Environ. Sci. Technol. 2005, 39, 3029-3033
Conservation of Cancer Genes in the Marine Invertebrate Mytilus edulis CORINA M. CIOCAN AND JEANETTE M. ROTCHELL* Department of Biology and Environmental Science, Centre for Environmental Research, University of Sussex, Falmer, Brighton, BN1 9QJ, U.K.
Mussels are susceptible to a wide range of environmental toxicants, including carcinogens, and thus are often employed as bioindicator species. To elucidate the molecular aetiology of such neoplastic damage, we have cloned Mytilus edulis homologues of the vertebrate ras protooncogene, and p53 tumor suppressor gene. The M. edulis ras cDNA encodes a predicted protein of 184 amino acids. The DNA sequence analysis with vertebrate ras sequences demonstrates that the M. edulis ras cDNA is highly conserved in regions of functional importance, including mutational hot spots. The partial p53 sequence also demonstrates that M. edulis p53 is highly conserved in two regions of functional importance and that these regions also include four of the five mutational hot spots for this gene. In contrast, the M. edulis p53 sequence shows little similarity to the other published invertebrate p53-like sequences. The cancer gene sequences characterized herein will allow development of specific biomarkers of genotoxic damage.
(1997) developed S19 ribosomal protein as a molecular biomarker of gonadal neoplasia in M. arenaria (15). All methods detect gross DNA alteration providing a correlation of DNA damage, or altered gene expression, with contaminant exposure but do not provide actual cause-and-effect or mechanistic detail. The exception is that in which differential display PCR has been used to detect genes involved in the development of dioxin-induced gonadal neoplasms (16). One, E3 ubiquitin, is thought to interact with cell regulatory proteins, such as p53, bringing about their degradation with subsequent uncontrolled cell growth and tumorigenesis (17). The genes most often implicated in vertebrate tumorigenesis are the ras oncogene and the p53 and retinoblastoma (Rb) tumor suppressor genes. Combined, their mutational activation or inactivation, respectively, is observed in more than half of all human tumors (18-20). Ras genes encode proteins that play a central role in cell growth signaling cascades and are evolutionarily conserved (21). A large proportion and wide variety of experimentally induced or environmentally induced vertebrate tumors possess mutant forms of ras (21). The p53 gene is an important negative regulator of cell cycle progression. Conservation of specific functional domains suggests that the p53 protein plays similar functional roles in vertebrates as diverse as fish and humans (22). Loss of p53 function can lead to unchecked cell growth and contribute to carcinogenesis. To date, two p53-like family members (p53 and p73) have been sequenced for clam (M. arenaria, GenBank Accession Nos. AF253323 and AF253324) (23), three for surf clam (Spisula solidissima, AF285104, AY289767, and AY289768) (24, 25), one for squid (Loligo forbesi, U43595), and one for oyster (Crassostrea rhizophorae, AY442309). Here, we describe the isolation and characterization of the M. edulis cancer genes, ras and p53, and their potential use in the development of a biomarker of genotoxic damage.
