Controlling the Catalytic and Optical Properties of Aggregated

Subscriber access provided by Duquesne University - Gumberg Library

Article

Controlling the Catalytic and Optical Properties of Aggregated Nanoparticles or Semiconductor Quantum Dots Using DNA-Based Constitutional Dynamic Networks Zhixin Zhou, Xia Liu, Liang Yue, and Itamar Willner ACS Nano, Just Accepted Manuscript • DOI: 10.1021/acsnano.8b05452 • Publication Date (Web): 26 Sep 2018 Downloaded from http://pubs.acs.org on September 27, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Controlling the Catalytic and Optical Properties of Aggregated

Nanoparticles

or

Semiconductor

Quantum Dots Using DNA-Based Constitutional Dynamic Networks Zhixin Zhou,‡ Xia Liu,‡ Liang Yue, and Itamar Willner* Institute of Chemistry, The Hebrew University of Jerusalem, Jerusalem 91904, Israel.

ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Nucleic acid-based constitutional dynamic networks, CDNs, attract growing interest as a means to mimic complex biological networks. The triggered stabilization of the CDNs allows the dictated guided reversible reconfiguration and re-equilibration of the CDNs to other CDN configurations, where some of the constituents are up-regulated while other constituents are down-regulated. Although substantial progress in controlling the adaptive dynamic control of the compositions of networks by means of auxiliary triggers was demonstrated, the use of CDNs as active ensembles for controlling chemical functionalities is still a challenge. We report on the assembly of signal-triggered CDN systems that guide the switchable aggregation of Au nanoparticles (NPs) thereby controlling their plasmonic properties and their catalytic functions (Au NPs-catalyzed oxidation of L-DOPA to dopachrome). In addition, we demonstrate that the triggered and orthogonal up-regulation and downregulation of the constituents of the CDNs lead to the dictated aggregation of different-sized CdSe/ZnS quantum dots (QDs), crosslinked by K+-ion-stabilized G-quadruplex units. The incorporation of hemin into the G-quadruplex crosslinking units yields horseradish peroxidase DNAzyme units that catalyze the generation of chemiluminescence, via the oxidation of luminol by H2O2. The resulting chemiluminescence stimulates the chemiluminescence resonance energy transfer (CRET) process to the QDs resulting in the luminescence of the two-sized QDs. By the application of appropriate triggers the CDNdictated up-regulation and down-regulation of the different-sized QDs aggregates, is demonstrated, and the control over the photophysical functions of the different-sized QDs, by means of the CDNs, are highlighted. Keywords: chemiluminescence resonance energy transfer (CRET), DNA nanotechnology, DNAzyme, plasmonic, fluorescence, gold nanoparticle, L-DOPA

2 Environment ACS Paragon Plus

Page 2 of 38

Page 3 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Substantial recent research efforts are directed towards the development of chemical networks that mimic complex biological networks operating in nature. Specifically, the assembly of constitutional dynamic networks (CDNs), that are up-regulated or downregulated by auxiliary triggers represents a basic principle to duplicate features of biological networks.1-7 The simplest constitutional dynamic network (a [2×2] network) consists of four dynamically-equilibrated constituents AA', AB', BA' and BB', where two pairs of constituents do not share components (agonist relations), e.g., AA'/BB' and AB'/BA', while all four equilibrated constituents inter-communicate by sharing components (antagonist relations), e.g., AA'/AB', AB'/BB', BB'/BA' and BA'/AA'. These features of the CDNs allow the triggered, and reversible, up-regulation and down-regulation of the equilibrated constituents in the CDNs. The triggered stabilization of any of the constituents results in the reequilibration of the CDN to a new state, where the stabilized constituent is up-regulated (increase in its content) on the expense of the antagonist constituents that share components with the stabilized constituents and are down-regulated (decrease in contents). Concomitantly, the partial separation of the antagonistic constituents leads to the upregulation of the agonist constituent, that does not share components with the stabilized constituent (For a further explanatory scheme discussing the triggered transitions of a CDN, see Figure S1, supporting information). Subjecting the re-equilibrated CDN to a counter trigger that destabilizes the energetically-stabilized constituent to its original configuration recovers the initial equilibrated state of the CDN. That is, fundamental features of CDNs include: (i) The adaptive dynamic transitions of the equilibrated constituents in response to external triggers; (ii) The structural connectivities between the constituents dictate the upregulation and down-regulation of the constituents. Substantial progress in the assembly of molecular8 or macromolecular9, 10 CDNs was reported in the past few years, and different triggers such as metal-ions,11,

