA heterohybrids.29 Moreover, data shown in Table 2 allow us to conclude that, using the same labeling strategy (anti-FITC-HRP), the sandwich configuration provided a 5-times higher sensitive than the competitive format (slope values of the respective calibration plots of 4,155 vs. 747 nA nM-1, formats (2) and (4), respectively). It is worth to mention also that a similar sensitivity was achieved using the strategies involving the AbRNA/DNA

both as capture (format (7)) and detector (format (9)) bioreceptor (slope values of the calibration plots of 9,448 vs 9,986 nA nM-1, respectively). Influence of the hybrid length. Since the length of the probe/hybridization region has shown to strongly affect the rate and efficiency of the target-probe duplex formation37,46 and, accordingly, the performance of the resulting electrochemical hybridization assays, the effect of this variable in the different formats was evaluated by comparing the results obtained using probes of 24- and 40-mer.

6


Page 7 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors Firstly, the sandwich hybridization format was employed to compare the conventional labeling using Strep-HRP and biotinylated DNA detector probes (b-DNADp, format (1)) with that using fluorescein (FITC)-labeled probes (FITC-DNADp, format (2)) and anti-FITC-HRP Fab fragments. Data in Figure 5 and Table 2 showed as the strategy involving anti-FITCHRP Fab fragments provided a much higher (35-times) sensitivity (4,155 vs 119.0 nA nM-1, formats (2) and (1), respectively) which can be attributed to the better affinity of the FITCFab fragments by FITC than that streptavidin by biotin.

Figure 3. Effect of the bioassay format on the amperometric responses obtained in the absence (B) and in the presence of 100 pM of the synthetic target DNA (S) and the resulting S/B current ratios. Error bars estimated as triple of the standard deviation of three replicates.

As it can be seen in Figure 4, the length of the hybrid showed to have a dramatic influence in the format involving the use of AbRNA/DNA as detector bioreceptor. When the AbARN/ADN is used as capture bioreceptor, the S/B ratio was slightly better using the shorter probes due to the smaller B signals. However, when the slope values of the corresponding calibration graphs are compared (Table 2), a slight higher sensitivity (1.4-times) was achieved using the longer probe (9,448 vs. 6,752 nA nM-1 for formats (6) and (7), respectively), which can be attributed to the improvement in the hybridization thermodynamics using longer linear probes.37 Nevertheless, the 2.3 times enhanced sensitivity observed when using the AbRNA/DNA as detector bioreceptor (91,796 vs. 40,629 nA nM-1 for formats (11) and (10), respectively), can be only justified if a larger number of antibodies were immobilized per single longer heterohybrid, which in turn allows for higher signal amplification. These results are consistent with those found by Qavi et al.47 where it was stated that the binding epitope of the antibody is about 6 base pairs in size. Therefore, taking into account the 16 additional nucleotides and the 6-bp binding epitope, ideally there should be 2 additional AbRNA/DNA molecules attached to each single 40 bp-heterohybrid. Influence of the enzymatic labeling. An alternative to signal amplification strategies in biosensing approaches using nanomaterials is the use of multiple labels or multi-enzyme labels.48-50 Therefore, although much less explored than in the construction of immunosensors, signal amplification can be achieved also in nucleic acid biosensing by loading larger numbers of biomolecules or multienzymes on appropriate detector bioreceptors (oligonucleotides or specific antibodies). In order to study this issue, we compared different labeling strategies in the assayed formats using both conventional enzymatic labels (such as Strep-HRP) and other, less explored in nucleic acid biosensing, such as specific antibody fragments and secondary antibodies conjugated with an enzyme molecule or bacterial antibody binding proteins, able to bind the Fc region of a wide range of immunoglobulins,51,52 conjugated with a single enzyme molecule or a homopolymer containing multiple enzyme units.

Figure 4. Effect of the RNA/DNA heterohybrid length formed in different formats on the amperometric responses obtained in the absence (B) and in the presence of 50 (formats (6), (7), (10) and (11)) and 5,000 (formats (3) and (4)) pM of the synthetic target DNA (S) as well as the resulting S/B current ratios. Error bars were estimated as triple of the standard deviation of three replicates.