Materials and Methods Introduction Mussels are selected as a sentinel organism to monitor aquatic pollution for several reasons: they are sessile, filter feeding, distributed worldwide, and also cultivated for human food consumption. Mussels, and related bivalve species, also appear to be susceptible to neoplastic damage and as such could provide both an opportunity for assessing the levels of genotoxicity, and a means to determine the aetiology of observed genetic damage, in the aquatic environment. The range of neoplasms observed includes: hemocytic in Mytilus sp. (1, 2) and Mya arenaria (3); gonadal in several marine bivalve species (4-7); digestive in Macoma balthica experimentally exposed to contaminated sediments (7); gill in M. balthica (8); and kidney and heart in Crassostrea virginica following laboratory and field controlled exposure to contaminated sediments (9, 10). In cases of environmentally induced neoplasia, the identification of the causative agents and their role in the molecular aetiology has yet to be achieved. The underlying molecular aetiology of neoplastic development in bivalves is a relatively recent focus of research initiatives. The current methods for assessing genetic damage in aquatic invertebrates include micronucleus frequency (11), fast micromethod (12), Comet assay (13), and flow cytometry (14). Using mRNA expression, Rhodes and Van Beneden * Corresponding author phone: +44 1273 872862; fax: +44 1273 677196; e-mail:
[email protected]. 10.1021/es0400887 CCC: $30.25 Published on Web 03/11/2005
2005 American Chemical Society
Isolation of Total RNA and First Strand cDNA Synthesis. M. edulis adults were collected from the English Channel near Brighton in November of 2002. Digestive gland tissue from each mussel was snap frozen and stored at -80 °C. Total RNA was extracted according to supplier’s instructions (Qiagen Ltd.). First strand cDNAs were synthesized using 1 µg of total RNA and according to supplier’s instructions (Invitrogen Ltd.). After cDNA synthesis, 3 µL of the reaction mixture was used as a template for subsequent PCR. Degenerate RT-PCR. Sequences for the degenerate primers used were as follows: RasF, 5′ATGACGGARTAYAAGCT3′; RasR, 5′CAGTAYATGMGRACAGG3′, to yield a PCR product of 224 bp. P53 was isolated using a direct RACE strategy described below. Amplification was performed with a BioRad iCycler in 50 µL reaction volumes. Ras fragments were amplified using 30 cycles at 94 °C for 30 s and 68 °C for 40 s followed by a final 2 min extension at 68 °C. 18 µL of PCR product was analyzed using agarose gel electrophoresis (1% agarose, Tris, boric acid, EDTA buffer), bands excised and purified (Qiagen Inc.). cDNA was ligated into a TA cloning vector (Invitrogen); recombinant plasmids were transformed and selected using kanamycin LB plates. Plasmid was purified for sequence analysis (by MWG Biotech, Germany). The sequence obtained from the cloned ras fragment subsequently served as a starting point for RACE primer design as follows. RACE Isolation of cDNAs. mRNA was purified from digestive gland total RNA (1 µg) using SMART RACE cDNA amplification reagents and protocol (Clontech). The 3′ ends VOL. 39, NO. 9, 2005 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
3029
FIGURE 1. Comparison of the deduced M. edulis ras protein sequence (GenBank Accession No. AY679522) with selected invertebrate and vertebrate ras sequences: L. forbesi, GenBank Accession No. AAA64420; A. californica, GenBank Accession No. AAA19441; Artemia sp., GenBank Accession No. AAC83399; D. rerio, GenBank Accession No. AAB40625; Homo sapiens Ki-ras, GenBank Accession No. 0909262B; H. sapiens Ha-ras, GenBank Accession No. TVHUH; H. sapiens N-ras, GenBank Accession No. PO1111. Areas showing homology are highlighted with an asterisk. of the genes were obtained using gene-specific primers. The sequences of these primers were: ras, 5′GCTTGTGGTTGTTGGAGCTGGTGGCGT3′; p53, 5′ATGAACCGSMGGCCCATYCTCACCATC3′. Amplifications were performed in 50 µL reactions using a BioRad iCycler for 5 cycles at 94 °C for 5 s, 72 °C for 3 min, 5 cycles of 94 °C for 5 s, 70 °C for 20 s, and 72 °C for 3 min, followed by 25 cycles at 94 °C for 5 s, 68 °C for 10 s, and 72 °C for 3 min. The RACE products obtained were analyzed on agarose gels, excised, and purified (Qiagen Inc.). cDNA was ligated into a TA cloning vector (Invitrogen); recombinant plasmids were transformed and selected using kanamycin LB plates. Plasmid was purified for sequence analysis (by MWG Biotech, Germany) to verify the identity of the product.
