Controllably Prepared AptamerâMolecularly Imprinted Polymer Hybrid

Subscriber access provided by WEBSTER UNIV

Article

Controllably Prepared Aptamer-Molecularly Imprinted Polymer Hybrid for High-Specificity and High-Affinity Recognition of Target Proteins Wei Li, Qi Zhang, Yijia Wang, Yanyan Ma, Zhanchen Guo, and Zhen Liu Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.9b00465 • Publication Date (Web): 03 Mar 2019 Downloaded from http://pubs.acs.org on March 4, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Controllably Prepared Aptamer-Molecularly Imprinted Polymer Hybrid for High-Specificity and High-Affinity Recognition of Target Proteins Wei Li, Qi Zhang, Yijia Wang, Yanyan Ma, Zhanchen Guo, and Zhen Liu*

State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210023, China

* Corresponding author: [email protected]

1

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract: Molecularly imprinted polymers (MIPs) and aptamers, as effective mimics of antibodies, can overcome only some drawbacks of antibodies. Since they have their own advantages and disadvantages, the combination of MIPs with aptamers could be an ideal solution to produce hybrid alternatives with improved properties and desirable features. Although quite a few attempts have been made in this direction, facile and controllable approach for the preparation of aptamer-MIP hybrids still remains lacking. Herein, we present a new approach for facile and controllable preparation of aptamer-MIP hybrids for high-specificity and high-affinity recognition towards proteins. An aptamer that can bind the glycoprotein alkaline phosphatase (ALP) with relative weak affinity and specificity was used as a ligand, and controllable oriented surface imprinting was carried out with in-water self-polymerization system of dopamine. A thin-layer of polydopamine was formed to cover the template to an appropriate thickness. After removing the template from the polymer, an aptamer-MIP hybrid with apparently improved affinity and specificity toward ALP was obtained, giving cross-reactivity of 3.2~5.6% and a dissociation constant of 1.5 nM. With this aptamer-MIP hybrid, a plasmonic immunosandwich assay (PISA) was developed. Reliable detection of ALP in human serum by the PISA was demonstrated.

Keywords: Aptamer, molecularly imprinted polymer, protein, molecular recognition, immunoassay

2


Page 2 of 32

Page 3 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Biomolecular recognition plays important roles in living systems. Reagents and materials for biomolecular recognition are important tools for life science studies. Although antibodies have been the workhorses for biomolecular recognition in many practical applications due to their specificity and affinity towards antigens, they suffer from apparent drawbacks such as poor stability and high cost.1-2 Therefore, development of antibody alternatives holds significant importance. Molecularly imprinted polymers (MIPs),3-15 which are chemically synthesized through the polymerization of appropriate functional monomers as well as cross-linkers in the presence of a template, have been important alternatives of antibodies. Due to the presence of imprinted cavities with complementary 3D shape and functionality, MIPs exhibit specificity and affinity towards the templates. As compared with antibodies, MIPs are easier in preparation, more cost efficient and more stable. Due to these merits, MIPs have found important applications such as chromatographic separation,16,17 chemical sensing,18-20 and sample pretreatment.21 In addition, aptamers, short single-stranded DNAs or RNAs, are also important alternatives of antibodies. Aptamers are usually selected by the process of systematic evolution of ligands by exponential enrichment (SELEX).22,23 The binding of aptamers to target molecules is based on the diversity of single-stranded nucleic acid structures and spatial conformations. Aptamers exhibit many merits, such as, in vitro production, biological compatibility, convenient modification and wide range potential targets.24-30 However, aptamers are often associated with inadequate affinity and specificity due to their dynamic structures. Since MIPs and aptamers can overcome only some drawbacks of antibodies and they have their own advantages and disadvantages, the combination of MIPs and aptamers could be an ideal 3



solution to produce hybrid alternatives with improved properties and desirable features. Some attempts have been made in this direction. Through electropolymerization, Hianik et al.31 synthesized an aptamer-MIP hybrid as an electrochemical sensor for the detection of thrombin. Spivak et al.32 developed an aptamer-based hydrogel specific to target proteins, showing volume shrinking visible to the naked eye down to femtomolar concentrations of proteins. Using a new method called double imprinting, they33 further developed a super-aptamer hydrogel that is specific to the Apple Stem Pitting Virus (ASPV) with light diffraction detectable by the naked eye to the concentrations as low as 10 ng/mL. Turner et al.34 developed aptamer-MIP hybrid nanoparticles (AptaMIP NPs) via modification of the chemical structure of the DNA. It was demonstrated that the introduction of this modified ‘aptamer monomer’ resulted in an increase of the affinity of the produced MIP NPs. Apart from these, a variety of other forms of aptamer-MIP hybrids have been developed for the detection of antibiotic,35,36 small molecules,37,38 and proteins.39-43 However, facile and controllable approach for the preparation of aptamer-MIP hybrids still remains lacking. Recently, our group has developed a facile and efficient method called boronate affinity controllable oriented surface imprinting.44,45 Since appropriate imprinting layer thickness can be prepared controllably, this approach allows for easy and efficient preparation of MIPs with high specificity and high affinity for the recognition of a range of cis-diol-containing compounds including glycoproteins, glycans and monosaccharides. This inspired us to explore new imprinting approaches of similar fashion for facile and controllable preparation of aptamer-MIP hybrids with improved binding properties.