12

Lewis acids13,

14

or light15,


16

were used to stimulate the

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 38

reconfiguration and re-equilibration of CDN systems. Nonetheless, the reported systems are far from duplicating the complexity of natural network, and important challenges are ahead of us: (i) There is no universal approach to construct the CDNs, and each of the systems required the specific bottom-up construction of the CDNs. (ii) It is difficult to mimic by means of the chemically-driven CDNs complex functionalities of biological networks such as inter-communication of adaptive networks, branching of network, or feedback-driven networks and the design of multi-constituent re-equilibrated networks. Most important, is the need to couple the CDNs systems to emerging chemical functionalities. This issue is not only important to duplicate the biological networks, that dictate chemical functions, but to introduce concepts where CDNs play key roles in material science and nanotechnology. Recently, we introduced nucleic acids as versatile building units to construct CDNs.17-20 The base-sequences of nucleic acids encode structural and functional information into the oligonucleotide polymer.21 Beyond the formation of duplex nucleic acids and their separation by the strand displacement process22, 23 via controlled base-pair stabilities, other structural motives associated with nucleic acids include the reversible pH-induced formation of imotif24, 25 or triplex structures,26-28 the switchable assembly and separation of guanine-rich nucleic acids G-quadruplexes in the presence of K+-ions and crown-ethers,29, 30 respectively, the metal-ion cooperative stabilization of duplexes, e.g., by T-Hg2+-T or C-Ag+-C bridges,3133

and their separation by co-added ligands, e.g., cysteine,34, 35 and the light-induced control

over the stability of duplex nucleic acids by photoisomerizable units, e.g., trans-/cisazobenzene units.36-38 Functional information encoded in the base sequence of nucleic acids includes specific recognition properties, e.g., by aptamers39, DNAzymes,41-43

e.g.,

the

hemin/G-quadruplex

40

and catalytic functions of

horseradish

peroxidase-mimicking

DNAzyme44-46 or metal-ion-dependent phosphodiester cleaving DNAzymes.47,

48

This rich

“tool-box” of nucleic acid structures was applied to develop the nucleic acid-based CDNs: (i)


Page 5 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Nucleic acid strands that stabilize (or destabilize) constituents by controlling the formation of triplex structures,17, 18 K+-stabilized G-quadruplexes17, 18 or photoisomerizable azobenzene19 that induce the reversible light-stimulated stabilization of duplex nucleic acids were used as triggers for the switchable adaptive reconfiguration and re-equilibration of CDNs. (ii) Sequence-specific

metal-ion-dependent

DNAzyme

units,

e.g.,

Mg2+-ion-dependent

DNAzyme, acted as effective catalytic reporter units that probe the contents of the constituents in the stimuli-triggered equilibrated and reconfigured CDNs. The cleavage rates of fluorophore/quencher-functionalized substrates, specific to the DNAzyme reporter units, and the application of appropriate calibration curves allowed the quantitative evaluation of the contents of constituents in the CDNs systems.17-20 (iii) The integration of additional cleaving DNAzyme units into target constituents enables the dictated cleavage of hairpin structures. The resulting cleaved-off strand(s) acted as functional units for informationtransfer and inter-communication of networks,20 or for the supramolecular assembly of nucleic acid structures exhibiting emerging catalytic activities.20 These studies demonstrated, the versatility of nucleic acids for enhancing the complexity of CDNs. Nonetheless, the use of CDNs as functional modules that control the reactivity of chemical ensembles is at present unknown. The switchable aggregation and deaggregation of plasmonic nanoparticles or of semiconductor quantum dots (QDs) leads to functional assemblies exhibiting size-controlled optical and photophysical properties.49 For example, the aggregation of plasmonic Au nanoparticles (NPs) results in the formation of interparticle coupled plasmonic excitons accompanied by a color transition of the localized single particle plasmonic exciton (red) to the coupled plasmonic absorbance (purple-blue). This phenomenon was used to develop triggered switchable aggregation/deaggregation systems.50 Examples include the pHstimulated crosslinking and separation of Au NPs by i-motif51 or triplex bridging units,52 the


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 38

crosslinking of Au NPs into aggregates by K+-stabilized G-quadruplex units and the separation of the aggregates in the presence of 18-crown-6-ether,53,

54

the light-induced

reversible aggregation and separation of Au NPs aggregates by the stabilization of duplex nucleic acid bridges by trans-azobenzene intercalators, and the separation of the aggregates by the light-induced separation of the crosslinking units, in the presence of cis-azobenzene.55, 56