Results Isolation and Sequencing of a cDNA Clone Encoding M. edulis ras. To isolate the ras gene, degenerate primers and RT-PCR techniques were used to amplify an initial 224 bp fragment representing the 5′ end of the gene. This fragment was used to design gene-specific primers and to generate an 820 bp sequence with a 3′ RACE reaction. The M. edulis ras cDNA isolated encodes a 184 amino acid protein (Figure 1, GenBank Accession No. AY679522). Isolation and Sequencing of a cDNA Clone Encoding M. edulis p53. A single product was generated using 3′ RACE and a degenerate p53 primer based on the alignment of p53 sequences in zebrafish (Danio rerio, GenBank Accession No. AAB40617) (26) and barbel (Barbus barbus, GenBank Accession No. AAD34212) (27). The 480 bp product encodes 160 amino acids, corresponding to amino acids 246-392 of 3030
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 39, NO. 9, 2005
the human p53 protein (Figure 2) and amino acid 286 onward of the M. arenaria p53-like protein (Figure 3).
Discussion Here, we report M. edulis cDNA sequences for the cancer genes ras and p53. The ras cDNA isolated encodes a 184 amino acid protein displaying a high identity with the human Ki-ras, 83% (GenBank Accession No. 0909262B) (28) and fish counterparts, 79% with D. rerio (GenBank Accession No. AAB41625) (29) and 83% with Platichthys flesus (GenBank Accession No. CAA76678) (30); and lowest with other mollusks, 62% with L. forbesi (unpublished, GenBank Accession No. AAA64420) and 68% with A. californica (GenBank Accession No. AAA19441) (31). The first 85 amino acids of the M. edulis ras gene, which encodes the functionally important nucleotide binding site and effector domains, are similar to vertebrate sequences, differing at only two codons 30 and 83. Relevantly, the mutational hot spot residues that affect activator (guanine-binding) function or sites (at codons 12, 13, 59, and 61) are conserved in M. edulis ras. Using published ras sequences and the M. edulis ras sequence, it is also possible to investigate the phylogenetic relationship using CLUSTALW (Figure 4). The cladogram produced reveals distinct clusters, M. edulis, Artemia, and human Ki-ras form one branch, while the ras sequences identified in L. forbesi and A. californica form a different branch. The invertebrate ras phylogeny may well change once complete sequences become available for the latter. Vertebrate p53 is characterized by the high conservation of five functional domains, and the M. edulis p53 partial sequence contains half of domain 4 and all of 5, sharing high
FIGURE 2. Comparison of the mussel (M. edulis, GenBank No. AY705932), zebrafish (D. rerio, GenBank Accession No. AAB40617), barbel (B. barbus, GenBank Accession No. AAD34212), and human (H. sapiens, GenBank Accession No. NP000537) deduced p53 protein sequences. The conserved DNA binding domains 1-5 are boxed. amino acid homology with the fish counterparts: 71% with D. rerio p53 and 77% with B. barbus p53 (Figure 2) as opposed to the invertebrate counterparts (Figure 3). This would suggest that the invertebrate p53 genes isolated to date, described in the literature as “p53-like” (23, 24), may be p53-related rather than actual p53 gene counterparts. A nuclear localization signal (KKRK) is also conserved in M. edulis. Attempts to amplify the 5′ end of M. edulis p53 were not successful (possibly due to greater sequence divergence), but relevantly for ecotoxicologists, the fragment reported herein contains four of the five most common mutational hot spots, codons 245, 248, 249, and 273. In summary, the highly conserved structural domains that define each gene in vertebrates are present in M. edulis, suggesting that their functional roles may also be conserved. Relevantly for ecotoxicologists, the mutational hot spots of the ras and p53 genes are also conserved. Conservation of mutational hot spot regions lends their development as a potential early-warning biomarker of genotoxic damage and carcinogenesis in the aquatic environment. Molecular responses to pollutant exposure are among the most sensitive