Figure 5. Effect of the labeling strategies used in the conventional sandwich hybridization formats ((1) and (2)) and in the methods involving the use of AbRNA/DNA as detector bioreceptor ((8), (9) and (11)) on the amperometric responses obtained in the absence (B) and in the presence of 50 (formats (8), (9) and (11)) and 1,000 (formats (1) and (2)) pM of the synthetic target DNA (S) and the resulting S/B current ratios. 7


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 13

Figure 6. Schematic display showing the spacing between the enzymatic labels in the strategies involving the use of DNA concatamers (format (5)) and the AbRNA/DNA further labeled with ProtA-poly-HRP40 (format (11)). These results suggest that antibodies conjugated with enzymes are more favorable for labeling than enzymatic conjugates of streptavidin when conventional sandwich formats involving probes labeled with small molecules (biotin and FITC) are used. Furthermore, the use of AbRNA/DNA as detector bioreceptor and secondary antibodies led to a more sensitive method than that involving bacterial antibody binding protein. In addition, the comparison of ProtA-HRP vs. ProtA-poly-HRP40 confirmed the remarkably improvement in sensitivity achieved using bioreagents conjugated with multiple enzyme units. In conclusion, the possibility of using secondary antibodies labeled with multiple units of enzyme such as mouse IgG Ab conjugated with HRP homopolymers deserves to be explored. Results obtained in the comparison of AbRNA/DNA labeling between three auxiliary DNA probes: a detector probe with secondary antibodies or bacterial antibody binding pro(DNADp-Janus) and two FITC-labeled probes, FITC-AP1 and teins conjugated with a single HRP molecule or with a polyFITC-AP2. Figure 6 shows as the AP1 hybridized with mer containing multiple HRP molecules, showed that a 2.4 DNADp-Janus and two different regions of the AP2. As a higher sensitivity was attained using the secondary antibody result, a cascade of hybridization events between alternating compared to the bacterial antibody binding protein (23,529 vs. AP1 and AP2 led to the formation of a typical one9,986 nA nM-1) with the bioreceptors were modified with a dimensional linear DNA concatamer, which contained the single enzyme molecule (formats (8) and (9), respectively). dangling fragments (FITC moieties at the 5´- and 3´-ends of This enhanced sensitivity can be attributed again to a better AP1 or AP2, respectively) flanked on the concatamer. The affinity of the secondary antibody than the bacterial antibody generated nicked double helices bore a large number of FITC binding protein for the AbRNA/DNA. Moreover, the comparison molecules thus allowing the capture of multiple anti-FITCof the results obtained with ProtA-HRP (format (9)) vs. ProtAHRP Fab fragments in a highly ordered way and, subsequentpoly-HRP40 (format (11)) showed, as expected, an enhanced ly, an efficient amplification of the measured electrochemical amplification (9.2) due to the increased number of enzyme signal.24 The DNADp-Janus was designed to be complementags per binding event using ProtA-poly-HRP40. However, it tary both to the dangling fragment of AP1 (at its 3´-end) and is important to note that this amplification factor is lower than the target DNA (at its 5´-end). Therefore, the DNADp-Janus played bridge role between the target DNA and the DNA that expected (∼40 considering the number of HRP molecules concatamer. Although linear DNA concatamers might be in the poly-HRP40 homopolymer), which can be attributed to produced in solution by self-assembly of AP1 and AP2 or a less efficient labeling of the AbRNA/DNA due to steric hinAP1, AP2 and DNADp-Janus, respectively, they could not be drance. On the other hand, the performance of signal amplifieffectively linked to the b-DNACp-modified MBs surface in cation strategies achieved by labeling the 40 mer-RNA/DNA the absence of target DNA. Only in the presence of the target heterohybrid with ProtA-poly-HRP40 or by incorporating DNA, with one of its ends hybridized with the b-DNACp multiple enzyme molecules at fixed positions using bioreaimmobilized on the MBs and the other with DNADp-Janus, gents conjugated with just one enzyme molecule (anti-FITCthe linear concatamer was attached to the surface of the bHRP) but enlarging artificially the initial RNA/DNA heteroDNACp-MBs.1 hybrid with linear DNA concatamers as carriers1,20 were also compared. The linear DNA concatamer was formed in a single-step by homogeneous hybridization chain reaction (HCR) 8


