Conjugates of Oligonucleotides with Triplex ... - ACS Publications

The T-cell immune response is mediated by the binding of interleukin 2 to its high-affinity receptor (the α chain associated with the β and/or γ ch...
0 downloads 0 Views 362KB Size
Download PDF
Bioconjugate Chem. 1997, 8, 15−22

15

Conjugates of Oligonucleotides with Triplex-Specific Intercalating Agents. Stabilization of Triple-Helical DNA in the Promoter Region of the Gene for the r-Subunit of Interleukin 2 (IL-2Rr) Gail C. Silver,† Chi Hung Nguyen,‡ Alexandre S. Boutorine,† Emile Bisagni,‡ The´re`se Garestier,† and Claude He´le`ne*,† Laboratoire de Biophysique, Muse´um National d’Histoire Naturelle, INSERM U201-CNRS URA 481, 43 rue Cuvier, 75231 Paris Cedex 05, France, and Laboratoire de Synthe`se Organique, Institut Curie-Biologie, CNRS URA 1387, Baˆtiment 110, 91405 Orsay, France. Received August 9, 1996X

The stabilization of triple-helical DNA under physiological conditions is an important goal for the control of gene expression using the antigene strategy, an approach whereby an oligonucleotide binds to the major groove of double-helical DNA to fom a triple helix. To this end, triplex-specific intercalators, namely benzopyridoindole (BPI) and benzopyridoquinoxaline (BPQ) derivatives, have been conjugated to the 5′ end or to an internucleotide position of a 15-mer oligonucleotide. These conjugates were then tested, using thermal denaturation experiments, for their ability to form and stabilize a triple-helical structure involving a 42-mer duplex target. All of the conjugates were found to do so. The B[h]PQ derivatives stabilized particularly well when attached to the 5′ end with a ∆Tm of 15 °C and -∆∆G°37 of 3.4 kcal mol-1 (pH 6.9, 140 mM KCl, 15 mM sodium cacodylate, 2 mM MgCl2, 0.8 mM spermine). Though most of the derivatives when attached to the internucleotide position were not able to stabilize triple-helical DNA as well as when attached to the 5′ end, one B[f]PQ derivative with an internucleotide attachment did so, with a ∆Tm of 13 °C and -∆∆G°37 of 2.8 kcal mol-1. To a lesser degree, these conjugates were also able to stabilize duplex structures with singlestranded targets. Results were compared to the stabilization obtained with acridine conjugates as well as to a similar study performed with a different sequence.

INTRODUCTION

Oligonucleotides can recognize in a sequence-selective manner both single-stranded DNA (ssDNA1 ) and doublestranded DNA (dsDNA). This feature has been exploited as a potential strategy for regulating gene expression with the purpose of treating genetic-based diseases (He´le`ne and Toulme´, 1990; Uhlmann and Peyman, 1990; Murray and Crockett, 1992; Crooke and Lebleu, 1993; Demesmaeker et al., 1995; Maher, 1996). By specifically recognizing and binding to m-RNA through WatsonCrick hydrogen bonds, an oligonucleotide may halt translation (antisense approach) (Stein and Cheng, 1993; He´le`ne, 1994; Pierga and Magdelenat, 1994). An oligonucleotide may also impede transcription by binding to the major groove of dsDNA (antigene approach) (Thuong and He´le`ne, 1993; Radhakrishnan and Patel, 1994a; Frank-Kamenetskii and Mirkin, 1995). In this latter approach, a (T,C)-containing third strand (pyrimidine motif) will bind parallel to the duplex purine strand with the formation of TA×T and CG×C+ base triplets using Hoogsteen bonds (Le Doan et al., 1987; Moser and Dervan, 1987; de los Santos et al., 1989; Rajagopal and Feigon, 1989). A (G,A)-containing third strand will run antiparallel and be bound through reverse Hoogsteen hydrogen bonds, forming CG×G and TA×A triplets (purine motif) (Beal and Dervan, 1991; Pilch et al., 1991). (G,T)-containing oligonucleotides can also form triple * Author to whom correspondence should be addressed (email [email protected]). † Muse ´ um National d’Histoire Naturelle. ‡ Insitut Curie-Biologie. X Abstract published in Advance ACS Abstracts, December 15, 1996. 1 Abbreviations: Ap, apurinic site; bp, base pair; BPI, benzopyridoindole; BPQ, benzopyridoquinoxaline; ds, doublestranded; Nb, nebularine; nt, nucleotide(s); ss, single-stranded.

S1043-1802(96)00067-5 CCC: $14.00

helices (Durland et al., 1991) with an orientation that depends on sequence (Sun et al., 1991b; de Bizemont et al., 1996). We have been interested in regulating gene expression via triple helix formation. One of the targets on which we have concentrated is a 15 bp oligopurine-oligopyrimidine sequence present in the promoter region of the gene coding for the R chain of the interleukin 2 receptor (IL-2RR), overlapping the binding sites for transcription factors NFκB and SRF (Grigoriev et al., 1992) (Table 1). IL-2RR is a cellular receptor expressed in activated T-cells. The T-cell immune response is mediated by the binding of interleukin 2 to its high-affinity receptor (the R chain associated with the β and/or γ chains). There are several limitations to the antigene strategy as a method for regulating gene expression. With a few exceptions (Svinarchuk et al., 1995), the stability of triple helices is limited under physiological conditions, due, in part, to the electrostatic repulsion between the third strand and the duplex, as well as the need for the cytosines on the third strand to be protonated in the pyrimidine motif. One strategy to improve triplex stability is to covalently attach DNA intercalators to the third strand (He´le`ne, 1989; Sun et al., 1989, 1991a; Giovannangeli et al., 1992; Thuong and He´le`ne, 1993). This approach has been used for the IL-2RR system using acridine-linked (Grigoriev et al., 1992, 1993a) and psoralen-linked (Grigoriev et al., 1993b) oligonucleotides. In both cases, specific inhibition of the transcription of reporter constructs containing the IL-2RR promoter in live cells was demonstrated. In an attempt to look at more efficient chemical modifications of the third strand for the purpose of modulating endogenous gene expression, we have studied other intercalator-oligonucleotide conjugates. Benzopy© 1997 American Chemical Society

16 Bioconjugate Chem., Vol. 8, No. 1, 1997

Silver et al.