and earliest detectable. Determining if proto-oncogenes and tumor suppressor genes are mutationally activated or inactivated (respectively) by environmental contaminants will also help to elucidate the mechanistic molecular aetiology of neoplastic conditions observed in the environment and induced in the laboratory. There are two points relevant to future biomarker development. First, the M. edulis ras gene isolated is more homologous to the vertebrate Ki-ras gene than to the N- or Ha-ras alternative genes (28). In chemically induced and feral fish tumors, it is commonly the Ki-ras homologue that is mutated (21), suggesting that the M. edulis ras may also be susceptible. Second, the M. edulis p53 partial sequence shows high identity with D. rerio and B. barbus (Figure 2) within the conserved domains 4 and 5 where mutational hot spots are located. Unfortunately, the M. edulis sequence is not available for the codon that corresponds to codon 263 of the M. arenaria sequence, at which evidence of a point mutation was previously detected in leukaemic samples (32). Ras and p53 are frequently implicated in the aetiology of various vertebrate neoplasms, including more than 50% of VOL. 39, NO. 9, 2005 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
3031
FIGURE 3. Comparison of the mussel (M. edulis, GenBank Accession No. AY705932), clam (M. arenaria, GenBank Accession No. AAF67733), and squid (L. forbesi, GenBank Accession No. AAA98563) deduced p53 protein sequences. Areas showing homology are highlighted with an asterisk. The site of a previously reported point mutation in M. arenaria p53 is highlighted with a #. inactivation (32) are involved in the development of leukaemia in M. arenaria. In future work, we therefore plan to screen mussels with leukaemia-like and other neoplastic disorders to establish if there is altered expression and/or mutational activation of the ras gene or inactivation of the p53 gene.
Abbreviations bp
base pairs
kb
kilobase(s)
RT-PCR
reverse transcriptase-polymerase chain reaction
Acknowledgments FIGURE 4. Relationship of the M. edulis ras sequence with those from published invertebrate and vertebrate species. The cladogram was generated using a ClustalW 1.82 program. Gap penalty and gap extension penalty were set to 10 and 0.05, respectively. certain human leukaemias (33), with ras involvement even higher in chemically induced human leukaemias (34). Two further investigations also provide circumstantial evidence that altered p53 expression (35) and/or p53 mutational 3032
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 39, NO. 9, 2005
This work was funded by an EU Marie Curie Intra European fellowship to C.M.C. (Contract MEIF-CT-2003-500587).
Literature Cited (1) Krishnakumar, P. K.; Casillas, E.; Snider, R. G.; Kagley, A. N.; Varanasi, U. Environmental contaminants and the prevalence of hemic neoplasia (leukemia) in the common mussel (Mytilus
(2)
(3)
(4)
(5) (6)
(7)
(8)
(9)
(10)
(11)
(12) (13) (14)
(15)
(16) (17) (18) (19)