In addition, the crosslinking of nucleic acids-modified Au NPs that exhibit base-pair

complementarities, and the separation of the aggregates by counter strands that apply the strand-displacement mechanism were reported.57-59 Numerous studies have applied the optical changes upon the aggregation/deaggregation of plasmonic NPs for the development of sensing platforms,60-62 such as the detection of genes63, 64 and base mutations, the analysis of ligand-aptamer complexes65,

66

or the detection of metal ions.67,

68

Furthermore, the

programmed deposition of Au NPs on DNA scaffolds was used to construct chiroplasmonic NPs structures.69-72 Also, the formation of nucleic acid-crosslinked semiconductor quantum dots (QDs) was reported.73, 74 Specifically, the reversible and switchable, aggregation and dissociation of semiconductor QDs was demonstrated, using K+-ion-stabilized G-quadruplex as crosslinking units, and the deaggregation of the QDs was induced by the separation of the G-quadruplex in the presence of 18-crown-6-ether.75 The G-quadruplex-crosslinked CdSe/ZnS QDs were used to switch the photophysical properties of the QDs aggregates. The conjugation of hemin/G-quadruplexes horseradish peroxidase-mimicking DNAzyme to CdSe/ZnS QDs stimulated the DNAzyme-catalyzed chemiluminescence resonance energy transfer (CRET) process to the QDs, in the presence of luminol/H2O2, resulting in the luminescence

of

the

QDs

without

extra

irradiation.76,

77

The

switchable

aggregation/deaggregation of the G-quadruplex-crosslinked QDs was, then, used as a functional matrix to switch the photophysical functions of the aggregated QDs.75 In the presence of hemin/G-quadruplex-crosslinked matrices composed of different-sized QDs (λ =


Page 7 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

540 nm; λ = 610 nm), the CRET-induced process led to the luminescence of the two-sized QDs. The dissociation of the aggregated QDs, in the presence of 18-crown-6-ether switched off the CRET process and the luminescence of the QDs. In the present study we couple the dynamically-triggered adaptive re-eqilibration of CDNs with plasmonic Au NPs and semiconductor QDs. We demonstrate that the dynamic operation of the CDNs dictates the switchable aggregation of the plasmonic NPs, thereby controlling the optical and catalytic functions of the NPs. In addition, we demonstrate that the orthogonal triggered transition of a parent CDN leads to the adaptive re-equilibration of two alternative CDNs. The up-regulation and down-regulation of the constituents in the two alternative networks leads to catalyzed-cleavage of two different hairpin substrates. The released strands stimulate the dictated aggregation of different-sized QDs crosslinked by hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme units. The chemiluminescence resonance energy transfer (CRET) processes, stimulated by the DNAzyme-catalyzed oxidation of luminol by H2O2, in the different-sized QDs aggregated assemblies, lead to CDNs-dictated luminescence features of the different-sized QDs. The results demonstrate the control over the photophysical and photoluminescence functions of different-sized QDs by means of the dynamically equilibrated CDNs systems.


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

RESULTS AND DISCUSSION

Figure 1. Schematic reversible and orthogonal triggering of a constitutional dynamic network “S” (CDN “S”) by triggers T1 or T2 to yield CDN “X” or CDN “Y”, respectively, and the reversible regeneration of CDN “S” in the presence of the counter triggers T1' or T2'. Each of the constituents in the different CDNs includes the Mg2+-ion-dependent DNAzyme as reporter unit. The triggered up-regulation or down-regulation of the constituents in CDNs “X” and “Y” are marked with arrows. Figure 1 shows the basic constitutional dynamic network “S” and the triggered transitions of CDN “S” to CDN “X” or “Y”, in the presence of the triggers T1 or T2, respectively. The CDN “S” and its dynamic operation represents a modified configuration to the [2×2] nucleic acid-based CDN that was reported by us.17 It consists of four supramolecular constituents AA', AB', BA' and BB' that include, each, duplex-bridged Mg2+-ion-dependent DNAzyme subunits. The duplex structures are conjugated to single-stranded arms that provide hybridization domains for the respective triggers. Each of the Mg2+-ion-dependent DNAzyme units is modified with different single-stranded “arms” that provide binding (hybridization) domains for four different fluorophore/quencher-functionalized ribonucleobase-modified substrates. The DNAzyme subunits associated with each of the constituents provide reporter units for the quantitative evaluation of the contents of the constituents (see Figure 1 right). By following the rate of hydrolysis of the different substrates, and using appropriate calibration curves corresponding to the rates of hydrolysis of the substrates by the different concentrations of the intact individual constituent structures, the contents (concentrations) of