4


Page 4 of 32

Page 5 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Herein, we present a new approach for facile and controllable preparation of aptamer-MIP hybrids for high-specificity and high-affinity recognition towards proteins. The principle and procedure of this approach is schematically illustrated in Figure 1. An aptamer that can recognize a target protein with relatively poor affinity and specificity is used as a sole ligand and facilely immobilized onto a gold thinlayer coated substrate through the formation of S-Au bond. Prior to the immobilization, the aptamer is functionalized with a SH group on its 3’-end. Controllable oriented surface imprinting is then carried out through in-water self-polymerization of dopamine. A thin-layer of polydopamine is formed to cover the template to an appropriate thickness. The selfpolymerization system of dopamine is chosen because according to Messersmith et al,46 the thickness evolution of polydopamine coating obeys a linear correlation with the polymerization time within initial several hours (a reconstructed linear fitting for initial 6 hours of polymerization is shown in Figure S1). In addition, polydopamine is a very promising polymer for bioapplications due to its biocompatibility,47-49 which can ensure that the prepared MIPs exhibit very lower nonselective adsorption. Furthermore, the polymerization occurs in a pure aqueous system, which helps keeping the target protein at its original conformation. After removing the template from the polymer with an appropriate solution to disrupt the interaction between the template and the aptamer, an aptamer-MIP hybrid with apparently improved affinity and specificity towards the target protein is obtained. In order to characterize the binding properties of the aptamer-MIP hybrid obtained, a plasmonic immunosandwich assay (PISA) method50,51 we reported previously was employed. It is based on ultrasensitive Plasmon-enhanced Raman scattering (PERS) detection. In this work, the glycoprotein alkaline phosphatase (ALP) was used as a target molecule. An aptamer 5



Page 6 of 32

selected previously52 was utilized as a ligand for the imprinting. For PERS detection, ALP molecules captured by the aptamer alone or the aptamer-MIP hybrid were labelled with boronate affinity silver-based Raman nanotags, and thus sandwich-like complexes were formed on the substrates. Upon being shined with a laser beam, the gold-based substrate generated surface plasmon, which excited the silver-based Raman nanotags to generate PERS signal (Figure S2). Through PISA method, we verified that the specificity and affinity of the prepared aptamer-MIP hybrid are apparently improved as compared with the aptamer itself. Using the aptamer-MIP hybrid-based PISA method, quantification of ALP in hepatocarcinoma patient serum sample was achieved, which demonstrated the feasibility of the aptamer-MIP hybrid for practical applications. The imprinting approach can be extended to other protein targets.

EXPERIMENTAL SECTION Reagents and Materials. Anhydrous ethanol, tris(hydroxymethyl)aminomethane (Tris), glycine, sodium chloride (NaCl), magnesium chloride (MgCl2), zinc chloride (ZnCl2), potassium chloride (KCl), chloroauric acid (HAuCl4·4H2O), silver nitrate, and ammonia solution (28% w/v) were purchased from Nanjing Reagent Company (Nanjing, China). Sodium dodecyl sulfate (SDS), paminothiophenol (PATP), RNase B, β-casein and mercaptohexanol were all purchased from Sigma (St. Louis, MO, USA). Tetraethoxysilane (TEOS, 99%) was from Heowns Biochemical Technologies

(Tianjin,

China).

3-Aminopropyltriethoxysilane

(APTES,

98%),

sodium

cyanoborohydride (95%), and dopamine hydrochloride (98%) were from J&K Scientific (Beijing, 6


Page 7 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


China). Horseradish peroxidase (HRP), sodium hydroxide (NaOH), and glacial acetic acid (HAc) were purchased from Sinopharm Chemical Reagent (Shanghai, China). 4-Formylphenylboronic acid (FPBA, 97%) was purchased from Aladdin Industrial Corporation (Shanghai, China). Sulfuric acid (98%), hydrogen peroxide (30%), potassium bicarbonate (KHCO3), trisodium citrate, and hydrochloric acid (36%) were purchased from Shanghai Lingfeng Chemical Reagent (Shanghai, China). All other reagents used were of analytical grade or higher unless otherwise specified. Alkaline phosphatase (ALP) (EC 3.1.3.1, specific activity: 4500 U/mg) from calf intestinal mucosa was obtained from Heowns Biochemical Technologies (Tianjin, China). The 3'-thiol modified ALP binding aptamer was purchased from Sangon (Shanghai, China), which had a sequence as 5'CTTCTGCCCGCCTCCTTCCTGGAGGACTGTGGAGGACTTAGCGCCCATCCTTGCCCAT GGAGACGAGATAGGCGGACACT-(CH2)6-SH-3'. Human serum from healthy adult was purchased from Shuangliu Zhenglong Biochemical Products Lab (Sichuan, China). Human serums from a hepatocarcinoma patient was collected at the Drum Tower Hospital. Phosphate-buffered saline (1× PBS) was obtained from Keygen Biotech (Nanjing, China). Water used in all the experiments was purified with a Milli-Q Advantage A10 ultrapure water purification system (Millipore, Milford, MA). Glass slides (75 mm × 25 mm) were purchased from the Shanghai Machinery Import and Export Corporation (Shanghai, China).