Page 9 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Figure 7. Comparison of the calibration plots constructed for the determination of the target DNA using signal amplification strategies based on the use of bioreagents modified with multiple enzyme molecules (a) and the use of DNA concatamers as carriers for signaling elements (b). Table 3. Comparison of the amplification factors achieved the signaling molecules density in HCR has been claimed to using multiple enzyme molecules and DNA concatamers be beneficial for amplification efficiency.24 Overall comparison of the different formats’ analytical Amplification Format Slope, nA nM-1 characteristics. Figure 8 compares the amperometric signals factor and the resulting S/B current ratios for the most representative formats. In addition, Table 2 summarizes the amplification ProtA-HRP (9) 9,986 ± 80 factors achieved with each strategy with respect to the conven9.2 tional sandwich hybridization assay (format 1). It is important ProtA-poly91,796 ± 728 to note that all the tested strategies, except for the competitive HRP40 (11) one, result in enhanced electrochemical responses when compared to the conventional sandwich strategy, providing ampliFITC-Dp (Sand4,155 ± 31 fication factors ranging from 3.3 to 771. Moreover, except the wich) (2) competitive format for which the LOD is 65 times higher (312 8.1 vs. 4.8 pM, formats 4 vs. 2, respectively), all other tested FITC33,522 ± 432 strategies provided LODs between 58 (format 6) and 1,308 Concatamers (5) times (format 11) lower than the sandwich assay. It is also Comparative results are shown in Figure 7 and summarized worth mentioning that the most attractive strategies (formats 5, in Table 3. As expected, both amplification strategies signifi8 and 11) required the same assay time (1 h) than the convencantly improved the sensitivity when compared with the contional sandwich hybridization approach. trol methodologies. According with the presence of two FITC A detailed comparison of the results shows that the most molecules per AP1/AP2 hybrid, the resulting amplification sensitive strategies are those using specific antibodies as defactor, 8.1, is consistent with a DNA concatamer comprising 4 tection bioreceptors. This can be attributed to the small size of AP1/AP2 hybrids (4 HCR cycles). However, the amplification the AbRNA-DNA binding epitope, of the order of 6 base pairs,47 factor achieved with the ProtA-poly-HRP40, although signifiwhich allowed that more antibodies recognized the same hycant, was lower than the one that could be expected considerbrid and open the possibility of modifying the sensitivity of ing that there should be 40 HRP molecules per conjugate the assay by varying the length of the heterohybrid. Obtained linked to each of the 4 or 6 AbRNA/DNA antibodies attached to a results demonstrate also the great influence of the strategy and single 24 or 40-mer RNA/DNA heterohybrid, respectively. bioreagent used for the heteroduplex enzymatic labeling. These results can only be explained if there were lesser ProtARegarding the compared amplification strategies, both the poly-HRP40 units attached per RNA/DNA heterohybrid. We use of AbRNA/DNA as detector bioreceptor along with bioreagent hypothesize that the proximity of AbRNA-DNA immobilized to conjugated with multiple enzyme units, and the use of DNA the duplex together with the big size of the ProtA-poly-HRP40 concatamers improved significantly the sensitivity of the ashindered the recognition of the antibodies by the bacterial say. However, the use of specific antibodies towards homo protein. Indeed, just a 2.6 higher sensitivity was achieved (DNA/DNA and RNA/RNA) or hetero (RNA/DNA) duplexes using ProtA-poli-HRP40 compared with DNA concatamers, further labeled with appropriate bioreagents can be considered which can be attributed to a more efficient labeling of the to provide a higher versatility for amplification through varyFITC molecules in this latter case as result of the wider spacing the length of the heterohybrid, the labeling reagent and the ing between them and the smaller size of the anti-FITC-HRP Fab fragments (see Figure 6). Actually, this precise control of 9


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

spacing between the antibodies attached to the duplex by using antibodies with binding epitopes of different base pair size.