Page 8 of 38

Page 9 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

the respective constituents in the CDNs can be evaluated (vide infra). The hybridization of the trigger strand T1 with the arms associated with the constituent AA' yields CDN “X” where the AA' constituent is stabilized. The stabilization of AA' leads to the up-regulation of this constituent on the expense of the down-regulation of the antagonistic constituents AB' and BA', that share components with AA'. The separation of the AB' and BA' constituents, due to the stabilization of AA', is then accompanied by the concomitant up-regulation of the agonistic constituent BB', that does not share structural components with AA'. That is, the treatment of CDN “S” with T1 results in the adaptive dynamic transition of CDN “S” to CDN “X”. Subjecting CDN “X” to the counter trigger T1', that displaces T1, restores the CDN “S”. Similarly, treatment of CDN “S” with the trigger T2, that selectively hybridized with the constituent AB' of CDN “S” results in the adaptive transition of CDN “S” to CDN “Y”, where constituent AB' and the agonist constituent BA' are up-regulated and the antagonist constituents AA' and BB' are down-regulated. As before, subjecting CDN “Y” to the counter trigger T2', displaces the stabilizing strand T2, via the formation of the T2/T2' duplex, and this results in the regeneration of the CDN “S”.


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2. Time-dependent fluorescence changes generated by the Mg2+-ion-dependent DNAzyme units associated with the different constituents, upon the transition of CDN “S” to CDN “X” in the presence of T1, and back to CDN “S” upon the T1'-triggered transformation of CDN “X” to CDN “S”. The time-dependent fluorescence changes generated by the DNAzyme reporter units that correspond to the equilibrated concentrations of the constituents in state “S” (curves (i)), in CDN “X” after triggering CDN “S” with T1 (curves (ii)) and after the regeneration of CDN “S” by triggering CDN “X” with T1' (curves (iii)) are presented in Panel I – for constituent AA', panels II, III and IV for constituents AB', BA' and BB', respectively. The adaptive triggered transitions of CDN “S” to CDN “X” and back are exemplified in Figure 2, panels I – IV. Figure 2 depicts the time-dependent fluorescence changes generated by the respective Mg2+-ion-dependent DNAzyme reporter unit, associated with the four constituents AA', AB', BA' and BB' of CDN “S” before the treatment with the trigger T1, curves (i), after the treatment of CDN “S” with T1, and transition of CDN “S” to “X”, curves (ii), and after the reverse transition of CDN “X” to “S”, in the presence of the counter trigger T1', curves (iii). Evidently, the stabilization of AA' leads to the up-regulation of AA', the down-regulation of AB' and BA', and the concomitant up-regulation of BB'. Using appropriate calibration curves, Figures S2 and S3, the concentrations of the up-regulated and down-regulated constituents were evaluated. The respective concentrations of the


Page 10 of 38

Page 11 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

constituents in CDN “S” and “X” are summarized in Table 1. The constituents AA' and BB' are up-regulated by 109% and 91%, respectively, while the constituents AB' and BA' are down-regulated by 73% and 79%, respectively. Similarly, the CDN in state “S” was triggered with the strand T2 to yield the dynamically re-equilibrated CDN in state “Y”, Figure 1. In this system, the stabilization of AB' results in the up-regulation of the constituents AB' and BA' and the concomitant down-regulation of the constituents AA' and BB', Figure 1. The timedependent fluorescence changes generated by the DNAzyme reporter units associated with the constituents comprising CDN “Y” are shown in Figure S4. Using the appropriate calibration curves, Figures S2 and S3, the contents (concentrations) of the four constituents were evaluated, Table 1. We find that the triggering of CDN “S” with T2, and the formation of CDN “Y”, results in the up-regulation of AB' and BA' by 60% and 50% and the downregulation of AA' and BB' by 80% and 78%, respectively. In addition, treatment of CDN “Y” with the counter trigger T2', displaced the stabilizing trigger-strand T2, through the formation of the T2'/T2 duplex, resulting in the regeneration of CDN “S” (cf. the time-dependent fluorescence changes characteristic to the constituents in regenerated CDN “S”, curves (iii) in Figure S4). Complementary quantitative electrophoretic separation of the constituents associated with CDNs “S”, “X” and “Y” were performed (see Figure 3). The bands corresponding to the individual constituents AB', AA', BB' and BA' are presented in lanes 1, 2, 3 and 4, respectively. (Note that in order to generate clear separation, the components A and B' were modified (elongated) with tethers. These tethers do not affect, however, the equilibria of the resulting CDNs as reported earlier.17-20 The sequences of these modified strands Amod and B'mod are detailed in the list of nucleic acids used in the study.) The separated constituents of CDN “S” are depicted in lane 5. As the concentrations of the individual constituents (lane 1 to 4) are 1 µM, the intensities of the SYBR Gold stained separated bands, lane 5, were compared to the intensities of the stained bands of known