Table 1. Thermal Melting Data of Triplex to Duplex Transitions for the BPI and BPQ Conjugates with the 42-mer Duplex Target at pH 6.9

third strand

linker arm

X ) Y ) no modification 1 oligonucleotide 15IL2 (unmodified) Y ) no modification; X ) 2 B[e]PI 1126 -(CH2)33 B[e]PI 1309 -(CH2)44 B[e]PI 1310 -(CH2)55 B[e]PI 1188 -(CH2)3NMe(CH2)36 B[g]PI 1204 -(CH2)37 B[g]PI 1263 -(CH2)48 B[g]PI 1271 -(CH2)3NMe(CH2)39 B[f]PQ 1245 -(CH2)310 B[f]PQ 1261 -(CH2)411 B[f]PQ 1333 -(CH2)512 B[h]PQ 1244 -(CH2)313 B[h]PQ 1248 -(CH2)314 B[h]PQ 1260 -(CH2)415 B[h]PQ 1335 -(CH2)516 B[h]PQ 1256 -(CH2)3NMe(CH2)317 acridine X ) no modification; Y ) 18 B[e]PI 1126 -(CH2)319 B[e]PI 1188 -(CH2)3NMe(CH2)320 B[g]PI 1263 -(CH2)421 B[f]PQ 1261 -(CH2)422 B[h]PQ 1260 -(CH2)423 B[h]PQ 1256 -(CH2)3NMe(CH2)324 acridine 5′TTNbTTCCTCTCCCTCT3′ (15IL2+Nb) 5′TTApTTCCTCTCCCTCT3′ (15IL2+Ap)

Tm (°C) ∆Tm 16

0

22 27 28 29 26 29 28 25 26 28 26 27 31 30 29 29

6 11 12 13 10 13 12 9 10 12 10 11 15 14 13 13

20 20 20 29 21 23 19 8 8

4 4 4 13 5 7 3 -8 -8

ridoindoles (BPI) (Nguyen et al., 1990) and benzopyridoquinoxalines (BPQ) (Nguyen et al., 1995) are classes of tetracyclic aromatic compounds (Figure 1) having antineoplastic activity. They have been shown to stabilize pyrimidine motif DNA triple helices in solution (Mergny et al., 1992; Escude´ et al., 1995; Marchand et al., 1996) and can intercalate into both duplexes and triplexes but bind preferentially to triplexes (Mergny et al., 1992; Pilch et al., 1993). In this study, we have covalently linked several BPI and BPQ intercalators to the 5′ end or at an internucleotide position of a 15-mer third strand probe with the IL-2RR sequence (Table 1). We have examined the ability of this series of oligonucleotide conjugates to stabilize triple helices in vitro under physiological conditions. The stability of triplexes formed from unmodified and acridine-modified oligonucleotide counterparts was also investigated. The results are compared to a similar study performed with a different triplex sequence (Silver et al., 1997).

EXPERIMENTAL PROCEDURES

Oligonucleotides. Unmodified and acridine-modified (using 2-methoxy-6-chloro-9-aminoacridine) oligonucleotides were purchased from Eurogentec (Seraing, Belgium) or Genosys (Cambridge, England). The BPI- and BPQ-modified oligonucleotides were synthesized as described below. The linkage structures of the BPI, BPQ, and acridine-modified oligonucleotides are shown in Figure 2 for both the 5′ and internal modifications. The

Figure 1. BPI (B[e]PI, B[g]PI), BPQ (B[f]PQ, B[h]PQ), and acridine derivatives. Oligonucleotides were attached to the terminal nitrogens on each of the side chains of the BPI and BPQ derivatives and to the nitrogen at position 9 of the acridine (indicated by boldface and underscoring).

Figure 2. Linkage structure of BPIs, BPQs, and acridine to oligonucleotides. Outlined characters indicate position of attachment to intercalator. Note that for BPI and BPQ derivatives, the NH group is that of the substituent R indicated in Figure 1, while for the acridine derivative the NH group is found in position 9 of the aromatic ring.

concentration of unmodified oligonucleotides was calculated using molar extinction coefficients at 260 nm derived using a nearest-neighbor model (Cantor et al., 1970; Rouge´e et al., 1992). The acridine-modified oligonucleotide concentration was calculated using 424 ) 8845 M-1 cm-1 (Asseline et al., 1984). The extinction coefficients for the BPI and BPQ conjugates were approximated by adding the experimentally derived extinction coefficient at 260 nm of the unconjugated BPI or BPQs in H2O to the extinction coefficient for oligonucle-

Bioconjugate Chem., Vol. 8, No. 1, 1997 17

Stabilization of Triple-Helical DNA Table 2. Thermodynamic Parameters for Triplex Formationa oligonucleotideintercalator conjugate 1 oligonucleotide 15IL2 (unmodified) 14 B[h]PQ 1260 (5′ attachment) 17 acridine (5′ attachment) 21 B[f]PQ 1261 (interior attachment)

Table 3. Tm Values of Duplex to Single-Strand Transitions

∆H° (kcal ∆S° [cal ∆G°37 mol-1) (mol K)-1] (kcal mol-1) -68 ( 3

-208 ( 8

-3.5 ( 0.2

-74 ( 3

-218 ( 10

-6.9 ( 0.1

-73 ( 2

-217 ( 8

-6.2 ( 0.1

-83 ( 4

-249 ( 13

-6.3 ( 0.1

a

The reported values correspond to the average of four experiments taking into account both the heating and cooling curves.