Page 10 of 13

labeling. Therefore, such a route offers great promise for ultrasensitive detection of relevant target DNA or RNA with no need for using nanomaterials or nucleic acid amplification strategies. Moreover, unlike other amplification schemes, the presented routes do not require release of internal markers from encapsulating carriers. Results suggest also that the successful realization of new signal amplification strategies will require proper attention to issues such as the spacing and density of moieties to be labeled at the duplexes and the size of multiple enzymeslabeling bioreagents. All in all, the reported results highlight the broad usefulness of the tested strategies to design very sensitive DNA/RNA biosensing methodologies without the use of nanomaterials and PCR amplification. It is worth to remark also that these strategies can be extended to other enzyme tracers or redox markers and find also interesting utility with other transduction techniques (impedimetric, piezoelectric, optical, microgravimetric).

Figure 8. Comparison of the amperometric signals obtained in the absence (B) and in the presence of 75 pM of the synthetic target DNA (S) using biosensors fabricated with the formats indicated between parenthesis. Error bars were estimated as triple of the standard deviation of three replicates.

ASSOCIATED CONTENT Supporting Information. A table containing the optimized experimental conditions and related references is supplied as Supporting Information (pdf). This material is available free of charge via the Internet at http://pubs.acs.org.

Moreover, DNA biosensing demands, apart from sensitivity and simplicity, high selectivity and feasibility for application in complex samples. In this context, it is important to note that the strategies 6 to 11), optimized and compared in terms of sensitivity in this work, exhibit also attractive performance to accomplish selective determinations in scarcely pretreated complex samples. Regarding selectivity, although involving different probe and target nucleic acids, the strategies involving the use of AbRNA/DNA as capture33 or detector35 bioreceptor demonstrated to provide amperometric responses for 2 and 3 mismatches sequences similar than those recorded for a fully non-complementary sequence or in the absence of target nucleic acid. In addition, 1-m sequences gave 48-65 % of the response provided by the target nucleic acid (depending on the 1-m position). These strategies demonstrated also successful applicability for the determination of the endogenous content of the target nucleic acid without apparent matrix effect in complex samples such as total RNA extracted from cells and human tumor tissues,33,35 total extracted horse mitochondrial DNA (∼16,660 bp in length) without fragmentation and raw mitochondrial lysates 1:1 diluted with a buffer solution.42

AUTHOR INFORMATION Corresponding Authors *E-mail: [email protected]. *E-mail: [email protected].

ORCID María Pedrero: 0000-0002-2047-396X A. Julio Reviejo: 0000-0002-3626-9154 Susana Campuzano: 0000-0002-9928-6613 José M. Pingarrón: 0000-0003-2271-1383

Author Contributions The manuscript was written through contributions of all authors. V.R.-V.M., E.P., E.V. and R.M.T.-R. performed research. S.C. and J.M.P. designed the experiments. M.P., A.J.R., S.C., and J.M.P. wrote the manuscript. All authors have given approval to the final version of the manuscript. ‡These authors contributed equally.

CONCLUSIONS

Notes

The comparison performed in this paper of the analytical performance of eleven different biosensing strategies targeting the same DNA and in connection with the use of specific nucleic acid probes, MBs and SPCEs demonstrates the relevant role played by experimental variables involved in the assay design such as the chosen assay format, the length of the hybrid formed, the use of specific duplexes bioreceptors and the labeling strategy (space between moieties to label and size of the labeling bioreagent) to tailor the resulting sensitivity in more than three orders of magnitude. Signal amplification using AbRNA/DNA and ProtA-polyHRP40 for labeling 40bp-RNA/DNA heteroduplexes has been shown to yield higher sensitivity with a large amplification factor (771 improved sensitivity) in comparison with the conventional sandwich hybridization strategy and Strep-HRP

The authors declare no competing financial interest.

