Construction and Assembly of Chimeric DNA: Oligonucleotide Hybrid

Article pubs.acs.org/Biomac

Construction and Assembly of Chimeric DNA: Oligonucleotide Hybrid Molecules Composed of Parallel or Antiparallel Duplexes and Tetrameric i‑Motifs Hui Mei,†,‡ Simone Budow,† and Frank Seela*,†,‡ †

Laboratory of Bioorganic Chemistry and Chemical Biology, Center for Nanotechnology, Heisenbergstraße 11, 48149 Münster, Germany ‡ Laboratorium für Organische und Bioorganische Chemie, Institut für Chemie, Universität Osnabrück, Barbarastraße 7, 49069 Osnabrück, Germany S Supporting Information *

ABSTRACT: Chimeric DNA containing parallel (ps) and antiparallel (aps) duplex elements as well as poly-dC tracts were designed and synthesized. Oligonucleotide duplexes with ps chain orientation containing reverse Watson−Crick dA-dT base pairs and short d(C)2 tails are stabilized under slightly acidic conditions by hemiprotonated dCH+-dC base pairs (“clamp” effect). Corresponding molecules with aps orientation containing Watson−Crick dA-dT base pairs do not show this phenomenon. Chimeric DNA with ps duplex elements and long d(C)5 tails at one or at both ends assemble to tetrameric i-motif structures. Molecules with two terminal d(C)5 tails form multimeric assemblies which have the potential to form nanoscopic scaffolds. A preorganization of the ps duplex chains stabilizes the i-motif assemblies up to almost neutral conditions as evidenced by thermal melting and gel electrophoresis. Although, ps DNA is generally less stable than aps DNA, the aps duplexes contribute less to the stability of the i-motif than ps DNA.

■

INTRODUCTION DNA is a polymorphic molecule forming various structural motifs such as A-, B-, and Z-DNA. In canonical duplex DNA the oligonucleotide strands show antiparallel (aps) chain orientation, while more complex DNA motifs, such as triplexes, 1 quadruplexes,2 and i-motif DNA 3 can form assemblies with parallel (ps) chains. Also, parallel stranded duplex DNA was constructed using the principles of regular DNA with two bidentate and two tridentate base pairs; dG was replaced by isoGd and dC by isoCd.4−9 The constituents of the dA-dT base pair have not to be changed, as these DNA nucleobases can form aps (Watson−Crick) as well as ps (reverse Watson−Crick, Figure 1a) motifs. Consequently, ps DNA formed by dA-dT base pairs is accessible by appropriate sequence selection (Figure 1b).10−14 Parallel stranded DNA represents an alternative pairing system to canonical Watson− Crick DNA. More than 40 years ago, it was suggested that poly-dC forms parallel stranded duplexes stabilized by hemiprotonated dCH+dC base pairs at acidic pH (Figure 1c).15 Later, Gehring and coworkers verified the formation of a tetrameric structure (Figure 1d), the so-called i-motif, by NMR spectroscopy at low pH.16 In this structure, two ps duplexes held together by hemiprotonated dCH+-dC base pairs are intercalating with each other in aps orientation (Figure 1d). The base pairs are perpendicular to each other with the nucleobases in the anti© 2012 American Chemical Society

conformation. These structural parameters were also confirmed by single crystal X-ray analysis.3,17−20 Recently, DNA supramolecular nanostructures were established by the self-assembly of functional subunits to nanodevices with entirely new nanometric shapes.21−23 Most of such supramolecular structures (sms) were formed by duplex DNA with antiparallel chain orientation and were stabilized by conventional Watson−Crick base pairs. To develop advanced functional DNA nanostructures, more complex motifs such as triplexes,24 G-quadruplexes,25 and i-motifs26−31 were recently used due to their diverse functions and properties. i-Motif nanodevices attracted particular attention as the i-motif core is sensitive to dissociation by pH changes between 6 and 8. The formation of nanospheres32 and nanowires33 has been reported recently. As our laboratory has a long lasting experience in the construction of duplex DNA with parallel stranded helix structure,4−7,34 as well as i-motif DNA,27,35 we reasoned that chimeric molecules build up from different DNA species, namely, stretches of parallel or antiparallel stranded duplex DNA and i-motifs (connectors), can lead to pH-sensitive multimeric assemblies. Herein, such DNA chimeric molecules Received: September 19, 2012 Revised: October 30, 2012 Published: November 5, 2012 4196

dx.doi.org/10.1021/bm301471d | Biomacromolecules 2012, 13, 4196−4204

Biomacromolecules

Article

Figure 1. (a) Reverse Watson−Crick base pair (S refers to the 2′-deoxyribofuranosyl moiety), (b) schematic presentation of duplex DNA with parallel chain orientation, (c) hemiprotonated dCH+-dC base pair, (d) tetrameric i-motif structure, and (e) chimeric DNA formed by a ps duplex and a tetrameric i-motif core. C represents dC.