Instruments. Transmission electron microscopic (TEM) characterization was performed on a JEM-1011 TEM instrument (JEOL, Tokyo, Japan). UV-vis absorbance characterization was carried out on a Nanodrop-2000C instrument (Thermo Fisher Scientific, Shanghai, China). 7



Plasmonic detection was carried out on a Renishaw InVia Reflex confocal microscope (Renishaw, UK) equipped with a high-resolution grating with 1800 grooves/cm, additional band-pass filter optics, and a CCD camera. All measurements were carried out using a He-Ne laser (λ0 = 633 nm; laser power at spot, 17 mW). The laser was focused onto the sample by using a ×50 objective (N.A. 0.75), providing a spatial resolution of ca. 1 μm2. Wavelength calibration was performed by measuring silicon wafers through a ×50 objective, evaluating the first-order phonon band of Si at 520 cm−1. The integration time for the Raman measurement was 1 s. Each measurement was repeated at least 20 times at different locations on the spot. Each spectrum was baseline corrected except for the noise test.

Preparation of aptamer-imprinted polymer hybrid. The procedure included the following three major steps. Preparation of Au-coated glass slides. Each glass slide (75 mm ×25 mm) was cut into seven equal pieces (10 mm × 25 mm). Then the glass slides were cleaned by immersion in a freshly prepared piranha solution (H2O2:H2SO4 =1:3, v/v) for 2 h and then rinsed thoroughly with water. The cleaned glass surface was successively amino-modified by soaking in an ethanolic solution of 4% v/v APTES at room temperature for 12 h and then rinsed repeatedly with ethanol and water to remove the unadsorbed APTES from the surface. Next, the slides were immersed in a mixed solution (12 mM HAuCl4, 0.5 M KHCO3, and 25 mM glucose) for 6-8 h at 50 °C (air bath) until an obvious gold layer appeared on the surface of each slide. Then the Au-coated slides were gently washed with water three times, and dried in an oven at 50 °C. 8


Page 8 of 32

Page 9 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Preparation of Aptamer-modified array. Each of the Au-coated glass slides was marked with four circles to form spot arrays. Aliquots of 5 μL of 1 μM ALP aptamer dissolved in 10 mM Tris-HCl buffer (pH 8.5) were dropped to each array. Then the array was incubated for 2 h in a humidity chamber to modify aptamer via Au-S bond, followed by rinsing with 10 mM Tris-HCl buffer (pH 8.5) three times to remove the unadsorbed aptamer from the surface. After that, the aptameranchored array was immersed into an aqueous solution of 1 mM mercaptohexanol at room temperature for 1 h to seal the surface that was not immobilized with the aptamer. Finally, the glass slide was rinsed repeatedly with water to remove the residual reagents from the surface, dried at 40 °C and then stored at room temperature for further use. Preparation of ALP aptamer-MIP hybrid-coated array. To immobilize the template onto the substrate, aliquots of 5 μL of 1500 U/mL ALP dissolved in 50 mM glycine-NaOH buffer (pH 9.5) were dropped to each spot of the aptamer-modified array. Then the array was incubated for 30 min in a humidity chamber to form a thin template layer, followed by rinsing with 50 mM glycineNaOH buffer (pH 9.5) three times to remove the uncaptured template. The molecular imprinting progress was carried out according to the following procedure. The template-anchored array was immersed into 10 mM Tris-HCl buffer (pH 8.5) containing 2.0 mg/mL dopamine under a constant shaking at room temperature for 50, 60, 70, 80 and 90 min for optimization of the imprinting time. The polymerization reaction generated an adherent polydopamine layer on the substrates. Finally, the template was removed by rinsing with 0.1 M HAc containing 10% SDS (w/v) for 12 h. The removal of the template molecules left behind well-defined imprinted cavities to rebind the target molecules specifically. To ensure the complete removal of the surfactant, the imprinted substrate 9



was washed with water and air-dried. To prepare non-imprinted polymer (NIP)-coated array for comparison, the processing procedure was the same except that no template was immobilized onto the aptamer-modified array.

Preparation of Raman nanotags. The boronic acid modified silver nanoparticles (AgNPs) were used as Raman nanotags. The preparation route is shown in Figure S3. The as-prepared FPBAmodified Ag/PATP@SiO2 NPs were used directly as Raman tags.

Procedure for PISA method. The procedure of PISA with labeling Raman nanotags included three steps: 1) target extraction, 2) labeling with Raman nanotags, and 3) detection. For the extraction, 5-μL aliquots of ALP standard solutions or serum samples were added onto each spot of the extraction arrays and allowed to incubate for 20 min in a humidity chamber, and then washed with 50 mM glycine−NaOH buffer (pH 9.5) twice to remove unwanted species. For the labeling, the arrays were incubated with 5 μL of the Raman nanotags at 37 C for 5 min, and washed with 50 mM glycine−NaOH buffer (pH 9.5) for three times to remove excess nanotags. For the detection, after dried at room temperature, the arrays were subject to the Raman spectrograph for signal readout.