ACKNOWLEDGMENT The financial support of the Spanish Ministerio de Economía y Competitividad, CTQ2015-64402-C2-1-R Research Project and the NANOAVANSENS Program from the Comunidad de Madrid (S2013/MT-3029) and predoctoral contracts from the Spanish Ministerio de Economía y Competitividad (R.M. TorrenteRodríguez and E. Povedano) and Universidad Complutense de Madrid (V. Ruiz-Valdepeñas Montiel) are also gratefully acknowledged.

REFERENCES 10


Page 11 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors concatamers for signal amplification. Electrochem. Commun. 2015, 60, 185–189. (21) Wang, X.; Lau, C.; Kai, M.; Lu, J. Hybridization chain reaction-based instantaneous derivatization technology for chemiluminescence detection of specific DNA sequences. Analyst 2013, 138, 2691– 2697. (22) Ge, Z.; Lin, M.; Wang, P.; Pei, H.; Yan J.; Shi, J.; Huang, Q.; He, D.; Fan, C.; Zuo, X. Hybridization chain reaction amplification of microRNA detection with a tetrahedral DNA nanostructure-based electrochemical biosensor. Anal. Chem. 2014, 86, 2124–2130. (23) Zhai, Q.; He, Y.; Li, X.; Guo, J.; Li, S.; Yi, G. A simple and ultrasensitive electrochemical biosensor for detection of microRNA based on hybridization chain reaction amplification. J. Electroanal. Chem. 2015, 758, 20–25. (24) Torrente-Rodríguez, R.M.; Campuzano, S.; Ruiz-Valdepeñas Montiel, V.; Montoya, J.J.; Pingarrón, J.M. Sensitive electrochemical determination of miRNAs based on a sandwich assay onto magnetic microcarriers and hybridization chain reaction amplification. Biosens. Bioelectron. 2016, 86, 516–521. (25) Dirks, R.M.; Pierce, N.A. Triggered amplification by hybridization chain reaction, Proc. Nat. Acad. Sci. U.S.A. 2004,101, 15275– 15278. (26) Chen, X.; Hong, C.Y.; Lin, Y.H.; Chen, J.H.; Chen, G.N.; Yang, H.H. Sensitive DNA-based electrochemical strategy for trace bleomycin detection. Anal. Chem. 2012, 84, 8277–8283. (27) Liu, P.; Yang, X.; Sun, S.; Wang, Q.; Wang, K.; Huang, J.; Liu, J.; He, L. Isothermal DNA amplification coupled with DNA nanosphere-based colorimetric detection. Anal. Chem. 2013, 85, 7689–7695. (28) Q. Xu, G. Zhu, C.Y. Zhang. Homogeneous bioluminescence detection of biomolecules using target-triggered hybridization chain reaction-mediated ligation without luciferase label. Anal. Chem. 2013, 85, 6915–6921. (29) Tran, H.V.; Piro, B.; Reisberg, S.; Duc, H.T.; Pham, M.C. Antibodies directed to RNA/DNA hybrids: an electrochemical immunosensor for microRNAs detection using graphene-composite electrodes. Anal. Chem. 2013, 85, 8469−8474. (30) Campuzano, S.; Yánez-Sedeño, P.; Pingarrón, J.M. Electrochemical biosensing of microribonucleic acids using antibodies and viral proteins with affinity for ribonucleic acid duplexes. Electrochim. Acta 2017, 230, 271–278 (31) Tran, H.V.; Piro, B.; Reisberg, S.; Nguyen, L.H.; Nguyen, T.D.; Duc, H.T.; Pham, M.C. An electrochemical ELISA-like immunosensor for miRNAs detection based on screen-printed gold electrodes modified with reduced graphene oxide and carbon nanotubes. Biosens. Bioelectron. 2014, 62, 25−30. (32) Wang, M.; Li, B.; Zhou, Q.; Yin, H.; Zhou, Y.; Ai, S. Labelfree, ultrasensitive and electrochemical immunosensing platform for microRNA detection using anti-DNA:RNA hybrid antibody and enzymatic signal amplification. Electrochim. Acta 2015, 165, 130−135. (33) Torrente-Rodríguez, R.M.; Ruiz-Valdepeñas Montiel, V.; Campuzano, S.; Fachardo-Dinia, M.; Barderas, R.; San SegundoAcosta, P.; Montoya, J.J.; Pingarrón, J.M. Fast electrochemical miRNAs determination in cancer cells and tumor tissues with antibodyfunctionalized magnetic microcarriers. ACS Sensors 2016, 1, 896−903. (34) Torrente-Rodríguez, R.M.; Campuzano, S.; Ruiz-Valdepeñas Montiel, V.; Sagrera, A.; Domínguez-Cañete, J.J.; Vargas, E.; Montoya, J.J.; Granados, R.; Sánchez-Puelles, J.M.; Pingarrón J.M. Electrochemical miRNAs determination in formalin-fixed, paraffinembedded breast tumor tissues association with HER2 expression, JSM Biotechnol. Bioeng., 2016, 3(4), 1064. (35) Vargas, E.; Torrente-Rodríguez, R.M.; Ruiz-Valdepeñas Montiel, V.; Povedano, E.; Pedrero, M.; Montoya, J.J.; Campuzano, S.; Pingarrón, J.M. Magnetic beads-based sensor with tailored sensitivity for rapid and single-step amperometric determination of miRNAs. Int. J. Mol. Sci. 2017, 18, 2151; doi:10.3390/ijms18112151.