edulis complex) from Puget sound, Washington, USA. J. Invert. Pathol. 1999, 73, 135-146. Kagley, A. N.; Snider, R. G.; Krishnakumar, P. K.; Casillas, E. Assessment of seasonal variability of cytochemical responses to contaminant exposure in the blue mussel Mytilus edulis (complex). Arch. Environ. Contam. Toxicol. 2003, 44, 43-52. Strandberg, J. D.; Rosenfield, J.; Berzins, I. K.; Reinisch, C. L. Specific localization of polychlorinated biphenyls in clams (Mya arenaria) from environmentally impacted sites. Aquat. Toxicol. 1998, 41, 343-354. Gardner, G. R.; Yevich, P. P.; Hurst, J.; Thayer, P.; Benyi, S.; Harshbarger, J. C.; Pruell, R. J. Germinomas and teratoid siphon anomalies in softshell clams, Mya arenaria, environmentally exposed to herbicides. Environ. Health Perspect. 1991, 90, 4351. Peters, E. C.; Yevich, P. P.; Harshbarger, J. C.; Zaroogian, G. E. Comparative histopathology of gonadal neoplasms in marine bivalve mollusks. Dis. Aquat. Org. 1994, 20, 59-76. Barber, B. J.; MacCallum, G. S.; Robinson, S. M. C.; McGladdery, S. Occurrence and lack of transmissibility of gonadal neoplasia in softshell clams, Mya arenaria, in Maine (USA) and Atlantic Canada. Aquat. Living Res. 2002, 15, 319-326. Tay, K. L.; Teh, S. J.; Doe, K.; Lee, K.; Jackman, P. Histopathologic and histochemical biomarker responses of Baltic clam, Macoma balthica, to contaminated Sydney Harbour sediment, Nova Scotia, Canada. Environ. Health Perspect. 2003, 111, 273-280. Smolarz, K.; Wolowicz, M.; Thiriot-Quievreux, C. Argyrophilic nucleolar organizer regions (AgNORs) in interphases and metaphases of normal and neoplastic gill cells of Macoma balthica (Bivalvia: Tellinidae) from the Gulf of Gdansk, Baltic Sea. Dis. Aquat. Org. 2003, 56, 269-274. Gardner, G. R.; Yevich, P. P.; Harshbarger, J. C.; Malcolm, A. R. Carcinogenicity of Black Rock Harbor sediment to the eastern oyster and trophic transfer of Black Rock Harbor carcinogens from the blue mussel to the winter flounder. Environ. Health Perspect. 1991, 90, 53-66. Gardner, G. R.; Pruell, R. J.; Malcolm, A. R. Chemical induction of tumors in oysters by a mixture of aromatic and chlorinated hydrocarbons, amines and metals. Mar. Environ. Res. 1992, 34, 59-63. Klobucar, G. I. V.; Pavlica, M.; Erben, R.; Papes, D. Application of the micronucleus and comet assays to mussel Dreissena polymorpha haemocytes for genotoxicity monitoring of freshwater environments. Aquat. Toxicol. 2003, 64, 15-23. Jaksic, Z.; Batel, R. DNA integrity determination in marine invertebrates by Fast Micromethod (R). Aquat. Toxicol. 2003, 65, 361-376. Dixon, D. R.; Pruski, A. M.; Dixon, L. R. J.; Jha, A. Marine invertebrate eco-genotoxicology: a methodological overview. Mutagenesis 2002, 17, 495-507. Bihari, N.; Micic, M.; Batel, R.; Zahn, R. K. Flow kilometric detection of DNA cell cycle alterations in hemocytes of mussels (Mytilus galloprovincialis) off the Adriatic coast, Croatia. Aquat. Toxicol. 2003, 64, 121-129. Rhodes, L. D.; Van Beneden, R. J. Isolation of the cDNA and characterization of mRNA expression of ribosomal protein S19 from the soft-shell clam, Mya arenaria. Gene 1997, 197, 295304. Van Beneden, R. J.; Rhodes, L. D.; Gardner, G. R. Potential alterations in gene expression associated with carcinogen exposure in Mya arenaria. Biomarkers 1999, 4, 485-491. Kelley, M. L.; Van Beneden, R. J. Identification of an E3 ubiquitinprotein ligase in the softshell clam (Mya arenaria). Mar. Environ. Res. 2000, 50, 289-293. Adjei, A. A. Blocking oncogenic ras signaling for cancer therapy. J. Natl. Cancer Inst. 2001, 93, 1062-1074. Greenblatt, M. S.; Bennett, W. P.; Hollstein, M.; Harris, C. C. Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res. 1994, 54, 4855-4878.