Optimization of template removal time. The template ALP protein was removed by rinsing the imprinted arrays with 0.1 M HAc containing 10% SDS (w/v) for 0 to 15 h with an interval of 3 h. 10


Page 10 of 32

Page 11 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


After residual template molecules on the aptamer-MIP hybrid-coated arrays were labeled with Raman nanotags, the arrays were subject to Raman detection as above described procedure. For comparison, the same procedure was applied to non-imprinted arrays to check the background signal when no template protein was present.

Assay of ALP in hepatocarcinoma patient serum. To demonstrate application to real sample, the concentration of serum ALP was determined via this aptamer-MIP hybrid. The serum samples were centrifuged at 3,000 rpm for 10 min at 4 C, then different amounts of ALP were added to the pretreated hepatocarcinoma patient serum, making the spiked concentrations 100, 200, 500 and 1000 U/L of ALP, respectively. Next, aliquots of 5 μL of the spiked and unspiked serum samples were added onto each spot of the aptamer-MIP hybrid-coated arrays, and the remaining procedure was the same as above-mentioned procedure for PISA with labeling Raman nanotags.

RESULTS AND DISCUSSION Characterization of Raman nanotags. The boronic acid modified uniform size-dispersed AgNPs were used as Raman nanotags in this study, and PATP was used as the Raman reporter. The modification of the Raman nanotags by FPBA allowed for labeling of the target glycoprotein due to the boronate affinity binding with the glycans on the glycoprotein. TEM images and UV−vis spectra of boronic acid-functionalized Ag/PATP@SiO2 NPs are shown in Figure S4. The average diameters of bare AgNPs and Ag/ PATP@SiO2 NPs were about 60 and 80 nm, respectively. For 11



boronic acid-modification on Ag@SiO2 NPs, there was not obvious variation in silica shell thickness. The silica shell thickness of the FPBA-modified Ag/PATP@SiO2 NPs was estimated to be ca. 10 nm. The silica encapsulation led to an obvious redshift in the surface plasmon band of AgNPs. The nanotags exhibited characteristic Raman spectra (Figure S5). It is noteworthy that the characteristic Raman peaks of FPBA-modified Ag/PATP@SiO2 NPs were not contributed directly from PATP but its photocatalytic coupling reaction product, 4,4-dimercaptoazobenzene (DMAB), generated on AgNPs upon laser irradiation. The assignments of the major Raman bands include: the carbon−sulfur (C−S) stretching mode (1072 cm−1), carbon−nitrogen (C−N) stretching mode (1143 cm−1), nitrogen–nitrogen double bond (N=N) stretching mode (1390, 1435 cm−1), and carbon−carbon (C−C) stretching mode (1576 cm−1). The Raman peak at 1435 cm−1 was used for property characterization and quantitative analysis. In this study, we employed glass slides (25 mm × 10 mm) with 4-spot (1 × 4) arrays as the substrates (Figure S6). For wide applications, the substrates can be fabricated into any desired formats with larger numbers of spots for high-throughput assays through some slight technical modifications. To verify successful modification of FPBA on Ag/PATP@SiO2 NPs, the Raman signal intensities of PISA detection of ALP on an aptamer-MIP hybrid using FPBA-functionalized and non-functionalized Ag/PATP@SiO2 NPs as tags were compared. The former generated much stronger signal than the latter did (Figure S7).

12


Page 12 of 32

Page 13 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Optimization of imprinting time. The impact of imprinting time on the imprinting effect was investigated by setting the imprinting time at 50-90 min. The imprinting effect was evaluated in terms of imprinting factor (IF). As shown in Figure 2, the imprinting times all exhibited apparent imprinting effect, giving an IF value of 4.8, 5.5, 9.5, 6.8 and 2.9 for the imprinting time of 50, 60, 70, 80 and 90 min, respectively. Clearly, the imprinting for 70 min is the best while the imprinting for 60 or 80 min is also well acceptable due to their significant imprinting effect. To establish a better understanding of this effect, the thickness evolution of polydopamine coating on Si reported by Messersmith et al.46 within initial 6 hours was re-plotted and a linear relationship between the thickness on the polymerization time was found (Figure S1). Then, the thickness of the imprinting layer at these imprinting times in this study was estimated according to the linear dependence. Although the polydopamine coating was produced on Si surface in the work by Messersmith et al.46 while the imprinting layer was formed on a gold surface in this study, our previous studies suggested that the nature of the substrates did not significantly influence the thicknesspolymerization time dependence.44,53 So, the thickness estimation should be acceptable within a reasonable range. The three dimensions of the ALP molecule is ca. 8.8 × 11.5 × 10.7 nm.54 Assuming the smallest dimension is the imprinting direction, the largest imprinting coverage of the template at the different imprinting times was estimated. The largest template coverage was found to be 60.2, 71.6, 83.0, 94.3 and 105.7% for the imprinting time of 50, 60, 70, 80 and 90 min, respectively (Table S1). Since the optimal imprinting time was 70 min, these results suggest that an intermediate imprinting layer is desirable to obtain good imprinting effect while a much thinner or much thicker imprinting layer generates poor imprinting. More importantly, these results also 13



suggest that the imprinting procedure developed in this study is controllable so that desirable imprinting layer thickness can be simply predicted according to the thickness-polymerization time dependence and the molecular size of the template.