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

concentrations, and by using the imageJ software, the quantitative contents (concentrations) of the separated constituents of CDN “S” were evaluated (see Table 1). Figure 3, lane 6 shows the stained band of the individual component AA'-T1 (1 µM). Figure 3, lane 7 shows the separated bands corresponding to CDN “X” generated by the reconfiguration and equilibration of CDN “S” to CDN “X”, using the trigger T1. Evidently, the stained bands corresponding to BB' and AA'-T1 are intense, while the bands corresponding to the constituents AB' and BA' are almost invisible, consistent with the adaptive down-regulation of AB' and BA' in the presence of trigger T1. Also lane 8 shows the SYBR Gold stained band corresponding to the individual constituent AB'-T2 (1 µM). Figure 3, lane 9, depicts the stained separated bands corresponding to CDN “Y” generated upon treatment of CDN “S” with the trigger T2. Evidently, the intensities of the stained bands of AB'-T2 and BA' are high, while the stained bands BB' and AA' are very weak as compared to the stained bands of BA' and AB' in CDN “S”. These results indicate that the reconfiguration of CDN “S” into CDN “Y”, in the presence of the trigger T2, is accompanied by the down-regulation of the constituents BB' and AA', and the up-regulation of AB' and BA'. Table 1 summarizes the concentrations of the equilibrated constituents in CDNs “S”, “X” and “Y” derived by the DNAzyme units associated with the respective constituents as reporters. For comparison, the concentrations of the respective constituents (in the different CDNs) were quantitatively evaluated by the electrophoretic experiments. That is, the intensities of the SYBR Gold stained separated bands corresponding to the constituents in the different CDNs were compared to the intensities of the reference stained bands of known concentrations, using the ImageJ software. The results are provided in Table 1 (in brackets) for the different constituents in the CDNs. Very good agreement between the concentrations of the constituents determined by the DNAzyme reporter units, and by the quantitative electrophoretic experiments is demonstrated. In addition, from the equilibrated concentrations


Page 12 of 38

Page 13 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

of the constituents in CDNs “S”, “X” and “Y”, we evaluated the molar contents of the components comprising the respective constituent structures, as single component concentrations, Table S1. We find that for all systems, the supramolecular constituents exist in a molar concentration that corresponds to ≥98%. That is, the concentrations of the free equilibrated components are ≤2%.

Figure 3. SYBR Gold stained electrophoretically-separated constituents of the CDNs presented in Figure 1, and of the reference intact constituents (native PAGE gel). Lane 1 to Lane 4, correspond to the intact individual constituents, 1 µM each, AB', AA', BB'. BA'. Lane 5 – separated constituents of CDN “S”. Lane 6 – reference intact constituent AA' stabilized by T1, AA'-T1 (1 µM). Lane 7 – separated constituents associated with CDN “X”. Lane 8 – reference intact constituent AB' stabilized by T2 (1 µM). Lane 9 – separated constituents associated with CDN “Y”. Table 1. Concentrations of the constituents associated with the different CDNs CDN S

X

Y

[AA']/µM

[AB']/µM

[BA']/µM

[BB']/µM

0.44a

0.59a

0.61a

0.45a

(0.43)b

(0.53)b

(0.60)b

(0.48)b

0.92a

0.16a

0.13a

0.86a

(0.92)b

(0.11)b

(0.10)b

(0.91)b

0.08a

0.96a

0.90a

0.10a

(0.07)b

(0.94)b

(0.94)b

(0.05)b

(a)

Concentrations derived by the DNAzyme reporter units associated with the respective units. Values in brackets correspond to the concentrations of the respective constituents derived from quantitative electrophoretic separation of the constituents. (b)