(1) Liu, S.F.; Lin, Y.; Liu, T.; Cheng, C.B.; Wei, W.J.; Wang, L.; Li, F. Enzyme-free and label-free ultrasensitive electrochemical detection of DNA and adenosine triphosphate by dendritic DNA concatamer-based signal amplification, Biosens. Bioelectron. 2014, 56, 12–18. (2) Wang, Y.; He, X.; Wang, K.; Ni, X.; Su, J.; Chen, Z. Ferrocene-functionalized SWCNT for electrochemical detection of T4 polynucleotide kinase activity. Biosens. Bioelectron. 2012, 32, 213−218. (3) A.-C. Lee, D. Du, B. Chen, C.-K. Heng, T.-M. Lim, Y. Lin, Electrochemical detection of leukemia oncogenes using enzymeloaded carbon nanotube labels. Analyst 2014, 139, 4223–4230. (4) Patolsky, F.; Lichtenstein, A.; Willner, I. Detection of singlebase DNA mutations by enzyme-amplified electronic transduction. Nat. Biotechnol. 2001, 19, 253–257. (5) Liu, G.; Wan, Y.; Gau, V.; Zhang, J.; Wang, L.; Song, S.; Fan, C. An enzyme-based E-DNA sensor for sequence-specific detection of femtomolar DNA targets. J. Am. Chem. Soc. 2008, 130, 6820– 6825. (6) Numnuam, A.; Chumbimuni–Torres, K.Y.; Xiang, Y.; Bash, R.; Thavarungkul, P.; Kanatharana, P.; Pretsch, E.; Wang, J.; Bakker, E. Potentiometric detection of DNA hybridization. J. Am. Chem. Soc. 2008, 130, 410–411. (7) Liao, W.C.; Ho, A.H. Attomole DNA electrochemical sensor for the detection of Escherichia coli O157. Anal. Chem. 2009, 831, 2470–2476. (8) Stoeva, S.I.; Lee, J.-S.; Smith, J.E.; Rosen, S.T.; Mirkin, C.A. Multiplexed detection of protein cancer markers with biobarcoded nanoparticle probes. J. Am. Chem. Soc. 2006, 128, 8378–8379. (9) Li, D.; Song, S.P.; Fan, C.H. Target-responsive structural switching for nucleic acid-based sensors. Acc. Chem. Res. 2010, 43, 631–641. (10) Li, H.; Sun, Z.; Zhong, W.; Hao, N.; Xu, D.; Chen, H.Y. Ultrasensitive electrochemical detection for DNA arrays based on silver nanoparticle aggregates. Anal. Chem. 2010, 82, 5477–5483. (11) Comstock, M.J.; Ha, T.; Chemla, Y.R. Ultrahigh-resolution optical trap with single-fluorophore sensitivity. Nat. Methods 2011, 8, 335–340. (12) Sorgenfrei, S.; Chiu, C.Y.; Gonzalez, Jr, R.L.; Yu, Y.-J.; Kim, P.; Nuckolls, C.; Shepard, K.L. Label-free single-molecule detection of DNA-hybridization kinetics with a carbon nanotube field-effect transistor. Nat. Nanotechnol. 2011, 6, 126–132. (13) Qiu, L.; Qiu, L.; Wu, Z.S.; Shen, G.; Yu, R.Q. Cooperative amplification-based electrochemical sensor for the zeptomole detection of nucleic acids. Anal. Chem. 2013, 85, 8225–8231. (14) Zuo, X.; Xia, F.; Xiao, Y.; Plaxco, K.W. Sensitive and selective amplified fluorescence DNA detection based on Exonuclease IIIaided target recycling. J. Am. Chem. Soc. 2010, 132, 1816–1818. (15) Wu, D.; Yin, B.C.; Ye, B.C. A label-free electrochemical DNA sensor based on exonuclease III-aided target recycling strategy for sequence-specific detection of femtomolar DNA. Biosens. Bioelectron. 2011, 28, 232–238. (16) Freeman, R.; Liu, X.; Willner, I. Amplified multiplexed analysis of DNA by the Exonuclease III-catalyzed regeneration of the target DNA in the presence of functionalized semiconductor quantum dots. Nano Lett. 2011, 11, 4456–4461. (17) Cao, Y.; Zhu, S.; Yu, J.; Zhu, X.; Yin, Y.; Li, G. Protein detection based on small molecule-linked DNA. Anal. Chem. 2012, 84, 4314–4320. (18) Ji, H.; Yan, F.; Lei, J.; Ju, H. Ultrasensitive electrochemical detection of nucleic acids by template enhanced hybridization followed with rolling circle amplification. Anal. Chem. 2012, 84, 7166– 7171. (19) Xu, Q.; Cao, A.; Zhang, L.F.; Zhang, C.Y. Rapid and labelfree monitoring of Exonuclease III-assisted target recycling amplification. Anal. Chem. 2012, 84, 10845–10851. (20) Li, C.; Liu, Z.; Cai, S.; Wen, F.; Wu, D.; Liu, Y.; Wu, F.; Lan, J.; Han, Z.; Chen, J. An electrochemical microRNA biosensor based on protein p19 combining an acridone derivate as indicator and DNA