Imprinting efficiency. Imprinting efficiency (IE) is also a critical parameter that describes the performance of the imprinting approach. Plasmonic immunosandwich assays on aptamer-modified and aptamer-MIP hybrid-coated arrays were compared. Both aptamer-modified and aptamer-MIP hybrid-coated arrays exhibited sensitive detection towards ALP (Figure S8). The former exhibited stronger signal than the latter did, suggesting that during the imprinting some immobilized aptamer molecules were buried by the imprinting layer. Such decrease in binding capacity is assigned to unfavorable orientation during imprinting. The IE values were calculated to be approximately 60%, which are excellent for the molecular imprinting of proteins.

Template Removal. Template removal is crucial for the formation of imprinted cavities. The interactions between the template protein with the aptamer and the polydopamine imprinting layer mainly include hydrogen bonding and van der Waals force, which can be disrupted by washing with an acidic solution. As shown in Figure S9, using the acidic washing solution selected, the amount of remained template protein on the imprinted arrays gradually decreased as increasing the washing time and it reached the lowest when the washing time was 15 h. As a comparison, NIPcoated arrays, on which no template protein was present, the background signal was nearly constant, which was comparable to the signal for imprinted arrays after washed for 15 h. It can also be seen 14


Page 14 of 32

Page 15 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


that when the washing time was 12 h, the amount of remained template protein almost reached the lowest, suggesting that the template protein was almost completely removed with wishing for 12 h.

Response curves for ALP. Figure 3 shows binding constant and response curve of ALP. The Raman intensities at 1435cm-1 on aptamer-modified and aptamer-MIP hybrid-coated arrays were detected for different concentrations of ALP. Adsorption isotherms for ALP were established by plotting the intensity at 1435 cm−1 against the logarithm of the ALP concentration. For aptamermodified array, the intensity increased linearly with the logarithm of the concentration of ALP within the range of 15-150000 U/L (y = -1364.96 + 1596.2 x, R2 = 0.997). For aptamer-MIP hybridcoated array, the intensity increased linearly with the logarithm of the concentration of ALP within the range of 1.5-15000 U/L (y = -432.71 + 1221.83 x, R2 = 0.996). The latter relationship was used as a calibration curve for serum sample quantitative analysis. The limit of quantification (LOQ) value of ALP on aptamer-modified array was 15 U/L or 6.2 × 10−11 M, whereas the LOQ on aptamer-MIP hybrid-coated array was 1.5 U/L or 6.2 × 10−12 M. The LOQ value of aptamer-MIP hybrid-coated array is 1 order of magnitude lower than that of aptamer-modified array. From the response-dose curve (Figure 3A), the dissociation constant (Kd) for aptamer-modified array was estimated by the logistic function fitting to be 7.49 × 10−8 M (R2 = 0.995), which is almost equivalent to the capillary electrophoresis-based data previously reported.52 Similarly, from the response−dose curve (Figure 3B), the Kd value for the aptamer-MIP hybrid-coated array was estimated to be 1.49 × 10−9 M (R2 = 0.998). The Kd value of aptamer-MIP hybrid-coated array is 15



50-fold lower than that of aptamer-modified array. The lower dissociation constant for ALP on aptamer-MIP hybrid was attributed to the dual recognition of aptamer and imprinted cavity.

Cross-reactivity. In addition to the binding affinity, cross-reactivity is another essential aspect of molecular recognition reagents or materials. The specificity of aptamer-modified and aptamer-MIP hybrid-coated arrays against a variety of interfering proteins including horseradish peroxidase (HRP, glycoprotein, 40 kDa), RNase B (glycoprotein, 14 kDa), β-casein (nonglycoprotein, 25 kDa) and catalase (nonglycoprotein, 248 kDa) was investigated. The concentration of ALP was 300folds lower than that of the interfering proteins. As shown in Figure 4, both aptamer-modified and aptamer-MIP hybrid-coated arrays exhibited much lower Raman signal intensity toward these interfering proteins as compared with ALP. For aptamer-modified array, the signal intensity for the interfering proteins was ca. 9.112.1% of that for the target protein. While aptamer-MIP hybridcoated array, the signal intensity for the interfering proteins was reduced to only ca. 3.25.6% of that for the target protein, and non-imprinted polymer with polydopamine (aptamer-NIP hybridcoated array) exhibited very little non-selective binding towards any of the test proteins. Since the dependence of the signal intensity on the concentration is not a linear relationship, the values reported herein cannot be directly considered as the value of cross-reactivity. However, these data clearly indicate that the cross-reactivity of aptamer-MIP hybrid-coated array is obviously lower than that of aptamer-modified array. These results suggest that the aptamer-MIP hybrid provided well-formed cavities with shape and functionality complementary towards the target.