Table 1. Tm Values of Oligonucleotide Assembliesa Tm values [°C]b buffer A (pH 6.0)

oligonucleotide assemblies ps

aps

buffer B (pH 6.4)

buffer C (pH 6.8)

buffer D (pH 7.0)

5′-d(AAAAAAAAAATAATTTTAAATATTT) ODN-1 5′-d(TTT TTT TTT TATT AAAAT TTATAAA) ODN-2

28 28

29 29

31 31

32 32

5′-d(CCAAAAAAAAAA TAATTT TAAATATTTCC) ODN-3 5′-d(CC TTT TTT TTT T AT TAAAATTTATAAACC) ODN-4

34 33

33 33

34 33

32 32

5′-d(AAAAAAAAAATAATTTTAAATATTTCC CCC) ODN-5 5′-d(TTT TTT TTT TATTAAAAT TTATAAACC CCC) ODN-6

32/52c 33

-d/48c 31

37 31

31 31

5′-d(CCC CCA AAAAAAAAATAATTTTAAATATTTCCCCC) ODN-7 5′-d(CCCCCT TTTTTTTTTATTAAAATTTATAAACCCCC) ODN-8

34/53c 35

32/47c 32

40 30

29 29

5′-d(AAAAAAAAAATAATTTTAAATATTT) ODN-1 3′-d(TTTTTTTTTTATTAAAATTTATAAA) ODN-9

47 47

48 48

49 49

49 49

5′-d(CCAAAAAAAAAATAATTTTAAATATTTCC) ODN-3 3′-d(CC TTT TTT TTT TATTAAAATTTATAAACC) ODN-10

47 47

48 47

50 49

50 49

5′-d(AAAAAAAAAATAATTTTAAATATTTCCCCC) ODN-5 3′-d(TTT TTT TTT TATTAAAATTTATAAACCCCC) ODN-11

47 45

46 47

49 49

48 48

5′-d(CCCCCAAAAAAAAAATAATTTTAAATATTTCCCCC) ODN-7 3′-d(CCCCCTTTTTTTTTTATTAAAATTTATAAACCCCC) ODN-12

48 43

44 45

46 46

46 46

Measured at 260 nm with 2.5 + 2.5 μM single-strand concentration at a heating rate of 0.5 °C/min. bFirst row: Tm values calculated from heating curves. Second row: Tm values calculated from cooling curves. Buffer A: 100 mM NaH2PO4, pH 6.0; buffer B: 100 mM NaH2PO4, pH 6.4; buffer C: 100 mM NaH2PO4, pH 6.8; buffer D: 100 mM NaH2PO4, pH 7.0. cBiphasic melting. dTm could not be calculated. a

were used without further purification. Standard phosphoramidites were purchased from Sigma (Sigma-Aldrich Chemie GmbH, Deisenhofen, Germany). Reversed-phase HPLC was carried out on a 250 × 4 mm RP-18 LiChrospher 100 column with a HPLC pump connected with a variable wavelength monitor, a controller, and an integrator. The following buffer solutions were used for gel electrophoresis and Tm measurements: Buffer A, 100 mM NaH2PO4, pH 6.0; Buffer B, 100 mM NaH2PO4, pH 6.4; Buffer C, 100 mM NaH2PO4, pH 6.8; Buffer D, 100 mM NaH2PO4, pH 7.0. Buffer preparation is as follows: 2.76 g NaH2PO4·H2O was dissolved in 200 mL of nanopure water and adjusted to the desired pH with 2 M aq NaOH. Oligonucleotide Synthesis and Purification. The solid-phase oligonucleotide synthesis was performed at 1 μmol scale (trityl-on

were designed, synthesized, and assembled. We anticipate that, upon hybridization at acidic pH, the duplex elements will enforce the formation of tetrameric i-motifs connecting multiple hybrid molecules to supramolecular assemblies as schematically demonstrated in Figure 1e. It will be shown by hybridization experiments in solution and gel electrophoretic characterization of the assemblies that duplex chain orientation affects the stability of DNA i-motif assemblies.