11


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 13

beads assembled on disposable DNA sensing scaffolds. Sens. Actuator B-Chem. 2017, 245, 895−902. (44) Zouari, M.; Campuzano, S.; Pingarrón, J.M.; Raouafi, N. Competitive RNA-RNA hybridization-based integrated nanostructured-disposable electrode for highly sensitive determination of miRNAs in cancer cells. Biosens. Bioelectron. 2017, 91, 40−45. (45) Wang, W.; Kong, T.; Zhang, D.; Zhang, J.; Cheng, G. LabelFree MicroRNA Detection based on fluorescence quenching of gold nanoparticles with a competitive hybridization. Anal. Chem. 2015, 87, 10822–10829. (46) Liu, W.-T.; Guo, H.; Wu. J.-H. Effects of target length on the hybridization efficiency and specificity of rRNA-based oligonucleotide microarrays. Appl. Environ. Microb. 2007, 73, 73–82. (47) Qavi, A.J.; Kindt, J.T.; Gleeson, M.A.; Bailey, R.C. AntiDNA:RNA antibodies and silicon photonic microring resonators: increased sensitivity for multiplexed microRNA detection. Anal. Chem. 2011, 83, 5949–5956. (48) Munge, B.; Liu, G.; Collins, G.; Wang, J. Multiple enzyme layers on carbon nanotubes for electrochemical detection down to 80 DNA copies. Anal. Chem. 2005, 77, 4662–4666. (49) Mani, V.; Chikkaveeraiah, B.V.; Patel, V.; Gutkind, J.S.; Rusling, J.F. Ultrasensitive immunosensor for cancer biomarker proteins using gold nanoparticle film electrodes and multienzymeparticle amplification. ACS Nano. 2009, 3, 585–594. (50) Chikkaveeraiah, B.V.; Bhirde, A.; Morgan, N.Y.; Eden, H.S.; Chen, X. Electrochemical immunosensors for detection of cancer protein biomarkers. ACS Nano 2012, 28, 6546–6561. (51) Valat, C.; Limoges, B.; Huet, D.; Romette, J.-L. A disposable Protein A-based immunosensor for flow-injection assay with electrochemical detection. Anal. Chim. Acta 2000, 404, 187–194. (52) Akram, M.; Stuart, M.C.; Wong, D.K.Y. Direct application strategy to immobilise a thioctic acid self-assembled monolayer on a gold electrode. Anal. Chim. Acta 2004, 504, 243–251.