16


Page 16 of 32

Page 17 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Real-world applications. Serum ALP has been routinely used in clinical tests as a biomarker to indicate physiologic or pathologic abnormities mainly deriving from hepatic disease and bone disease associated with increased osteoblastic activity.55 Serum ALP is often determined using enzyme activity assay, which is performed in the presence of sample matrix and thereby suffers from interference of sample matrix. It was revealed that the coexistence of glucose and amino acids apparently inhibits the enzyme activity of ALP.56 On the other hand, it was also reported that the presence of human haemoglobin interferes the detection of the enzymatic reaction product.57 Therefore, an approach that avoids the interference of sample matrix can provide more accurate results. In this work, the feasibility of the aptamer-MIP hybrid for the specific extraction of ALP from human serum for the establishment of accurate determination was investigated. We first assumed that the matrix effect can be effectively eliminated due to the high-specificity extraction by the aptamer-MIP hybrid. Aliquot serum samples from a hepatocarcinoma patient unspiked and spiked with standard ALP of varying concentration (ci) were detected by the PISA approach (Figure 5A). The original concentration of ALP (c0) in the unspiked sample was calculated according to the linear calibration curve shown in Figure 3B. The ALP concentration of the unspiked patient serum was calculated to be 213 ± 33 U/L. With the knowledge of this value, we plotted the intensity at 1435 cm−1 against the logarithm of the total concentration of ALP in the spiked samples [log (c0 + ci)]. The obtained plot (Figure 5B) obeyed good linear relationship, which was very close to the calibration curve. So the assumption was verified to be reasonable and the calculated concentration for the unspiked sample was acceptable. Similarly, the serum sample of a healthy individual was 17



also detected, the ALP concentration in the unspiked serum was measured to be 93 ± 22 U/L (Figure S10). Results by the PISA approach and conventional enzyme activity assay58 were compared, which were found to be consistent with each other (Table 1). The current method should be more reliable, due to the sample matrix had been removed from serum sample by the aptamerMIP hybrid.

CONCLUSION To summarize, we have developed a controllable approach for facile preparation of aptamer-MIP hybrids specific towards proteins. Through the PISA method, it was verified that the affinity and specificity of the prepared aptamer-MIP hybrid towards the target were improved as compared with the aptamer alone. These excellent binding properties were attributed to the dual recognition of aptamer and imprinted cavity. Feasibility of the aptamer-MIP hybrid for real sample application was demonstrated. The approach can be extended to the imprinting of other protein targets. Thus, the developed approach opened a new access for facile preparation of aptamer-MIP hybrids with excellent molecular recognition properties.

AUTHOR INFORMATION * Corresponding Author Tel.: +86 25 8968 5639; fax: +86 25 8968 5639.

18


Page 18 of 32

Page 19 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ACKNOWLEDGEMENTS

We acknowledge the financial support from the National Science Fund for Distinguished Young Scholars (No. 21425520), the Key Grants (No. 21627810 and No. 21834003) from the National Natural Science Foundation of China.

ASSOCIATED CONTENT Supporting Information. Experimental details as well as supplementary figures are given in the supporting information.

19



REFERENCES (1)

Baker, M. Nature 2015, 521, 274-276.

(2)

Baker, M. Nature 2015, 527, 545-551.

(3)

Wulff, G.; Sarhan, A. Angew. Chem. Int. Ed. Engl. 1972, 11, 341-345.

(4)

Vlatakis, G.; Andersson, L. I.; Müller, R.; Mosbach, K. Nature 1993, 361, 645-647.

(5)

Kugimiya, A.; Takeuchi, T. Biosens. Bioelectron. 2001, 16, 1059-1062.

(6)

Wan, W.; Biyikal, M.; Wagner, R.; Sellergren, B.; Rurack, K. Angew. Chem. Int. Ed. 2013, 52, 7023-7027.

(7)

Canfarotta, F.; Poma, A.; Guerreiro, A.; Piletsky, S. Nat. Protoc. 2016, 11, 443-455.

(8)

Bompart, M.; Wilde, Y. D.; Haupt, K. Adv. Mater. 2010, 22, 2343-2348.

(9)

Yu, Y.; Ye, L.; Haupt, K.; Mosbach, K. Angew. Chem. Int. Ed. 2002, 41, 4459-4463.

(10) Wulff, G. Angew. Chem. Int. Ed. Engl. 1995, 34, 1812-1832. (11) Wulff, G.; Vesper, W.; Grobe-Einsler, R.; Sarhan, A. Makromol. Chem. 1977, 178, 27992816. (12) Shea, K. J.; Sasaki, D. Y. J. Am. Chem. Soc. 1991, 113, 4109-4120. (13) Takano, E.; Taguchi, Y.; Ooya, T.; Takeuchi, T. Anal. Lett. 2012, 45, 1204-1213. (14) Alexander, C.; Andersson, H. S.; Andersson, L. I.; Ansell, R. J.; Kirsch, N.; Nicholls, I. A.; O’Mahony, J.; Whitcombe, M. J. J. Mol. Recognit. 2006, 19, 106-180. (15) Mosbach, K.; Trends Biochem. Sci. 1994, 19, 9-14. (16) Wang, S. S.; Ye, J.; Bie, Z. J.; Liu, Z. Chem. Sci. 2014, 5, 1135-1140. (17) Benito-Pena, E.; Martins, S.; Orellana, G.; Moreno-Bondi, M. C. Anal. Bioanal. Chem. 2008, 20