■

EXPERIMENTAL SECTION

General Methods and Materials. All chemicals and solvents were of laboratory grade as obtained from Acros, Aldrich, Sigma, or Fluka (Sigma-Aldrich Chemie GmbH, Deisenhofen, Germany) and 4197


Biomacromolecules

Article

mode) employing standard phosphoramidites and following the synthesis protocol for 3′-cyanoethyl phosphoramidites. After cleavage from the solid-support, the oligonucleotides were deprotected in 25% aq NH3 for 2 h at 60 °C. The DMT-containing oligonucleotides were purified by reversed-phase HPLC (RP-18) with the following solvent gradient system [E: 0.1 M (Et3NH)OAc (pH 7.0)/MeCN 95:5; F: MeCN; gradient I: 0−3 min 10−15% F in E, 3−15 min 15−50% F in E, 15−20 min 50−10% F in E, flow rate 0.8 cm3 min−1]. Then, the mixture was evaporated to dryness, and the residue was treated with 2.5% Cl2CHCOOH/CH2Cl2 for 3 min at 0 °C to remove the 4,4′dimethoxytrityl residues. The detritylated oligomers were purified by reversed-phase HPLC with the gradient II: 0−20 min 0−20% F in E, 20−25 min 20% F in E, 25−30 min 20−0% F in E, flow rate 0.8 cm3 min−1. The oligomers were desalted on a short column (RP-18, silica gel) using H2O for elution of the salt, while the oligomers were eluted with MeOH/H2O (3:2). The oligonucleotides were lyophilized on a Speed Vac evaporator to yield colorless solids which were stored frozen at −24 °C. The molecular masses of oligonucleotides were determined by MALDI-TOF (MS Autoflex, Bruker and Voyager-DE PRO spectrometer, Applied Biosystems) in the linear positive mode with 3-hydroxypicolinic acid (3-HPA) as a matrix (Table S1, Supporting Information). Thermal Melting Measurements. The melting temperature curves were measured with a Cary-100 Bio UV−vis spectrophotometer (Varian, Australia) equipped with a Cary thermoelectrical controller. The temperature was measured continuously in the reference cell with a heating and cooling rate of 0.5 °C min−1. Before starting a cooling or heating cycle, the samples were incubated for 10 min at 15 or 75 °C. The program MeltWin 3.0 was used for data calculation. Protocol for the Formation of i-Motif Hybrid Molecules with Parallel or Antiparallel Stranded Duplex Elements. Oligonucleotides (250 μM) were first heated in buffer A (100 mM NaH2PO4, pH 6.0) or buffer C (100 mM NaH2PO4, pH 6.8) at 80 °C for 5 min and then slowly cooled down to room temperature. After that, the stock solutions were kept at 4 °C for 2−3 or 21 days before performing native polyacrylamide gel electrophoresis. Native Polyacrylamide Gel Electrophoresis (PAGE). Analysis of DNA hybrid molecules was carried out by native polyacrylamide gel electrophoresis (15% polyacrylamide gel, 19:1 acryl/bisacrylamide). Tris-acetate 1× buffer (0.112 mol/L, pH 6.0 or 6.8) was used to prepare the gels and was also used as running buffer. After complete polymerization (1 h), the gel (10 × 10 cm) was prerun at 90 V for 30 min at 0 °C using 1× Tris-acetate buffer. Aliquots (2 μL) of the oligonucleotide stock solutions were dissolved in 10 μL Tris-acetate buffer. Glycerol (5 μL) was added, and the mixed oligonucleotide solutions were loaded onto the gel. Electrophoresis was run at a constant field strength of 7 V/cm at 0 °C for 5 h using Tris-acetate buffer. The gel was stained with 0.02% methylene blue for 20 min and was then incubated in water for 2 h to remove excess dye from the background.

Figure 2. Schematic illustration of ps and aps duplex formation with short dC tails. C represents dC.

thermal melting. As i-motif formation requires slightly acidic conditions and the stability of i-motifs depends on the pH values, melting curves were measured at different pH values from slightly acidic to neutral pH (6.0, 6.4, 6.8, 7.0; Table 1). Oligonucleotides with Short dC-Tails not Forming i-Motif Assemblies. In acidic buffer solution (pH 6.0), no significant differences in duplex stabilities were observed for the aps duplexes with short dC-tails (e.g., ODN-3·ODN-10: Tm = 47 °C) and without dC-tails (ODN-1·ODN-9: Tm = 47 °C). On the contrary, the corresponding ps duplex ODN-1·ODN-2 without dC tails shows a lower Tm than the duplexes with dC tails, for example, ODN-1·ODN-2: Tm = 28 °C versus ODN3·ODN-4: Tm = 34 °C (Table 1). From this, we conclude that the ps duplex forms tridentate hemiprotonated dCH+-dC base pairs at the termini of the helix acting as a clamp, as illustrated in Figure 2. Such a clamp formation has already been reported by Miles and co-workers in a NMR study performed on a DNA dodecamer duplex.36 However, in the antiparallel orientation (ODN-3·ODN-10) homobase pair formation of dC residues is not possible. As a consequence, identical Tm values were found for the aps duplexes with and without dC tails. Oligonucleotides with dC-Tails Forming Parallel Stranded Duplexes and i-Motif Assemblies. Next, Tm measurements were performed on chimeric oligonucleotides with five consecutive dC residues either at the 3′-end or at both ends (3′ and 5′) at pH 6.0. The assembly formed by the ps duplex ODN-7·ODN-8 bearing d(C)5 tails at the 3′- and 5′-end displays biphasic melting with two Tm values in the heating mode: a lower Tm at 34 °C and a higher one at 53 °C (Table 1). Most interestingly, upon cooling, the high transition profile disappeared and only the low melting curve was observed (Tm = 35 °C; Figure 3b). A similar behavior was noticed for the ps assembly of ODN-5 and ODN-6 with only one 3′-d(C)5 tail (Figure 3a). From this, we concluded that the biphasic melting behavior of the assemblies ODN-5·ODN-6, as well as ODN7·ODN-8, results from a combination of ps duplex melting (low Tm) and i-motif dissociation (high Tm). This assumption is supported by the monophasic melting behavior of ps duplex ODN-1·ODN-2 without dC-tails, which shows only the low Tm value and the observation that i-motif melting is associated with hysteresis. Details on the composition of the assemblies are discussed in the next section. It has been reported that reconstitution of the i-motif assembly from the individual strands of oligonucleotide 5′-