(20) Sellers, W. R.; Kaelin, W. G. Role of the retinoblastoma protein in the pathogenesis of human cancer. J. Clin. Oncol. 1997, 15, 3301-3312. (21) Rotchell, J. M.; Lee, J.-S.; Chipman, J. K.; Ostrander, G. K. Structure, expression and activation of fish ras genes. Aquat. Toxicol. 2001, 55, 1-21. (22) Soussi, T.; de Fromentel, C.; May, P. Structural aspects of the p53 protein in relation to gene evolution. Oncogene 1990, 5, 945-952. (23) Kelley, M. L.; Winge, P.; Heaney, J. D.; Stephens, R. E.; Farell, J. H.; Van Beneden, R. J.; Reinisch, C. L.; Lesser, M. P.; Walker, C. W. Expression of homologues for p53 and p73 in the softshell clam (Mya arenaria), a naturally-occurring model for human cancer. Oncogene 2001, 20, 748-758. (24) Jessen-Eller, K.; Kreiling, J. A.; Begley, G. S.; Steele, M. E.; Walker, C. W.; Stephens, R. E.; Reinisch, C. L. A new invertebrate member of the p53 gene family is developmentally expressed and responds to polychlorinated biphenyls. Environ. Health Perspect. 2002, 110, 377-385. (25) Cox, R. L.; Stephens, R. E.; Reinisch, C. L. p63/73 homologues in surf clam: novel signaling motifs and implications for control of expression. Gene 2003, 320, 49-58. (26) Cheng, R.; Ford, B. L.; ONeal, P. E.; Mathews, C. Z.; Bradford, C. S.; Thongtan, T.; Barnes, D. W.; Hendricks, J. D.; Bailey, G. S. Zebrafish (Danio rerio) p53 tumor suppressor gene: cDNA sequence and expression during embryogenesis. Mol. Mar. Biol. Biotechnol. 1997, 6, 88-97. (27) Bhaskaran, A.; May, D.; Rand-Weaver, M.; Tyler, C. R. Fish p53 as a possible biomarker for genotoxins in the aquatic environment. Environ. Mol. Mutagen. 1999, 33, 177-184. (28) Kahn, S.; Yamamoto, F.; Almoguera, C.; Winter, E.; Forrester, K.; Jordano, J.; Perucho, M. The c-K-ras gene and human cancer (review). Anticancer Res. 1987, 7, 639-652. (29) Cheng, R.; Bradford, S.; Barnes, D.; Williams, D.; Hendricks, J.; Bailey, G. Cloning, sequencing, and embryonic expression of an N-ras proto-oncogene isolated from an enriched zebrafish (Danio rerio) cDNA library. Mol. Mar. Biol. Biotechnol. 1997, 6, 40-47. (30) Vincent-Hubert, F. cDNA cloning and expression of two Ki-ras genes in the flounder, Platichthys flesus, and analysis of hepatic neoplasms. Comp. Biochem. Physiol., B 2000, 126, 17-27. (31) Swanson, M. E.; Elste, A. M.; Greenberg, S. M.; Schwartz, J. H.; Aldrich, T. H.; Furth, M. E. Abundant expression of ras proteins in aplysia neurons. J. Cell Biol. 1986, 103, 485-492. (32) Barker, C. M.; Calvert, R. J.; Walker, C. W.; Reinisch, C. L. Detection of mutant p53 in clam leukaemia cells. Exp. Cell Res. 1997, 232, 240-245. (33) Side, L. E.; Curtiss, N. P.; Teel, K.; Kratz, C.; Wang, P. W.; Larson, R. A.; Le Beau, M. M.; Shannon, K. M. Ras, FLT3, and TP53 mutations in therapy-related myeloid malignancies with abnormalities of chromosomes 5 and 7. Genes, Chromosomes Cancer 2004, 39, 217-223. (34) Barletta, E.; Gorini, G.; Vineis, P.; Miligi, L.; Davico, L.; Mugnai, G.; Ciolli, S.; Leoni, F.; Bertini, M.; Matullo, G.; Costantini, A. S. Ras gene mutations in patients with acute myeloid leukaemia and exposure to chemical agents. Carcinogenesis 2004, 25, 749755. (35) Stephens, R. E.; Walker, C. W.; Reinisch, C. L. Multiple protein differences distinguish clam leukaemia cells from normal hemocytes: evidence for the involvement of p53 homologues. Comp. Biochem. Physiol., C 2001, 129, 329-338.
Received for review August 16, 2004. Revised manuscript received January 25, 2005. Accepted January 28, 2005. ES0400887
VOL. 39, NO. 9, 2005 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
3033