(36) Ricci, F.; Lai, R.Y.; Heeger, A.J.; Plaxco, K.W., Sumner, J.J. Effect of molecular crowding on the response of an electrochemical DNA sensor. Langmuir 2007, 23, 6827−6834. (37) Lubin, A.A.; Hunt, B.V.S.; White, R.J.; Plaxco K.W. Effects of probe length, probe geometry, and redox-tag placement on the performance of the electrochemical E-DNA sensor. Anal. Chem. 2009, 81, 2150–2158. (38) Esteban Fernández de Ávila, B.; Watkins, H.M.; Pingarrón, J.M.; Plaxco, K.W.; Palleschi, G.; Ricci, F. Determinants of the detection limit and specificity of surface-based biosensors. Anal. Chem. 2013, 85, 6593−6597. (39) Ishida, N.; Hasegawa, T.; Takeda, K.; Sakagami, M.; Onishi, A.; Inumaru, S.; Komatsu, M.; Mukoyama, H. Polymorphic sequence in the D-loop region of equine mitochondrial DNA. Anim. Genet. 1994, 25, 215–221. (40) Liao, J.C.; Mastali, M.; Li, Y.; Gau, V.; Suchard, M.A.; Babbitt, J.; Gornbein, J.; Landaw, E.M.; McCabe, E.R.B.; Churchill, B.M.; Haake, D.A. Development of an advanced electrochemical DNA biosensor for bacterial pathogen detection. J. Mol. Diagn. 2007, 9, 158−168. (41) Bettazzi, F.; Lucarelli, F.; Palchetti, I.; Berti, F.; Marrazza, G.; Mascini, M. Disposable electrochemical DNA-array for PCR amplified detection of hazelnut allergens in foodstuffs. Anal. Chim. Acta 2008, 614, 93–102. (42) Ruiz-Valdepeñas Montiel, V.; Gutiérrez, M.L.; TorrenteRodríguez, R.M.; Povedano, E.; Vargas, E.; Reviejo, A.J.; Linacero, R.; Gallego, F.J.; Campuzano, S.; Pingarrón, J.M. Disposable amperometric polymerase chain reaction-free biosensor for direct detection of adulteration with horsemeat in raw lysates targeting mitochondrial DNA. Anal. Chem. 2017, 89, 9474−9482. (43) V. Ruiz-Valdepeñas Montiel, R.M. Torrente-Rodríguez, G. González de Rivera, A.J. Reviejo, C. Cuadrado, R. Linacero, F.J. Gallego, S. Campuzano, J.M. Pingarrón. Amperometric determination of hazelnut traces by means of Express PCR coupled to magnetic

12


Page 13 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors “for TOC only”

Optimization, characterization and comparison of eleven nucleic acid-based hybridization approaches implemented on the surface of MBs, involving different formats, probe lengths, enzymatic labeling strategies and amperometric detection at SPCEs, for the determination of the same target DNA, to develop simple nucleic acid based sensors with improved and tailored sensitivity, free of nanomaterials or nucleic acid-based amplification strategies


13

Comparison of different strategies for the development of highly

Recommend Documents