otide 15IL2 (260 ) 116 000 M-1 cm-1). All concentrations are given on a per strand basis. Syntheses. To covalently link the BPQ and BPI derivatives to the 5′ end of the oligomers (Godovikova et al., 1986; Mergny et al., 1994), the hexadecyl trimethyl ammonium salt of 150 µg of 5′-phosphorylated 15IL2 (5′TTTTCCTCTCCCTCT-3′) was incubated with 6.6 mg of dipyridyl disulfide, 7.9 mg of triphenylphosphine, and 5 µL of N-methylimidazole in 100 µL of dry DMSO for 15 min at room temperature. Five microliters of triethylamine was added followed by a solution of the BPQ or BPI derivative (20 µL, 30 mM in DMSO). After 20 min, the oligonucleotide was precipitated with 3% LiClO4 in acetone, reprecipitated from water with EtOH, and purified by reversed phase HPLC. Average yield ) 21%. The oligonucleotide-intercalator conjugates were characterized by UV-visible spectroscopy. To attach the BPQ and BPI derivatives to the interior of the oligonucleotide (Vasseur et al., 1991), 100 µg of oligo 15IL2+A (5′-TTATTCCTCTCCCTCT-3′) or 15IL2+Nb (5′-TTNbTTCCTCTCCCTCT-3′) was depurinated in a 100 µL solution of 30 mM HCl/1 mM EDTA for 22 h at 37 °C [Bailly and Verly, 1987; to form oligo 15IL2+Ap (5′-TTApTTCCTCTCCCTCT-3′)]. Following EtOH precipitation, the oligonucleotide was reacted with the BPQ or BPI derivative (2.5 mM), NaOAc (pH 5.2, 200 mM), and NaBH3CN (50 mM) in a total volume of 100 µL for 2 h. The oligonucleotide was recovered by reversed phase HPLC. Average yield ) 53%. The oligonucleotide-intercalator conjugates were characterized by UVvisible spectroscopy. Thermal Denaturation Studies. Experiments were carried out in 140 mM KCl, 15 mM sodium cacodylate, 1.5 mM MgCl2, and 0.8 mM spermine, pH 6.9. Cacodylate buffer was chosen due to the limited dependence of pH on temperature. Absorbance versus temperature curves were obtained using a Uvikon 940 spectrophotometer interfaced to an IBM computer. The temperature of the two six-cell holders was regulated by a Haake P2 circulating H2O/glycerol (4:1) bath. The temperature was varied at a rate of 6 °C/h by a Haake PG20 thermoprogrammer. To monitor triplex-to-duplex transitions, the temperature was varied from 62 °C (equilibrated for 70 min) to 0 °C (maintained for 70 min) and returned to 62 °C. To monitor duplex-to-single-strand transitions, the temperature was varied from 90 °C (equilibrated for 70 min) to 40 °C (maintained for 70 min) and returned to 90 °C. Oligonucleotide concentrations were 1 µM of duplex and 1.5 µM of third strand. When intercalator was added free in solution, it was added at 1.5 µM. When the target was single-stranded and not double-stranded, the probe strand was added at 1.0 µM (Table 3). The absorbance at 260 and at 600 nm was recorded every 8.3 min. Corrections for spectrophotometric instability were made by subtracting the absor-

third strand

linker arm

X ) Y ) no modification 1 unmodified 15IL2 Y ) no modification; X ) 10 B[f]PQ 1261 13 B[h]PQ 1248 17 acridine X ) no modification; Y ) 21 B[f]PQ 1261 22 B[h]PQ 1260 23 B[h]PQ 1256 24 acridine

Tm (°C) 54

-(CH2)4-(CH2)3-

58 60 60

-(CH2)4-(CH2)4-(CH2)3NMe(CH2)3-

57 58 58 59

bance at 600 nm from that at 260 nm. There is some hysteresis in the heating and cooling curves, due to slow kinetics of formation and dissociation of the triple-helical complexes (Rouge´e et al., 1992). The difference between the cooling and heating curves varied between 0.5 and 2 °C at the Tm value depending on the identity of the third strand. Tm values were approximated as the maxima in dA/dT vs T plots of the heating curves. The uncertainty in Tm values reported is estimated at (1 °C on the basis of repetition of experiments. Values reported are an average of three to six experiments. Thermodynamic Calculations. As the hysteresis was minimal for many of the melting curves, we could estimate thermodynamic parameters from some of these curves. The heating and cooling curves were analyzed separately, and it was found that the differences between the two values were insignificant. The transition to the triplex, T, from the duplex, D, and the monomeric oligonucleotide, M, is given by

D+MhT Thermodynamic parameters were derived from the melting curves using a two-state model which assumes that the species with incomplete base pairing are not significantly populated (Cantor and Schimmel, 1980; Rouge´e et al., 1992). A linear absorbance vs temperature relationship was assumed for the calculation of AD and AT, the absorbances of the double- and triple-stranded species, respectively. Equilibrium constants at different temperatures were then calculated, and the plot of ln Keq vs T-1 was used to determine ∆H°, ∆S°, and ∆G° (37 °C) as previously described (Breslauer et al., 1975; Albergo et al., 1981; Petersheim and Turner, 1983; Rouge´e et al., 1992; Wang and Kool, 1995). Errors are reported as the standard deviation. RESULTS

To study the ability of BPI and BPQ conjugates to form stable triple helices, UV thermal melting studies were performed with each conjugate (15 nt) in the presence of a 42 bp target duplex (see top of Table 1). Hyperchromicty at 260 nm accompanies the dissociation of the third strand from the duplex. The midpoint of this transition (Tm) indicates the relative stability of the triple helix. Comparisons were made with the unmodified third strand (15IL2) and with the acridine conjugates. The results of these studies are shown in Table 1. Examples of the profiles of the fraction of triplex formed as a function of temperature are shown in Figure 3. These

18 Bioconjugate Chem., Vol. 8, No. 1, 1997

Figure 3. Fraction of triplex formed calculated from the graphs of absorbance vs temperature [χT ) (A - AD)/(AT - AD)]. One example each is shown of the triplex formed with the unmodified third strand (triangles) or with oligonucleotide 14 (circles) in the presence of duplex (42R/Y). The calculations were performed separately on the heating (solid circles/triangles) and cooling (open circles/triangles) curves. Conditions are those described under Experimental Procedures.