■

RESULTS AND DISCUSSION For the construction of chimeric DNA, a number of oligonucleotides (ODNs) 1−12 was synthesized by phosphoramidite solid-phase synthesis (Table 1). We designed two series of oligonucleotides containing dA-dT sequence elements, which are able to form duplexes with either parallel or antiparallel chain orientation (Table 1).11,13,14 Moreover, these chimeric oligonucleotides comprise d(C)2 or d(C)5 tracts at both ends (5′ and 3′) or only at the 3′-end. For comparison, duplexes without dC tracts (ps ODN-1·ODN-2 and aps ODN1·ODN-9) were prepared. The oligonucleotides were purified by reversed-phase HPLC and characterized by MALDI-TOF mass spectra (Table S1, Supporting Information) as well as by PAGE. Analysis of Assemblies by Thermal Melting. To shed light into the composition of the particular assemblies, hybridization studies were performed in solution applying 4198


Biomacromolecules

Article

Figure 3. Dissociation and association profiles of DNA assemblies formed by chimeric DNA employing ps duplexes measured at 260 nm with 2.5 + 2.5 μM single-strand concentration in 100 mM NaH2PO4 at pH 6.0. Upper part: (a) ps ODN-5·ODN-6, (b) ps ODN-7·ODN-8. Lower part: illustration of the assemblies. C represents dC.

dimer pathway). (iii) The formation of nonstable intermediates by incorrect alignment of the d(C)5 tracts.37 When the kinetics for the intermolecular i-motif reassociation of individual strands (5′-d[TCCCCC]) was compared with the intramolecular imotif assembly of the closely related hairpin (5′-d[(C5T3)3C5]), the kinetics of intramolecular tetraplex formation was significantly accelerated. It was calculated that the process of i-motif formation is driven by favorable enthalpy as well as by entropy changes that are different to those of duplex association.37 We observed that the reassembly of our chimeric molecules into the i-motif is quick compared to those without duplex elements [5′-d(TCCCCC) (13)], even when a higher single strand concentration (22.5 μM) was used for the annealing of 13 (Figure 4 and Figure S8, Supporting Information). On the contrary, in the case of our hybrid molecules, only a short incubation time of 10 min at 15 °C between two heating experiments was necessary to afford almost identical melting profiles to the initial ones (Figure 3). The fast reassembly kinetics of our ps hybrid molecules shows a relationship to the intramolecular i-motif assembly of the above-mentioned hairpin. As all i-motif elements are present in one strand, the assembly is driven by a favorable entropy change, and the formation of misaligned, kinetically trapped intermediates is prevented.37 In our studies, the i-motifs of the ps hybrid molecules are also quickly formed. This process is certainly accelerated by the rapid duplex formation resulting in a preorganization of base paired dC tails. These paired dC tails are already intermediates of the i-motif formation pathway and represent one-half of the correct aligned i-motif assembly. Thus,

Figure 4. Melting curve of 5′-d(TCCCCC)4 (13) measured at 260 nm with 22.5 μM single-strand concentration at pH 6.0 in 100 mM NaH2PO4 buffer.

d(TCCCCC) to the tetrameric motif 5′-d(TCCCCC)4 took several days.19,37 Moreover, the phenomenon of hysteresis observed for i-motif association (cooling) and dissociation (heating) is consistent with kinetic data reported earlier.37−39 This is different to the reannealing kinetics of short oligonucleotide duplexes which associate in the order of milliseconds. According to Breslauer et al., three main events account for the slow reassociation kinetics of tetrameric i-motif structures: (i) Hemiprotonation of cytosines at a pH value several pH units above the pKa of free cytosine (pH 4.5). (ii) The collision of two ps duplexes in a correct orientation, thereby forming the tetrameric i-motif assembly (dimer of 4199