Page 20 of 32

Page 21 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


393, 235-245. (18) Liang, R. N.; Song, D. A.; Zhang, R. M.; Qin, W. Angew. Chem. Int. Ed. 2010, 49, 25562559. (19) Alizadeh, T.; Zare, M.; Ganjali, M. R.; Norouzi, P.; Tavana, B. Biosens. Bioelectron. 2010, 25, 1166-1172. (20) Fuchs, Y.; Soppera, O.; Mayes, A.G.; Haupt, K. Adv. Mater. 2013, 25, 566-570. (21) Long, C.; Mai, Z.; Yang, Y.; Zhu, B.; Xu, X.; Lu, L.; Zou, X. J. Chromatogr. A 2009, 1216, 2275-2281. (22) Tuerk, C.; Gold, L. Science 1990, 249, 505-510. (23) Ellington, A. D.; Szostak, J.W. Nature 1990, 346, 818-822. (24) Bagalkot, V.; Farokhzad, O. C.; Langer, R.; Jon, S. Angew. Chem. Int. Ed. Engl. 2006, 45, 8149-8152. (25) Cao, Z.; Tong, R.; Mishra, A.; Xu, W.; Wong, G. C.; Cheng, J.; Lu, Y. Angew. Chem. Int. Ed. Engl. 2009, 48, 6494-6498. (26) Leung, K. H.; He, B.; Yang, C.; Leung, C. H.; Wang, H. M.; Ma, D. L. ACS Appl. Mater. Interfaces 2015, 7, 24046-24052. (27) Jiménez, G. C.; Eissa, S.; Ng, A.; Alhadrami, H.; Zourob, M.; Siaj, M. Anal. Chem. 2015, 87, 1075-1082. (28) Lin, S.; Gao, W.; Tian, Z.; Yang, C.; Lu, L.; Mergny, J. L.; Leung, C. H.; Ma, D. L. Chem. Sci. 2015, 6, 4284-4290. (29) Li, J.; Dai, Y.; Wang, S.; Han, C.; Xu, K. Sens. Actuators B: Chem. 2016, 232, 1-8. (30) Ng, E. W.; Shima, D. T.; Calias, P.; Cunningham, E. T., Jr.; Guyer, D. R.; Adamis, A. P. Nat. Rev. Drug Discov. 2006, 5, 123-132. 21



(31) Evtugyn, G.; Porfireva, A.; Ivanov, A.; Konovalova, O.; Hianik, T. Electroanalysis 2009, 21, 1272-1277. (32) Bai, W.; Gariano, N. A.; Spivak, D. A. J. Am. Chem. Soc. 2013, 135, 6977-6984. (33) Bai, W.; Spivak, D. A. Angew. Chem. Int. Ed. Engl. 2014, 53, 2095-2098. (34) Poma, A.; Brahmbhatt, H.; Pendergraff, H. M.; Watts, J. K.; Turner, N. W. Adv. Mater, 2015, 27, 750-758. (35) Liu, X.; Ren, J.; Su, L.; Gao, X.; Tang, Y.; Ma, T.; Zhu, L.; Li, J. Biosens. Bioelectron. 2016, 87, 203-208. (36) Li, S.; Liu, C.; Yin, G.; Zhang, Q.; Luo, J.; Wu, N. Biosens. Bioelectron. 2017, 91, 687-691. (37) Shahdost-Fard, F.; Roushani, M. Microchim. Acta 2017, 184, 3997-4006. (38) Zhang, Z. J.; Liu, J. W. ACS Appl. Mater. Interfaces 2016, 8, 6371-6378. (39) Tan, J. A.; Guo, M. L.; Tan, L.; Geng, Y. Y.; Huang, S. Y.; Tang, Y. W.; Su, C. C.; Lin, C. C.; Liang, Y. Sens. Actuators B: Chem. 2018, 274, 627-635. (40) Liao, Y. J.; Shiang, Y. C.; Huang, C. C.; Chang, H.T. Langmuir 2012, 28, 8944-8951. (41) Jolly, P.; Tamboli, V.; Harniman, R. L.; Estrel, P.; Allender, C. J.; Bowen, J. L. Biosens. Bioelectron. 2016, 75, 188–195. (42) Ghanbari, K.; Roushani, M. Sens. Actuators B: Chem. 2018, 258, 1066-1071. (43) Shoghi, E.; Mirahmadi-Zare, S. Z.; Ghasemi, R.; Asghari, M.; Poorebrahim, M.; NasrEsfahani, M. H. Microchim. Acta 2018, 185, 241. (44) Bie Z. J.; Chen Y.; Ye J.; Wang S. S.; Liu Z. Angew. Chem. Int. Ed. 2015, 54, 10211-10215. (45) Xing, R. R.; Wang, S. S.; Bie, Z. J.; He, H.; Liu, Z. Nat. Protoc. 2017, 12, 964-987. (46) Lee, H.; Dellatore, S. M.; Miller, W. M.; Messersmith, P. B. Science 2007, 318, 426-430.