curves allowed the calculation of several thermodynamic parameters (∆G°37, ∆H°, and ∆S°), which are given in Table 2. These results show that all of the triple helices formed with the oligonucleotide conjugates are more stable than those formed with the unmodified probe (15IL2), yet there are significant variations depending on the point of attachment to the oligonucleotide and the specific intercalator used. The most stable triplex is formed with conjugate 14, where a B[h]PQ with a butyl linker arm is attached to the 5′ end. The triplex formed melts at 31 °C compared with 16 °C for the triplex formed with the free oligonucleotide (1) and 29 °C for the 5′ acridine conjugate (17). The B[f]PQ derivative, 1261, attached to the interior of the 15-mer (21) melts at 29 °C. In terms of standard free energy, this corresponds to a stabilization of the triplex by 3.4 kcal mol-1 at 37 °C for B[h]PQ 1260 attached to the 5′ end of the 15-mer (14) as compared to 2.7 kcal mol-1 for the acridine derivative (Table 2). The B[f]PQ derivative, 1261, attached to the interior of the 15-mer (21) stabilizes the triplex by 2.8 kcal mol-1. For the 5′ attachments, comparing the four intercalators, for the -(CH2)3- linker arm B[h]PQ ) B[g]PI g B[f]PQ > B[e]PI, for the -(CH2)4- linker arm B[h]PQ > B[g]PI > B[e]PI g B[f]PQ, for the -(CH2)5- linker arm B[h]PQ > B[e]PI ) B[f]PQ, and for the -(CH2)3NMe(CH3)2- linker arm B[h]PQ ) B[e]PI g B[g]PI. In summary, B[h]PQ seems to be the best ligand for stabilizing the triple helix. Also, a chain length of four carbons is optimal for B[f]PQ, but a slightly higher stabilization is obtained with a chain of 5 carbons for B[e]PI and B[h]PQ. A linker arm of three carbons gave consistently less stabilization. Different linker lengths were not tested for the acridine complexes. However, the one tested [-(CH2)5-] stablizes well in comparison to most of the BPI and BPQ derivatives, except for B[h]PQ derivatives 1260 and 1335. Attached to the interior position, the most stabilizing is the B[f]PQ with a linker arm of -(CH2)4- (21), which has a Tm of 29 °C. This particular intercalator shows a remarkable stablilization compared with all of the other intercalators tested including acridine at this position.

Silver et al.

As is to be expected, the oligonucleotide precursors for these conjugates, namely 15IL2+Nb or 15IL2+A, and the oligonucleotide with an apurinic site (15IL2+Ap) (see Experimental Procedures) are much less stable than the unmodified third strand. As fewer conjugates were tested for the interior modifications, it is more difficult to generalize. However, it appears that the B[f]PQ derivatives are much more stable than any of the other intercalator conjugates, whereas in the 5′ position it was one of the worst. The results with the intercalator-oligonucleotide conjugates were compared to the stabilization gained by triplexes with the intercalators free in solution. The plain third strand, 15IL2 (1.5 µM), was mixed with the duplex solution (1 µM) in the same buffer as that used for the conjugate studies. Significant triplex stabilization has been seen for solutions where a 10-fold higher concentration of intercalator was used (vs the triplex concentration) at pH 6.2 (Escude´ et al., 1995). In the current study, a 1.5-fold concentration (1.5 µM) of the BPI or BPQ derivatives and a pH of 6.9 were used. All tested BPI and BPQ derivatives led to ∆Tm values of 2 °C except B[h]PQ 1256 and B[g]PI 1271, which gave ∆Tm values of 6 and 3 °C, respectively. This is likely due to the extra positve charge localized on the tertiary nitrogen found in the longer linker arms of these two derivatives providing greater affinity for the negatively charged nucleic acids. That the first of these derivatives stabilizes more than the second has been confirmed by previous studies (Escude´ et al., 1995; C. Escude´, personal communication). The addition of acridine to a triplex solution under these conditions did not stabilize the triplex. BPIs and BPQs are known to preferentially stabilize triple-helical DNA structures over double-helical DNA when in solution (Mergny et al., 1992; Escude´ et al., 1995; Marchand et al., 1996). Nevertheless, they do intercalate into duplex structures (Mergny et al., 1992). Therefore, it was of interest to measure the stability of double-helical complexes formed upon binding of the 15-mer-intercalator conjugates to a single-stranded target. A singlestranded sequence complementary to the oligonucleotideBPI/BPQ conjugates was mixed in equimolar quantity (1 µM) with different conjugates and the Tm of the duplexto-single-strand transition was determined. The results are shown in Table 3. The stabilization seen varies between 3 and 6 °C depending on the conjugate. To attach the intercalators to the interior of the probe strand, we chose to add an extra nucleotide to the probe strand, which was then depurinated so that the intercalator could be attached at this position. The reason we chose to do so was based on molecular modeling studies which had indicated that adding, rather than replacing, an existing nucleotide would provide the most energetically favorable possibility (unpublished calculations). The duplex “spreads apart” upon binding of an intercalator (Wilson, 1992; Zhou et al., 1995). Thus, the alignment of the bases in the duplex with the third strand is thought to be better through the addition rather than the replacement of a base. To test this, we performed some melting studies with a target sequence in which an extra base pair was added opposite to the position of depurination on the probe strand. The results are given in Table 4. When the probe strand also contained an extra nucleotide complementary to the base pair added to the target, the Tm remained at 16 °C. However, the Tm values observed with the oligonucleotide conjugates (20, 21, and 23) dropped (2-8 °C), indicating that these conjugates could not form a more stable conformation with the 43-mer duplexes as compared to the 42-mer duplex. It is interesting to note that the Tm of the 15IL2 oligonucle-

Bioconjugate Chem., Vol. 8, No. 1, 1997 19

Stabilization of Triple-Helical DNA

Table 4. Thermal Melting Data of Triplex to Duplex Transitions with Extra Base Pair (in bold) in Target Sequence

Tm (°C) third strand 5′-TTTTCCTCTCCCTCT-3′ (15IL2) 5′-TTATTCCTCTCCCTCT-3′ 5′-TTTTTCCTCTCCTCT-3′ Y) 20 21 23 24

B[g]PI 1263 B[f]PQ 1261 B[h]PQ 1256 acridine

Z, W ) A, T

T, A

no extra bp (42-mer target)

7 7 not tested

14 7 16

16 not tested not tested

19 21 20 20

18 23 19 17

20 29 23 19

linker arm

-(CH2)4-(CH2)4-(CH2)3NMe(CH2)3-

Table 5. Tm Values of Triplex to Duplex Transitions wth a Blunt End Target Duplexa

blunt end targeta third strand

linker arm

X ) Y ) no modification 1 oligonucleotide 15IL2 (unmodified) Y ) no modification; X ) 10 B[f]PQ 1261 -(CH2)414 B[h]PQ 1260 -(CH2)416 B[h]PQ 1256 -(CH2)3NMe(CH2)317 acridine X ) no modification; Y ) 21 B[f]PQ 1261 -(CH2)422 B[h]PQ 1260 -(CH2)423 B[h]PQ 1256 -(CH2)3NMe(CH2)324 acridine a

standard targetb

Tm

∆Tm

Tma

∆Tma

18

0

16

0

24 28 26 26

6 10 8 8

26 31 29 29

10 15 13 13

28 22 23 18

10 4 5 0

29 21 23 19

13 5 7 3

Shown above. b From Table 1.