Biomacromolecules

Article

due to overlapping Tm values for the ps duplex and i-motif, while hysteresis is still maintained for the dissociation and association profiles (Tm = 40 °C upon heating vs Tm = 30 °C upon cooling, Figure 5b). However, at pH 7.0, only duplex melting was observed (identical Tm values for dissociation and association). Comparable findings were also obtained for ps ODN-5·ODN-6 (Figure S3, Supporting Information). Consequently, the parallel stranded duplex units significantly contribute to the association and stabilization of the tetrameric i-motif structure. Oligonucleotides with dC-Tails Forming Antiparallel Stranded Duplexes and i-Motif Assemblies. The situation is different for hybrid molecules containing aps duplex DNA elements (aps ODN-5·ODN-11 and aps ODN-7·ODN-12). Also, in these cases, stable i-motifs were formed at pH 6.0, and in both cases, hysteresis was observed between heating and cooling profiles due to the slow association kinetics of i-motif formation (Figure 6). Nevertheless, the difference of Tm values is much less (2−5 °C for aps ODN-5·ODN-11 and aps ODN7·ODN-12) compared to 18−19 °C difference of the corresponding ps hybrid molecules (ps ODN-5·ODN-6 and ps ODN-7·ODN-8; Table 1) as the aps duplex unit is more stable than the ps duplex unit. At higher pH values, the aps hybrid molecules lost their ability to form i-motif structures, which is reflected by their melting profiles, not showing hysteresis anymore upon association and dissociation (Figure S6 and S7, Supporting Information). As mentioned before, this is different to ps hybrid molecules ODN-5·ODN-6 and ODN7·ODN-8 still forming i-motif structures up to pH 6.8. This differential behavior supports the assumption that the assembly into i-motif structures is less favorable for the aps hybrid molecules than for ps hybrid DNA. Apparently, the more stable aps duplex element of the aps hybrid molecules have a less stabilizing effect on the i-motif assembly than the less stable ps duplexes. We anticipate that preorganization of base-paired dCtails in the case of ps hybrid molecules is beneficial for i-motif formation, even under unfavorable conditions (high pH). Analysis of Assemblies by Polyacrylamide Gel Electrophoresis. Native polyacrylamide gel electrophoresis (PAGE) has been used earlier to monitor and differentiate between various multistranded structures, including triplexes and G-quadruplexes, as well as i-motifs.24,40−42 Herein, we used native PAGE to analyze the assemblies formed by the DNA hybrid molecules with ps or aps duplex elements, and the results were correlated to those obtained from the thermal melting experiments. PAGE was carried out in Tris-acetate buffer (0.112 mol/L) at pH 6.0 or 6.8. The oligonucleotide samples were incubated in buffer A or C (100 mM NaH2PO4, pH 6.0 or pH 6.8) for 2−3 or 21 days at 4 °C. Figure 7 summarizes the experiments performed with hybrid molecules with ps and aps duplex elements at pH 6.0. Hybridization of oligonucleotides with one 3′-d(C)5 tail, namely, ODN-5 with ODN-6 or ODN-11, gave in each case one distinct band of comparable mobility (Figure 7, lanes 2 and 3), which were correlated to tetrameric i-motif structures. iMotif formation of assemblies containing either ps (ODN5·ODN-6) or aps (ODN-5·ODN-11) duplexes is in accordance to the results obtained from melting studies performed at pH 6.0 (Figure 3a and Figure 6a). For the assemblies formed upon hybridization of ODN-7 with ODN-8 (ps; lane 4) and ODN-7 with ODN-12 (aps; lane 5) containing two d(C)5 tails, the situation was entirely different. No distinct bands were observed. Instead, a slow migrating smear of bands was

Figure 5. Dissociation and association profiles of ps ODN-7·ODN-8 measured at 260 nm with 2.5 + 2.5 μM single-strand concentration at different pH values in 100 mM NaH2PO4 buffer: (a) pH 6.4, (b) pH 6.8, and (c) pH 7.0.

the kinetics of i-motif formation is much faster compared to that of an assembly formed by four individual strands. Upon pH increase, the melting profile of the assembly notably changes as demonstrated for ps ODN-7·ODN-8 (Figure 5). Biphasic melting is still observed at pH 6.4, however, with a reduced Tm value for the i-motif connector (Table 1). Even when the pH is increased further away from the pKa of free cytosine, reaching to almost neutral conditions (pH 6.8), i-motif structures were still formed, though they were markedly destabilized. Only one Tm value is found at pH 6.8 4200