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4. Schematic control of the time-dependent aggregation of Au NPs (15 nm diameter) upon subjecting the equilibrated CDN “S” or the T1-equilibrated CDN “X” to the hairpin H1 and the mixture of p- and q-functionalized Au NPs. Note that the up-regulation of AA'-T1 and the concomitant up-regulation of BB' in CDN “X” leads to the enhanced cleavage of H1 and the enhanced aggregation of the Au NPs. Realizing that CDN “S” can be reconfigured by the trigger T1 to form CDN “X” or by the trigger T2 to form CDN “Y”, we applied the CDNs to control the aggregation of nanoparticles, and to control the resulting optical and catalytic properties of the nanoparticles by the respective aggregates. Figure 4 shows the mechanism to induce the aggregation of Au NPs by CDN “S” and the T1-triggered dynamically equilibrated CDN “X”. The CDNs were subjected separately, to the hairpin H1 that acts as substrate for the Mg2+-ion-dependent DNAzyme associated with the constituent BB', in the presence of Au NPs modified with the nucleic acids p and q. The BB' cleaves ribonucleobase-modified loop domain of hairpin H1 and the fragmented single-strand H1-1 is complementary to the nucleic acid tethers p and q associated with the Au NPs. The cleavage of the hairpin H1 induces then the aggregation of the Au NPs. The aggregation of the Au NPs is probed by following the depletion of the localized plasmon absorbance band of single Au NPs at 525 nm. Figure 5(A) shows the timedependent absorption spectra changes of the Au NPs occurring upon subjecting CDN “S” to the Au NPs. A slow decrease in the plasmon band of the NPs is observed over a time interval of 16 hours, implying very inefficient aggregation of the NPs. These results are consistent


Page 14 of 38

Page 15 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

with the very low concentration of constituent BB' in the CDN mixture that leads to inefficient release of the crosslinking strand H1-1 that stimulates the aggregation process. Treatment of CDN “S” with the trigger T1 results in the absorption spectra changes of Au NPs shown in Figure 5(B). Evidently, the plasmon bands characteristic to the single plasmonic Au NPs decrease in their intensity and a red-shifted band, consistent with the enhanced aggregation of the NPs is observed. Figure 5(C) depicts the time-dependent absorbance ratio changes of the Au NPs in the presence of CDN “S” (i) and CDN “X” (ii), as a result of the aggregation of the Au NPs. Clearly, the aggregation of the NPs is enhanced, in the presence of CDN “X”. These results are consistent with the fact that the treatment of CDN “S” with trigger T1 results in the stabilization of the constituent AA' that leads to the dynamic adaptive transition of CDN “S” into CDN “X”, where the constituents AB' and BA' are down-regulated and concomitantly the constituents AA' and BB' are up-regulated. The up-regulation of BB' results in the enhanced cleavage of H1 and this leads to the faster aggregation of the Au NPs. It should be noted that the triggered CDN-controlled aggregation of the Au NPs was characterized at a concentration of the hairpin that corresponds to 50 nM. This concentration represents an optimized value to observe the switchable T1-controlled aggregation process (see Figure S6, supporting information and accompanying discussion). Further support to the enhanced aggregation of the Au NPs upon treatment of CDN “S” with the trigger T1, in the presence of the nucleic acid-modified AuNPs, was obtained by examining the aggregation process of the NPs by transmission electron microscopy, Figure 5(D). At time zero, the Au NPs treated with CDN “S” show only the single Au NPs (Figure S7). The aggregation process of the Au NPs in the presence of CDN “S” shows little aggregation of the NPs after a time-interval of four hours (panel I) and slightly higher aggregation after a time-interval of 8 hours (panel II). In turn, subjecting CDN “S” to the trigger T1 leads to the reconfiguration of CDN “S” into CDN “X” that induces effective


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

aggregation of the Au NPs after a time interval of four hours (panel III) and very effective aggregation after a time-interval of eight hours (panel IV). These results are consistent with the very inefficient cleavage of H1 that induces the aggregation of the NPs, in the presence of the low content of the constituent BB' in CDN “S”, and the T1-triggered up-regulation of BB' in the CDN “X” that leads to enhanced cleavage of H1 and fast aggregation of the NPs.

Figure 5. (A) Absorption spectra associated with the time-dependent aggregation of the Au NPs in the presence of the equilibrated CDN “S”. (B) Absorption spectra associated with the time-dependent aggregation of the Au NPs that are subjected to the CDN “X”. (C) Timedependent absorbance ratio changes of 525 nm and 650 nm upon: (i) The aggregation of the Au NPs subjected to CDN “S”. (ii) The aggregation of the Au NPs subjected to the equilibrated CDN “X”. (Error bars were derived from n=3 experiments) (D) TEM image corresponding to the aggregates of the Au NPs generated by the equilibrated CDN “S” after four hours (panel I) and eight hours (panel II), and by the CDN “X” after four hours (panel III) and eight hours (panel IV) of aggregation, respectively. The aggregation of the Au NPs by the dynamic reconfiguration of the CDNs reveals switchable features, Figure 6. In the presence of the CDN “X”, fast aggregation of the NPs is initiated. At the time indicated with an arrow (a), the system is subjected to the counter trigger T1'. This results in the destabilization of the constituent AA', through the displacement 16 Environment ACS Paragon Plus