22


Page 22 of 32

Page 23 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(47) Ku, S. H.; Ryu, J.; Hong, S. K.; Lee, H.; Park, C. B. Biomaterials 2010, 31, 2535−2541. (48) Hong, S.; Kim, K. Y.; Wook, H. J.; Park, S. Y.; Lee, K. D.; Lee, D. Y.; Lee, H. Nanomedicine 2011, 6, 793−801. (49) Zhou, W. H.; Lu, C. H.; Guo, X. C.; Chen, F. R.; Yang, H. H.; Wang, X. R. J. Mater. Chem. 2010, 20, 880–883. (50) Liu, J.; Yin, D.Y.; Wang, S.S.; Chen, H. Y.; Liu, Z. Angew. Chem. Int. Ed. 2016, 55, 1321513218. (51) Tu, X. Y.; Muhammad, P.; Liu, J.; Ma, Y. Y.; Wang, S. S; Yin, D. Y.; Liu, Z. Anal. Chem. 2016, 88, 12363-12370. (52) Li, X. L.; He, Y. J.; Ma, Y. Y.; Bie, Z. J.; Liu, B. R.; Liu, Z. Anal. Chem. 2016, 88, 98059812. (53) Yin, D. Y.; Wang, S. S.; He, Y. J.; Liu, J.; Zhou, M.; Ouyang, J.; Liu, B. R.; Chen, H Y.; Liu, Z. Chem. Commun. 2015, 51, 17696-17699. (54) Stec, B.; Cheltsov; A.; Millán, J. L. Acta Crystallogr. 2010, 66, 866-870. (55) Romagnoli, E.; Minisola, G.; Carnevale, V.; Scillitani, A.; Frusciante, V.; Aliberti, G.; Minisola, S. Clin. Chem. Lab. Med. 1998, 36, 163-168. (56) Hoylaerts, M. F.; Manes, T.; Millan, J. L. Clin. Chem. 1992, 38, 2493−2500. (57) Bi, X. D.; Liu, Z. Anal. Chem. 2014, 86, 12382-12389. (58) Schumann, G.; Klauke, R.; Canalias, F.; Bossert-Reuther, S.; Franck, P. F. H.; Gella, F. J.; Jorgensen, P. J.; Kang, D. C.; Lessinger, J. M.; Panteghini, M.; Ceriotti, F. Clin. Chem. Lab. Med. 2011, 49, 1439−1446.

23



Captions

Figure 1. Schematic illustration of the principle and procedure for preparing aptamer-MIP hybrid.

Figure 2. Comparison of the Raman intensity of aptamer-MIP hybrid and the imprinting factor at different imprinting time. Error bars represent standard deviations for 3 parallel measurements.

Figure 3. Raman intensity at 1435cm-1 of (A) aptamer-modified and (B) aptamer-MIP hybrid-coated arrays on the different concentration of ALP. Error bars represent standard deviations for 3 parallel measurements.

Figure 4. The selectivity of (A) aptamer-modified and (B) aptamer-MIP hybrid-coated arrays towards different proteins. Error bars represent standard deviations for 3 parallel measurements.

Figure 5. (A) Raman spectra for hepatocarcinoma patient serum samples spiked with known concentration of ALP (the spiked concentration for trace I to V was 0, 100, 200, 500 and 1000 U/L, respectively) and (B) the linear relationship between the Raman intensity and the logarithm of the measured total concentration of ALP in serum samples 24


Page 24 of 32

Page 25 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of the hepatocarcinoma patient. Error bars represent standard deviations for 3 parallel measurements.

25



Figure 1.

26


Page 26 of 32

Page 27 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2.

27



Figure 3.

28


Page 28 of 32

Page 29 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4.

29



Figure 5.

30


Page 30 of 32

Page 31 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Comparison of the ALP concentrations (U/L) measured by the current method and the conventional enzyme activity assay a

a

Sample

Current method

Conventional enzyme activity assay

Healthy individual

93 ±22

116

Hepatocarcinoma patient

213 ±33

190

Conventional enzyme activity assay is the international federation of clinical chemistry (IFCC)

standard method.58 In this method, a certain amount of serum sample is added to a 4-nitrophenyl phosphate (pNPP)-containing test kit. ALP in the sample catalyzes the hydrolysis of pNPP, producing phosphate and free 4-nitrophenol. Under alkaline conditions, 4-nitrophenol is converted to 4-nitrophenoxide ion, which has strong absorption at 405 nm. Measurement of the absorbance allows for the quantification of ALP in the sample.

31



TOC graphic for

Controllably Prepared Aptamer-Molecularly Imprinted Polymer Hybrid for HighSpecificity and High-Affinity Recognition of Target Proteins

Wei Li, Qi Zhang, Yijia Wang, Yanyan Ma, Zhanchen Guo, and Zhen Liu*

32


Page 32 of 32

Controllably Prepared AptamerâMolecularly Imprinted Polymer Hybrid

Recommend Documents

Controllably Prepared AptamerâMolecularly Imprinted Polymer Hybrid