Biomacromolecules

Article

Figure 6. Dissociation and association profiles of DNA assemblies formed by chimeric DNA employing aps duplexes measured at 260 nm with 2.5 + 2.5 μM single-strand concentration in 100 mM NaH2PO4 at pH 6.0. Upper part: (a) aps ODN-5·ODN-11, (b) aps ODN-7·ODN-12. Lower part: illustration of the assemblies. C represents dC.

conditions (pH 6.8), which are unfavorable for hemiprotonated base pairing. Figure 8b displays the results of the PAGE experiments performed with aps hybrid molecules. The aps hybrid molecules ODN-5·ODN-11 (lane 4) as well as ODN7·ODN-12 (lane 7) showed entirely duplex formation; bands corresponding to i-motif assemblies were not detected. Contrary to the above-described results for the ps hybrid molecules, even upon a prolonged incubation time (21 days), the aps hybrid molecules could not assemble into i-motif structures (Figure S10, lanes 3 and 6; Supporting Information). These findings are in line with the thermal melting experiments, in which the absence of hysteresis indicated only duplex formation for aps hybrid molecules at pH 6.8. In both cases (ps and aps hybrid molecules), the results obtained by native PAGE match the findings obtained by thermal melting. Stabilization of the hybrid molecules is apparently stronger when the duplex element has parallel chain orientation. The gel electrophoresis studies clearly indicate that oligonucleotide hybrid molecules such as ODN-7·ODN-8 or ODN-7·ODN-12 incorporating ps or aps duplexes, respectively, and bearing d(C) 5 tails at both ends of the oligonucleotides, aggregate to large oligomeric assemblies via i-motif formation. The assemblies with parallel stranded DNA units are still formed at almost neural conditions (pH 6.8), while assemblies incorporating antiparallel stranded DNA

detected (Figure 7). The smeared bands resulted from the formation of supramolecular structures (sms) induced by many i-motif interactions as displayed in Figure 3b for ODN-7·ODN8 and in Figure 6b for ODN-7·ODN-12. In a subsequent series of experiments, native PAGE was carried out at higher pH values (pH 6.8), which are further away from the pKa of 2′-deoxycytidine (pH 4.5). For oligonucleotides having short 5′- and 3′-d(C)2 tails (ODN-3, ODN-4 and ODN-10), only duplex formation was observed (ps ODN-3·ODN-4 and aps ODN-3·ODN-10; see Supporting Information, Figure S9). For ps ODN-5·ODN-6 (only 3′-d(C)5 tail) two distinct bands appeared that moved slower than the corresponding single strands (Figure 8a). The faster migrating band corresponds to the ps duplex, while the slower migrating band was assigned to a tetrameric i-motif assembly (for comparison, see ps duplex ODN-3·ODN-4; Figure S9, lane 4; Supporting Information), showing that the parallel stranded duplex and the tetrameric i-motif assembly were coexisting. Prolongation of the incubation time (21 days) facilitated formation of the i-motif assembly; only the slower migrating band corresponding to the i-motif was detected (Figure S10, lane 3; Supporting Information). Most interestingly, for ps ODN-7·ODN-8 with 3′- and 5′-d(C)5 tails, already after 2 days, exclusively multimeric i-motif assemblies were detected (smear of bands; Figure 8a, lane 7). The results obtained for the ps hybrid molecules stress the contribution of stabilization by the parallel stranded duplex toward i-motif assembly under pH 4201


Biomacromolecules

Article

Figure 7. Left: native PAGE analysis of oligonucleotides and their assemblies at pH 6.0. Lanes 1, ODN-11 (ss); 2, ODN-5·ODN-6 (i-motif); 3, ODN-5·ODN-11 (i-motif); 4, ODN-7·ODN-8 (multimeric i-motif assembly); 5, ODN-7·ODN-12 (multimeric i-motif assembly). All samples were incubated at pH 6.0 and 4 °C for 3 days. Right: schematic illustration of oligonucleotides and their assemblies. Red color indicates hemiprotonated dCH+-dC base pairs, and blue color refers to non-base-paired dC residues.

parallel stranded duplex elements and i-motif structures can be used for the construction of nanoscopic devices or therapeutic oligonucleotides.

required stronger acidic pH values. It has been reported earlier that related cytidine-rich oligonucleotides without duplex DNA units can be used as DNA scaffolds for the fabrication of nanometric devices.32,33,43 However, the usage of short d(C)20 tracts for the construction of nanostructures was found to be extremely difficult due to the pH sensitive properties of i-motif structures losing their ability to fold into i-motif assemblies at pH values above 6.32 The application of our hybrid molecules, consisting of parallel stranded duplex elements and cytidinerich tracts, constitutes a robust and pH desensitized alternative for the construction of nanostructured scaffolds up to almost neutral conditions.