Page 16 of 38

Page 17 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

of the duplex T1'/T1 and the transition of CDN “X” to CDN “S”. This is accompanied by a substantially slower aggregation process due to the lower content of the catalytic constituent BB'. At the time-interval indicated with an arrow (b), the trigger T1 is added to the system. This results in the dynamic adaptive transition of CDN “S” to CDN “X”, leading to the switched-on, fast aggregation, of the NPs, due to the increased content of the catalytic constituent BB' in the system. Note that substantial differences in the aggregation rates of the nanoparticles are observed upon subjecting the system to the counter trigger T1' (point a) and trigger T1 (point b). The additional points represent data points at different aggregation timeintervals to emphasize consistence of the different aggregation rates.

Figure 6. Switchable control of the aggregation of Au NPs by the triggered transition between CDN “X” and “S”. The aggregation is initiated by CDN “X”, resulting in fast aggregation. At the time marked “a”, the system is subjected to the counter trigger T1', resulting in the CDN “S” and slower aggregation. At the time marked “b”, the system is subjected to the trigger T1 resulting in the CDN “X” and the fast aggregation process. Beyond the control over the aggregation properties of the Au NPs by the triggered transitions of the CDNs between the states “S” and “X”, we find that the catalytic functions of the Au NPs are controlled by the CDN systems. Recently, it was reported that Au NPs reveal catalytic functions such as peroxidase mimicking functions.78 One of the reactions 17 Environment ACS Paragon Plus

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

catalyzed by Au NPs involves the catalyzed oxidation of L-DOPA to dopachrome by H2O2,78 Figure 7(A). Thus, the controlled aggregation of Au NPs by means of the CDNs is anticipated to control the catalytic oxidation of L-DOPA by H2O2 by controlling the catalytic surface area associated with the aggregated NPs. That is, the enhanced aggregation of the Au NPs in the presence of CDN “X” is anticipated to retard the catalytic oxidation of L-DOPA, while in the presence of CDN “S” enhanced catalytic oxidation of L-DOPA should proceed, due to the inefficient aggregation of the NPs and high surface area of the catalytic interfaces. Furthermore, by switching the CDNs between states “X” and “S”, by means of the trigger T1 and T1', the catalytic performance of the Au NPs toward the catalyzed oxidation of L-DOPA to dopachrome should be switched between slow and fast processes, respectively. Figure 7(B) depicts the time-dependent absorbance changes of the resulting dopachrome, upon subjecting CDN “S” to L-DOPA/H2O2 (curve i) and of the CDN “X”, in the presence of LDOPA/H2O2, curve (ii). Evidently, the triggered transition of CDN “S” to “X” slows down the catalytic oxidation of L-DOPA due to the aggregation of the Au NPs. By the reversible switching of the networks between states “X”, in the presence of T1, and “S”, in the presence of T1', the catalytic oxidation of L-DOPA is switched between slow and fast processes, Figure 7(C). To further evaluate the catalytic functions of the high-surface-area individual Au NPs and the low-surface-area aggregated Au NPs, we analyzed the catalyzed oxidation of LDopa by the single/aggregated Au NPs in terms of the Michaelis−Menten mode,79 (Figure S8, supporting information). We find that the individual Au NPs exhibit a KM = 0.17 mM and kcat = 1.04×10-5 s-1, while the aggregated Au NPs show a KM = 0.22 mM and kcat = 6.9 ×10-6 s-1. (It should be noted that the intrinsic catalytic activity of the Au NPs is affected, as expected, by the immobilization of the nucleic acid units. Nevertheless this decrease in the catalytic activity is irrelevant for the switchable catalytic activities of the aggregated Au NPs.) Note that the oxidation of L-DOPA is fast (20 minutes time-scale), whereas the


Page 18 of 38

Page 19 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

aggregation process and the reconfiguration of CDN “S” to CDN “X” are slow (proceed on a time-scale of hours). Thus changes in the rates of oxidation of L-DOPA reflect the individual Au NPs/aggregated NPs in the different systems.