otide also drops slightly with the 43-mer duplex (Z, B ) T, A), even though it should also form a perfect triplex with the modified target. This phenomenon has previously been observed (J.-L Mergny, personal communication). It is likely due to the distortion induced at the triplex-duplex junction which destabilizes the triple helix more for a py-py than for a pu-py step at the junction. When the third strand hybridizes to the duplex, two sites are possible for intercalation of the BPI or BPQ derivatives: the duplex-triplex junction and within the triplex. To investigate the relative importance of intercalation at these two sites with the two types of conjugates synthesized, we performed melting temperature studies in the presence of a duplex where the overhanging 5′ end (with respect to the purine strand) was removed (Table 5). As would be expected for intercalation within the triplex, the ∆Tm values for those conjugates where the intercalator is attached to the interior are almost the same as the ∆Tm values of these same conjugates with the standard (42R/Y) target. In the case where the intercalator was joined at the 5′ end one sees a greater decrease in ∆Tm (i.e. 4-5 °C) when the overhanging duplex sequence is removed. Though not conclusive, these experiments suggest that when attached to the interior, the BPI/BPQ derivative intercalates within the triplex. However, when atttached to the

5′ end, a large part of the stabilization comes from intercalation into the junction. The Tm of the triplex formed with the unmodified third strand is somewhat higher with the blunt end target than with the target with the overhanging end (42R/Y). This is because the binding of a third strand induces a distortion of the triplex-duplex junction (Collier and He´le`ne, 1991), and the corresponding free energy has to be provided upon third strand binding leading to a destabilization of the complex. A similar set of syntheses and melting experiments have previously been performed with a different sequence, called 14C3, shown in Table 6. These results are being reported elsewhere (Silver et al., 1996). However, a small selection of these 14C3 results is shown in Table 6 for the purpose of comparison. The 14C3 triplex is inherently more stable under the conditions used (the same as the present paper), as it contains only 21% cytosines vs 47% for the IL2Ra sequence. The pKa of cytosines has been estimated at 4.7 in oligonucleotides (Manzini et al., 1990), and protonation is required for triplex formation. It is thus understandable that all of the Tm values obtained with the 14C3 sequence were higher than their 15IL2 counterparts. However, it is interesting to note that the ∆Tm values for the 14C3 system were greater as well. The most significant ∆(∆Tm) values [i.e. ∆Tm (14C3 system) - ∆Tm

20 Bioconjugate Chem., Vol. 8, No. 1, 1997

Silver et al.

Table 6. Selection of Tm Values for Triplex to Duplex Transitions in the 14C3 Systema

third strand

linker arm

X ) Y ) no modification unmodified (15IL2) Y ) no modification; X ) B[f]PQ 1261 -(CH2)4B[h]PQ 1260 -(CH2)4acridine X ) no modification; Y ) B[f]PQ 1261 -(CH2)4B[h]PQ 1260 -(CH2)4acridine a

14C3 15IL2 Tm (°C) ∆Tm Tm (°C) ∆Tm 28

0

16

0

43 51 45

15 23 17

26 31 29

10 15 13

45 39 35

17 11 7

29 21 19

13 5 3

Buffer is the same as for the IL2 system.

(IL2 system)] were seen for 5′ B[h]PQ attachments and for internally attached B[e]PIs. Thinking that the sequence around the site of the duplex-triplex junction could be influencing the amount of stability gained for the 5′ attachments, we changed the duplex target sequence for the 14C3 system. In the IL2 system, at the junction the sequence is TATT in the pyrimidine strand, and for the 14C3 system it is AATT (see Table 6). So we changed the duplex target sequence for the 14C3 system to 3′ GCTCTATTCTTCTTTTTTCTAACTCG 5′ (outlined base indicates the one changed). The stability of the 14C3 triplexes formed with this target and a probeintercalator conjugate was not lowered and in fact showed a 1-2 °C increase in Tm (data not shown), indicating that the conformation of the duplex-triplex junction is perhaps not responsible for the differences seen in ∆Tm values. DISCUSSION

Certain DNA ligands have been shown to bind to DNA triple helices (Mergny et al., 1991; Scaria and Shafer, 1991; Durand et al., 1992; Park and Breslauer, 1992; Escude´ et al., 1995). However, only a few compounds have been studied that efficiently and selectively bind to triple helices (Mergny et al., 1992; Lee et al., 1993; Wilson et al., 1993; Escude´ et al., 1995; Fox et al., 1995; Latimer et al., 1995). Previous studies in our laboratory have concentrated on ligands of this latter type, namely benzopyridoindoles and benzopyridoquinoxalines. They stabilize the triple helix by intercalating between TA×T base triplets. Binding of these cationic derivatives to CG×C+ triplets is not favored due to the positive charge of this triplet. In this paper and another (Silver et al., 1996), we attached the BPI and BPQ derivatives to a run of thymines within the probe strand and examined the stability of triplexes formed with these conjugates. The results of the current study indicate that all of the conjugates synthesized are able to stabilize the formation of DNA triple helices. However, certain conjugates did so to a greater extent. Differences were seen among the different derivatives and depended on which of the intercalators was attached, the length of the hydrocarbon linker chain, and the position of attachment to the probe strand. In general, better stabilization was seen with 5′ attachments when arm lengths of at least four methylenes were used. The B[h]PQ derivatives worked par-