■

ASSOCIATED CONTENT

S Supporting Information *

Molecular masses of oligonucleotides, additional melting profiles, and native PAGE experiments. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

■

*Phone: +49 (0)251 53 406 500. Fax: +49 (0)251 53 406 857. E-mail: [email protected].

CONCLUSIONS Chimeric DNA with ps and aps duplex elements was designed and synthesized. Oligonucleotides with short d(C)2 tails were not capable of forming i-motif assemblies. However, the double helix was stabilized under slightly acidic conditions, when the duplex elements showed parallel chain orientation (“clamp” effect), while antiparallel duplexes were not stabilized. This confirms hemiprotonated dCH+-dC base pair formation in ps hybrid molecules. Chimeric DNA with ps duplex elements and d(C)5 tails at one or at both ends easily assemble into tetrameric i-motif structures. Molecules with two terminal d(C)5 tails formed multimeric assemblies. The preorganized parallel stranded duplexes contribute to the stabilization of tetrameric i-motif assemblies up to almost neutral conditions (pH 6.8), as evidenced by thermal melting experiments and PAGE. On the contrary, aps hybrid molecules were only able to aggregate into multimeric assemblies when acidic conditions were applied (pH 6.0). Although ps DNA is less stable than aps DNA, the aps duplexes contribute less to the stability of i-motif assemblies than ps DNA elements. We anticipate that pH robust multimeric assemblies of chimeric DNA composed of

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We appreciate critical reading of the manuscript by Dr. P. Leonard and thank Mr. N.-Q. Trân for the synthesis of oligonucleotides. Financial support by ChemBiotech, Münster, Germany, is highly appreciated.

■

REFERENCES

(1) Frank-Kamenetskii, M. D.; Mirkin, S. M. Annu. Rev. Biochem. 1995, 64, 65−95. (2) Burge, S.; Parkinson, G. N.; Hazel, P.; Todd, A. K.; Neidle, S. Nucleic Acids Res. 2006, 34, 5402−5415. (3) Guéron, M.; Leroy, J.-L. Curr. Opin. Struct. Biol. 2000, 10, 326− 331. (4) Seela, F.; He, Y.; Wei, C. Tetrahedron 1999, 55, 9481−9500. (5) Seela, F.; Wei, C. Helv. Chim. Acta 1999, 82, 726−745. (6) Seela, F.; He, Y. Helv. Chim. Acta 2000, 83, 2527−2540. (7) Seela, F.; Peng, X.; Li, H. J. Am. Chem. Soc. 2005, 127, 7739− 7751.

4202


Biomacromolecules

Article

Figure 8. (a) Native PAGE analysis of oligonucleotides and their ps assemblies at pH 6.8 (left) and their schematic illustration (right). Lanes 1, DNA ladder (100 bp); 2, ODN-5 (ss); 3, ODN-6 (ss); 4, ODN-5·ODN-6 (ps duplex and i-motif); 5, ODN-7 (ss); 6, ODN-8 (ss); 7, ODN-7·ODN-8 (multimeric i-motif assembly). (b) PAGE analysis of oligonucleotides and their aps assemblies at pH 6.8 (left) and their schematic illustration (right). Lanes 1, DNA ladder (100 bp); 2, ODN-5 (ss); 3, ODN-11 (ss); 4, ODN-5·ODN-11 (aps duplex); 5, ODN-7 (ss); 6, ODN-12 (ss); 7, ODN-7·ODN-12 (aps duplex). All samples were incubated at pH 6.8 and 4 °C for 2 days. Illustration: Red color indicates hemiprotonated dCH+-dC base pairs, and blue color refers to non-base-paired dC residues. (16) Gehring, K.; Leroy, J.-L.; Guéron, M. Nature 1993, 363, 561− 565. (17) Kang, C.; Berger, I.; Lockshin, C.; Ratliff, R.; Moyzis, R.; Rich, A. Proc. Natl. Acad. Sci. U.S.A. 1994, 91, 11636−11640. (18) Kang, C.; Berger, I.; Lockshin, C.; Ratliff, R.; Moyzis, R.; Rich, A. Proc. Natl. Acad. Sci. U.S.A. 1995, 92, 3874−3878. (19) Leroy, J.-L.; Gehring, K.; Kettani, A.; Guéron, M. Biochemistry 1993, 32, 6019−6031. (20) Chen, L.; Cai, L.; Zhang, X.; Rich, A. Biochemistry 1994, 33, 13540−13546. (21) Winfree, E.; Liu, F.; Wenzler, L. A.; Seeman, N. C. Nature 1998, 394, 539−544. (22) Seeman, N. C.; Lukeman, P. S. Rep. Prog. Phys. 2005, 68, 237− 270.

(8) Geinguenaud, F.; Mondragon-Sanchez, J. A.; Liquier, J.; Shchyolkina, A. K.; Klement, R.; Arndt-Jovin, D. J.; Jovin, T. M.; Taillandier, E. Spectrochim. Acta, Part A 2005, 61, 579−587. (9) Shchyolkina, A. K.; Borisova, O. F.; Livshits, M. A.; Jovin, T. M. Mol. Biol. 2003, 37, 223−231. (10) Rippe, K.; Jovin, T. M. Methods Enzymol. 1992, 211, 199−220. (11) Ramsing, N. B.; Jovin, T. M. Nucleic Acids Res. 1988, 16, 6659− 6676. (12) Rippe, K.; Jovin, T. M. Biochemistry 1989, 28, 9542−9549. (13) Ramsing, N. B.; Rippe, K.; Jovin, T. M. Biochemistry 1989, 28, 9528−9535. (14) Rentzeperis, D.; Kupke, D. W.; Marky, L. A. Biochemistry 1994, 33, 9588−9591. (15) Akinrimisi, E. O.; Sander, C.; Ts’o, P. O. P. Biochemistry 1963, 2, 340−344. 4203


Biomacromolecules

Article

(23) Qing, G.; Xiong, H.; Seela, F.; Sun, T. J. Am. Chem. Soc. 2010, 132, 15228−15232. (24) Tumpane, J.; Kumar, R.; Lundberg, E. P.; Sandin, P.; Gale, N.; Nandhakumar, I. S.; Albinsson, B.; Lincoln, P.; Wilhelmsson, L. M.; Brown, T.; Nordén, B. Nano Lett. 2007, 7, 3832−3839. (25) Marsh, T. C.; Vesenka, J.; Henderson, E. Nucleic Acids Res. 1995, 23, 696−700. (26) Yang, Y.; Zhou, C.; Zhang, T.; Cheng, E.; Yang, Z.; Liu, D. Small 2012, 8, 552−556. (27) Seela, F.; Budow, S.; Leonard, P. Org. Biomol. Chem. 2007, 5, 1858−1872. (28) Cheng, E.; Xing, Y.; Chen, P.; Yang, Y.; Sun, Y.; Zhou, D.; Xu, L.; Fan, Q.; Liu, D. Angew. Chem., Int. Ed. 2009, 48, 7660−7663. (29) Yang, Y.; Liu, G.; Liu, H.; Li, D.; Fan, C.; Liu, D. Nano Lett. 2010, 10, 1393−1397. (30) Laisné, A.; Pompon, D.; Leroy, J.-L. Nucleic Acids Res. 2010, 38, 3817−3826. (31) Guittet, E.; Renciuk, D.; Leroy, J.-L. Nucleic Acids Res. 2012, 40, 5162−5170. (32) Zikich, D.; Liu, K.; Sagiv, L.; Porath, D.; Kotlyar, A. Small 2011, 7, 1029−1034. (33) Ghodke, H. B.; Krishnan, R.; Vignesh, K.; Kumar, G. V. P.; Narayana, C.; Krishnan, Y. Angew. Chem., Int. Ed. 2007, 46, 2646− 2649. (34) Ming, X.; Ding, P.; Leonard, P.; Budow, S.; Seela, F. Org. Biomol. Chem. 2012, 10, 1861−1869. (35) Seela, F.; Budow, S. Helv. Chim. Acta 2006, 89, 1978−1985. (36) Parvathy, V. R.; Bhaumik, S. R.; Chary, K. V. R.; Govil, G.; Liu, K.; Howard, F. B.; Miles, H. T. Nucleic Acids Res. 2002, 30, 1500− 1511. (37) Völker, J.; Klump, H. H.; Breslauer, K. J. Biopolymers 2007, 86, 136−147. (38) Robidoux, S.; Klinck, R.; Gehring, K.; Damha, M. J. J. Biomol. Struct. Dyn. 1997, 15, 517−527. (39) Mergny, J.-L.; Lacroix, L.; Han, X.; Leroy, J.-L.; Hélène, C. J. Am. Chem. Soc. 1995, 117, 8887−8898. (40) Kaushik, M.; Prasad, M.; Kaushik, S.; Singh, A.; Kukreti, S. Biopolymers 2009, 93, 150−160. (41) Pedroso, I. M.; Duarte, L. F.; Yanez, G.; Burkewitz, K.; Fletcher, T. M. Biopolymers 2007, 87, 74−84. (42) Manzini, G.; Yathindra, N.; Xodo, L. E. Nucleic Acids Res. 1994, 22, 4634−4640. (43) Xu, Y.; Hirao, Y.; Nishimura, Y.; Sugiyama, H. Bioorg. Med. Chem. 2007, 15, 1275−1279.

4204


Construction and Assembly of Chimeric DNA: Oligonucleotide Hybrid

Recommend Documents