ticularly well here. That the B[f]PQ 1261 derivative (21) attached to the interior showed significant stabilization compared to both of the other intercalators attached at this position as well as to the same derivative attached to the 5′ end suggests that this conjugate has a conformation allowing particularly favorable ligand-base stacking interactions within the triple-helical region. The mechanism by which these conjugates stabilize triple helices is likely the intercalation of the derivatives within the triplex (internal attachment) or at the duplex/triplex junction (5′- end attachment). When the BPI or BPQ is covalently attached to the oligonucleotide third strand, intramolecular interactions of the BPI or BPQ moiety with the bases of the third strand might also play a role in determining the thermodynamic parameters of the interactions of the conjugate with its target double helix. It should be noted that the linker used to tether the BPI and BPQ derivatives to the oligonucleotide occupies a different position in the grooves of the triplex than when they are bound as free ligand. In the latter case, the linker is expected to be in the Watson-Crick groove for B[g]PI and B[h]PQ derivatives but has been shown to prefer the Watson-Hoogsteen groove for B[e]PI and B[f]PQ derivatives on the basis of molecular modeling (Escude´ et al., 1995). [The nomenclature of the grooves has been previously described (Radhakrishnan and Patel, 1994b). The oligopyrimidine and oligopurine strand of the Watson-Crick duplex are Watson and Crick, respectively, and the third strand is Hoogsteen. Each groove of the triple helix is referred to by the names of the adjacent strands.] However, when attached to the third strand, the intercalating moiety is always introduced from the major groove side of the double helix. Therefore, B[g]PI and B[h]PQ should be in a less favorable position than B[e]PI and B[f]PQ. This seems to hold when the intercalator is attached to the interior of the third strand oligonucleotide but not when attached to the 5′ end (Table 6). This might reflect the difference in the intercalation mode: within the triple-helical structure in the first case, at the duplex-triplex junction in the second case. On the other hand, the chemistry of dye attachment to the oligonucleotide is also different for an interior site and the 5′ end (see Figure 2). A positive charge is still present on the linker when attachment occurs at an interior site as is the case for the free derviatives. This positive charge was taken into account for the modeling studies mentioned above. In contrast, the phosphoramidate linkage at the 5′ end carries no positive charge, which may also explain the deviation from the results with the free ligands (Escude´ et al., 1995). It is informative to compare the current study with one performed with the 14C3 sequence (Table 6) (Silver et al., 1996). Both the Tm values and the ∆Tm values are significantly greater for the 14C3 system. The reason for the larger ∆Tm values is not obvious. Previous studies using the 14C3 sequence have suggested that the stretch of six TA×T base triplets is the major binding site for free BPI ligands (Mergny et al., 1992). When two thymines were replaced by two cytosines in the 14C3 sequence, leaving only four contiguous TA×T base triplets, a strong decrease in triple-helix stabilization was seen (Mergny et al., 1992). This probably occurs because the six contiguous TA×T base triplets provide a greater number of binding sites for the BPI ligands within the triplex. The IL2 sequence contains only a stretch of four TA×T base triplets, which might be one reason for the lower stabilization as compared to the 14C3 sequence. In addition, the four TA×T triplets of the IL2 sequence are located at the 5′ end of the oligopurine target sequence, whereas the six TA×T triplets are located

Stabilization of Triple-Helical DNA

toward the center of the 14C3 sequence. Finally, in the case of oligonucleotides with internal attachment of the ligands, the position of intercalation is only two base triplets away from the 5′ end of the triplex structure in the case of the IL2 sequence. The last two thymines between the 5′ end and the intercalator attachment site of the third-strand oligonucleotide might not be fully hydrogen-bonded to the two T‚A base pairs of the target. Despite the differences in sequence between the IL2 and 14C3, the same trends were seen with both systems in terms of which derivatives stabilized the most. To summarize, the B[h]PQs generally work particularly well and the B[f]PQs particularly poorly at stablizing DNA triple helices when attached to the 5′ end of the probe strand. As well, in both systems, for this site of attachment, the short linker arm, -(CH2)3-, does not work well. At the interior position, the results were somewhat more mixed, likely a result of several differences in the positioning of the intercalator. However, in both cases the B[f]PQ derivative 1261 shows great stabilization. For the 14C3 system the B[e]PIs also work well. CONCLUSION

Benzopyridoindoles and benzopyridoquinoxalines have been shown to stabilize the formation of DNA triple helices when they are conjugated at both the 5′ end and to an internucleotide position of the third-strand oligonucleotide. The particular derivative, the length of the linker arm, the point of attachment, and the sequence of base triplets around the ligand attachment site all play important roles in determining the stability of the triplexes formed. These results will be useful for studies using these conjugates to inhibit transcription in cellular systems as well as in the design of new oligonucleotide conjugates. ACKNOWLEDGMENT

G.C.S. acknowledges the Ministe`re des Affaires Etrange`res du Gouvernement Franc¸ ais for a Chateaubriand Fellowship as well as the support of the National Science Foundation (Grant INT 9403368). LITERATURE CITED Albergo, D., Marky, L., Breslauer, K., and Turner, D. (1981) Thermodynamics of (dG-dC)3 double-helix formation in water and deuterium oxide. Biochemistry 20, 1409-1413. Asseline, U., Delarue, M., Lancelot, G., Toulme´, F., Thuong, N. T., Montenay-Garestier, T., and He´le`ne, C. (1984) Nucleic acid-binding molecules with high affinity and base sequence specificity: intercalating agents covalently linked to oligodeoxynucleotides. Proc. Natl. Acad. Sci. U.S.A. 81, 32973301. Bailly, V., and Verly, W. G. (1987) Escherichia coli endonuclease III is not an endonuclease but a beta-elimination catalyst. Biochem. J. 242, 565-572. Beal, P. A., and Dervan, P. B. (1991) Second structural motif for recognition of DNA by oligonuclotide-directed triple-helix formation. Science 251, 1360-1363. Breslauer, K., Sturtevant, J., and Tinoco, I. J. (1975) Calorimetric and spectroscopic investigation of the helix-to-coil transition of a ribo-oligonucleotide. J. Mol. Biol. 99, 549-65. Cantor, C., and Schimmel, P. (1980) Biophysical Chemistry, Chapter 22, W. H. Freeman, San Francisco. Cantor, C. R., Warshaw, M. M., and Shapiro, H. (1970) Oligonucleotides interactions. III. Circular dichroism studies of the conformation of deoxyoligonucleotides. Biopolymers 9, 10591077. Collier, D. A., and He´le`ne, C. (1991) Site-specific intercalation at the triplex-duplex junction Induces a conformational change which is detectable by hypersensitivity of diethylpyrocarbonate. Nucleic Acids Res. 11, 4219-4224.

Bioconjugate Chem., Vol. 8, No. 1, 1997 21 Crooke, S. T., and Lebleu, B. (1993) Antisense Research and Applications, CRC Press, London. de Bizemont, T., Duval-Valentin, G., Sun, J.-S., Bisagni, E., Garestier, T., and He´le`ne, C. (1996) Alternate strand recognition of double-helical DNA by (T,G)-containing oligonucleotides in the presence of a triple helix-specific ligand. Nucleic Acids Res. 24, 1136-1143. de los Santos, C., Rosen, M., and Patel, D. (1989) NMR Studies of DNA (R+)N.(Y-)N.(Y+)N triple helices in solutionsimino and amino proton markers of TAT and CGC+ base-triple formation. Biochemistry 28, 7282-7289. Demesmaeker, A., Haner, R., Martin, P., and Moser, H. E. (1995) Antisense oligonucleotides. Acc. Chem. Res. 28, 366374. Durand, M., Thuong, N. T., and Maurizot, J. C. (1992) Binding of netropsin to a DNA triple helix. J. Biol. Chem. 267, 2439424399. Durland, R. H., Kessler, D. J., Gunnel, S., Duvic, M., Petit, B. M., and Hogan, M. E. (1991) Binding of triple helix forming oligonucleotides to sites in gene promoters. Biochemistry 30, 9246-9255. Escude´, C., Nguyen, C. H., Mergny, J.-L., Sun, J.-S., Bisagni, E., Garestier, T., and He´le`ne, C. (1995) Stabilization of triple helices by benzopyridoindole derivatives. J. Am. Chem. Soc. 117, 10212-10219. Fox, K. R., Polucci, P., Jenkins, T. C., and Neidle, S. (1995) A molecular anchor for stabilizing triple-helical DNA. Proc. Natl. Acad. Sci. U.S.A. 92, 7887-7891. Frank-Kamenetskii, M. D., and Mirkin, S. M. (1995) Triplex DNA structures. Annu. Rev. Biochem. 64, 65-95. Giovannangeli, C., Rouge´e, M., Montenay-Garestier, T., Thuong, N. T., and He´le`ne, C. (1992) Triple-helix formation by oligonucleotides containing the three bases thymine, cytosine, and guanine. Proc. Natl. Acad. Sci. U.S.A. 89, 8631-8635. Godovikova, T. S., Zarytova, V. F., and Khalimskaya, L. M. (1986) Synthesis of phosphoramide derivatives of oligonucleotides. Bioorgan. Khim. 12, 475-481. Grigoriev, M., Praseuth, D., Robin, P., Hemar, A., SaisonBehmoaras, T., Dautry-Varsat, A., Thuong, N. T., He´le`ne, C., and Harel-Bellan, A. (1992) A triple helix-forming oligonucleotide-intercalator conjugate acts as a transcriptional repressor via inhibition of NF kappa B binding to interleukin-2 receptor alpha-regulatory sequence. J. Biol. Chem. 267, 3389-3395. Grigoriev, M., Praseuth, D., Guieysse, A.-L., Robin, P., Thuong, N. T., He´le`ne, C., and Harel-Bellan, A. (1993a) Inhibition of interleukin-2 receptor alpha-subunit gene expression by oligonucleotide-directed triple helix formation. C. R. Acad. Sci. Paris, Ser. III 316, 492-495. Grigoriev, M., Praseuth, D., Guieysse, A. L., Robin, P., Thuong, N. T., He´le`ne, C., and Harel-Bellan, A. (1993b) Inhibition of gene expression by triple helix-directed DNA cross-linking at specific sites. Proc. Natl. Acad. Sci. U.S.A. 90, 3501-3505. He´le`ne, C. (1989) Artificial control of gene expression by oligodeoxynucleotides covalently linked to intercalating agents. Br. J. Cancer 60, 157-160. He´le`ne, C. (1994) Control of oncogene expression by antisense nucleic acids. Eur. J. Cancer 30A, 1721-1726. He´le`ne, C., and Toulme´, J.-J. (1990) Specific regulation of gene expression by antisense, sense and antigene nucleic acids. Biochim. Biophys. Acta 1049, 99-125. Latimer, L. J. P., Payton, N., Forsyth, G., and Lee, J. S. (1995) The binding of analogues of coralyne and related heterocyclics to DNA triplexes. Biochem. Cell Biol. 73, 11-18. Le Doan, T., Perrouault, L., Praseuth, D., Habhoub, N., Decout, J. L., Thuong, N. T., Lhomme, J., and He´le`ne, C. (1987) Sequence-specific recognition, photocrosslinking and cleavage of the DNA double helix by an oligo-[alpha]-thymidylate covalently linked to an azidoproflavine derivative. Nucleic Acids Res. 15, 7749-60. Lee, J. S., Latimer, L. J. P., and Hampel, K. J. (1993) Coralyne binds tightly to both T.A.T-containing and C.G.C+-containing DNA triplexes. Biochemistry 32, 5591-5597. Maher, L. (1996) Prospects for the therapeutic use of antigene oligonucleotides. Cancer Invest. 14, 66-82. Manzini, G., Xodo, L. E., Gasparotto, D., Quadrifoglio, F., van der Marel, G. A., and van Boom, J. H. (1990) Triple helix formation by oligopurine-oligopyrimidine DNA fragments.

22 Bioconjugate Chem., Vol. 8, No. 1, 1997 Electrophoretic and thermodynamic behavior. J. Mol. Biol. 213, 833-843. Marchand, C., Bailly, C., Nguyen, C. H., Bisagni, E., Garestier, T., He´le`ne, C., and Waring, M. J. (1996) Stabilization of triple helical DNA by a benzopynidoquinoxaline intercalator. Biochemistry 35, 5022-5032. Mergny, J. L., Collier, D., Rouge´e, M., Montenay-Garestier, T., and He´le`ne, C. (1991) Intercalation of ethidium bromide into a triple-stranded oligonucleotide. Nucleic Acids Res. 19, 1521-1526. Mergny, J. L., Duval-Valentin, G., Nguyen, C. H., Perrouault, L., Faucon, B., Rouge´e, M., Montenay-Garestier, T., Bisagni, E., and He´le`ne, C. (1992) Triple helix-specific ligands. Science 256, 1681-1684. Mergny, J. L., Boutorine, A. S., Garestier, T., Belloc, F., Rougee, M., Bulychev, N. V., Koshkin, A. A., Bourson, J., Lebedev, A. V., Valeur, B., Thuong, N. T., and He´le`ne, C. (1994) Fluorescence energy transfer as a probe for nucleic acid structures and sequences. Nucleic Acids Res. 22, 920-928. Moser, H. E., and Dervan, P. B. (1987) Sequence-specific cleavage of double helical DNA by triple helix formation. Science 238, 645-650. Murray, J. A. H., and Crockett, N. (1992) Antisense techiques: an overview. In Antisense RNA and DNA (J. A. H. Murray, Ed.) pp 1-48, Wiley, New York. Nguyen, C. H., Lhoste, J.-M., Lavelle, F., Bissery, M.-C., and Bisagni, E. (1990) Synthesis and antitumor activity of 1-[[(dialkylamino)alkyl]amino]-4-methyl-5H-pyrido[4,3-b]benzo[e]and -benzo[g])indoles. A new class of antineoplastic agents. J. Med. Chem. 33, 1519-1528. Nguyen, C. H., Fan, E., Riou, J.-F., Bissery, M.-C., Vrignaud, P., Lavelle, F., and Bisagni, E. (1995) Synthesis and biological evaluation of amino-substituted benzo[f]pyrido[4,3-b] and pyrido[3,4-b]quinoxalines: a new class of antineoplastic agents. Anti-Cancer Drug Des. 10, 277-297. Park, Y. W., and Breslauer, K. J. (1992) Drug binding to higher ordered DNA structuressnetropsin complexation with a nucleic acid triple helix. Proc. Natl. Acad. Sci. U.S.A. 89, 6653-6657. Petersheim, M., and Turner, D. H. (1983) Base-stacking and base-pairing contributions to helix stability: thermodynamics of double-helix formation with CCGG, CCGGp, CCGGAp, ACCGGp, CCGGUp, and ACCGGUp. Biochemistry 22, 256263. Pierga, J., and Magdelenat, H. (1994) Applications of antisense oligonucleotides in oncology. Cell. Mol. Biol. 40, 237-261. Pilch, D. S., Levenson, C., and Shafer, R. H. (1991) Structure, stability, and thermodynamics of a short intermolecular purine-purine-pyrimidine triple helix. Biochemistry 30, 60816088. Pilch, D. S., Waring, M. J., Sun, J.-S., Rougee, M., Nguyen, C.H., Bisagni, E., Garestier, T., and He´le`ne, C. (1993) Characterization of a triple helix-specific ligand. BePI {3-methoxy7H-8-methyl-11-[(3′-amino)propylamino]-benzo[e]pyrido[4,3b]indole} intercalates into both double-helical and triplehelical DNA. J. Mol. Biol. 232, 926-946. Radhakrishnan, I., and Patel, D. J. (1994a) DNA triplexes: solution structures, hydration sites, energetics, interactions, and function. Biochemistry 33, 11405-11416. Radhakrishnan, I., and Patel, D. J. (1994b) Solution structure and hydration patterns of a pyrimidine‚purine‚pyrimidine DNA triplex containing a novel T‚CG base-triple. J. Mol. Biol. 241, 600-619. Rajagopal, P., and Feigon, J. (1989) Triple-strand formation in the homopurine homopyrimidine DNA oligonucleotide-d(GA)4 and oligonucleotide-d(TC)4. Nature 339, 637-640.

Silver et al. Rouge´e, M., Faucon, B., Mergny, J. L., Barcelo, F., Giovannangeli, C., Garestier, T., and He´le`ne, C. (1992) Kinetics and thermodynamics of triple-helix formation: effects of ionic strength and mismatches. Biochemistry 31, 9269-9278. Scaria, P. V., and Shafer, R. H. (1991) Binding of ethidium bromide to a DNA triple helixsevidence for intercalation. J. Biol. Chem. 266, 5417-5423. Silver, G. C., Sun, J.-S., Nguyen, C. H., Boutorine, A. S., Bisagni, E., and He´le`ne, C. (1997) Stable triple helical DNA complexes formed by benzopyridoindole- and benzopyridoquinoxalineoligonucleotide conjugates. J. Am. Chem. Soc. 119, 263-268. Stein, C. A., and Cheng, Y. (1993) Antisense oligonucleotides as therapeutic agentssis the bullet really magic? Science 261, 1004-1012. Sun, J. S., Franc¸ ois, J. C., Montenay-Garestier, T., SaisonBehmoaras, T., Roig, V., Chassignol, M., Thuong, N. T., and He´le`ne, C. (1989) Sequence-specific intercalating agents. Intercalation at specific sequences on duplex DNA via majorgroove recognition by oligonucleotide intercalator conjugates. Proc. Natl. Acad. Sci. U.S.A. 86, 9198-9202. Sun, J., Giovannangeli, C., Francois, J.-C., Kurfurst, R., Montenay-Garestier, T., Asseline, U., Saison-Behmoaras, T., Thuong, N. T., and He´le`ne, C. (1991a) Triple-helix formation by alpha-oligodeoxynucleotides and alpha-oligodeoxynucleotide intercalator conjugates. Proc. Natl. Acad. Sci. U.S.A. 88, 6023-6027. Sun, J. S., de Bizemont, T., Duval-Valentin, G., MontenayGarestier, T., and He´le`ne, C. (1991b) Extension of the range of recognition sequences for triple helix formation by oligonucleotides containing guanines and thymines. C. R. Acad. Sci. Paris, Ser. III 313, 585-590. Svinarchuk, F., Paoletti, J., and Malvy, C. (1995) An unusually stable purine(purine-pyrimidine) short triplexsthe third strand stabilizes double-stranded DNA. J. Biol. Chem. 270, 14068-14071. Thuong, N. T., and He´le`ne, C. (1993) Sequence-specific recognition and modification of double-helical DNA by oligonucleotides. Angew. Chem., Int. Ed. Engl. 32, 666-690. Uhlmann, E., and Peyman, A. (1990) Antisense oligonucleotides: a new therapeutic principle. Chem. Rev. 90, 543-584. Vasseur, J.-J., Peoc’h, D., Rayner, B., and Imbach, J.-L. (1991) Derivatization of oligonucleotides through abasic site formation. Nucleosides Nucleotides 10, 107-117. Wang, S., and Kool, E. T. (1995) Origins of the large differences in stability of DNA and RNA helices: C-5 methyl and 2′-hydroxyl effects. Biochemistry 34, 4125-4132. Wilson, W. D. (1992) Reversible interactions of nucleic acids with small molecules. In Nucleic Acids in Chemistry and Biology (G. M. Blackburn and M. J. Gait, Eds.) 311 pp, Oxford Unversity Press, Oxford, U.K. Wilson, W. D., Tanious, F. A., Mizan, S., Yao, S. J., Kiselyov, A. S., Zon, G., and Strekowski, L. (1993) DNA triple-helix specific intercalators as antigene enhancerssunfused aromatic cations. Biochemistry 32, 10614-10621. Zhou, B. W., Puga, E., Sun, J. S., Garestier, T., and He´le`ne, C. (1995) Stable triple helices formed by acridine-containing oligonuclotides with oligopurine tracts of DNA interrupted by one or two pyrimidines. J. Am. Chem. Soc. 117, 1042510428.

BC9600675