Figure 7. The switchable control of the Au NPs-catalyzed oxidation of L-DOPA to dopachrome by H2O2 using the triggered reconfiguration of CDN “S” to CDN “X” and back: (A) Schematic control of the oxidation of L-DOPA to dopachrome by H2O2 in the presence of Au NPs and Au NPs aggregates generated by the triggered reconfiguration of the CDNs. (B) Time-dependent rates corresponding to the Au NPs-catalyzed oxidation of L-DOPA to dopachrome by H2O2, in the presence of CDN “S”, curve (i), and the T1-triggered reconfiguration of CDN “S” to CDN “X”, curve (ii). (C) CDNs-stimulated switchable rates of oxidation of L-DOPA upon the triggered reversible transitions between CDN “S” and CDN “X”. The oxidation processes are initiated by CDN “S”. At point (a), the system is subjected to the trigger T1, resulting in the dynamic reconfiguration of CDN “S” to CDN “X” and to the enhanced decrease in the rate-changes of L-DOPA oxidation. At point (b), the system is subjected to the counter trigger T1', leading to lower rate-changes in the oxidation of LDOPA (consistent with retarded aggregation). At point (c) the system is re-treated with the trigger T1, resulting in enhanced decreases in the rate-changes of the oxidation of L-DOPA (consistent with enhanced aggregation of the Au NPs). In addition to the CDNs-stimulated control over the aggregation of the Au NPs and their catalytic properties, we were able to control the photophysical properties of CdSe/ZnS QDs through the CDNs-driven controlled aggregation of the QDs by means of hemin/Gquadruplex bridging units generated by the respective CDNs. Previous studies have demonstrated that hemin/G-quadruplex yields chemiluminescence in the presence of luminol/H2O2.75 In addition, it was demonstrated that hemin/G-quadruplexes linked to 19 Environment ACS Paragon Plus

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

CdSe/ZnS QDs lead to, in the presence of luminol/H2O2, a CRET process, that switches-on the luminescence of the QDs in the absence of external excitation of the QDs. Also, in the presence of two different-sized aggregated CdSe/ZnS QDs crosslinked by hemin/Gquadruplexes, induced, in the presence of luminol/H2O2, the CRET process to the QDs that results in the luminescence of the two-sized QDs.75 (It should be noted that no fluorescence quenching phenomena of the QDs were detected in the presence of hemin, for nonaggregated QDs, and in the presence of the hemin/G-quadruplex crosslinked aggregated QDs. We find a minute quenching of the QDs crosslinked by the hemin/ G-quadruplex units, ≤ 5%, (cf. Figure S9). Knowing the CRET efficiencies for the two QDs and the geometrical separation between the hemin/G-quadruplex and the QDs, we estimated the Förster distance to be ca. 3.1-3.6 nm.

Figure 8. Orthogonal control of the CDNs-induced CRET functionalities of hemin/Gquadruplex-crosslinked QDs aggregates generated by the CDNs. (A) Schematic T1-triggered aggregation of the 540 nm-emitting QDs in the presence of hairpin H2 and the resulting hemin/G-quadruplex-stimulated CRET process in the resulting aggregate. (B) Emission spectra corresponding to the chemiluminescence and CRET signal (λ = 540 nm) generated by: (a) The CDN “S” (b) The T1-equilibrated CDN “X”. (C) Schematic T2-triggered aggregation of the 610 nm-emitting QDs in the presence of hairpin H3 and the resulting hemin/G-quadruplex-stimulated CRET process in the resulting aggregate. (D) Luminescence spectra of: (a) The chemiluminescence and CRET signal (λ = 610 nm) generated by the CDN 20 Environment ACS Paragon Plus

Page 20 of 38

Page 21 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

“S”. (b) The chemiluminescence and CRET signal (λ = 610 nm) by CDN “Y”, generated by the reconfiguration of CDN “S” in the presence of T2. Following these basic features of hemin/G-quadruplexes and their interactions with semiconductor quantum dots, we have applied CDNs to control the aggregation of differentsized semiconductor QDs, crosslinked by hemin/G-quadruplexes, and to dictate by the CDNs their sequestered optical properties. The CDN “S” was subjected to the hairpin H2 that acts as substrate of the constituent BB' in the presence of 540 nm-emitting QDs functionalized with the nucleic acids (1) and (2), where the strand (1) includes 3/4 of the G-quadruplex sequence and (2) consists of 1/4 of the G-quadruplex sequence. Under these conditions, Figure 8(A), the constituent BB' cleaves H2, and the released strand H2-1 crosslinks the QDs to yield the aggregated hemin/G-quadruplex-stabilized QDs. In the presence of luminol/H2O2, the hemin/G-quadruplex-catalyzed generation of chemiluminescence induces the CRET process to the QDs, thus switching-on the 540 nm luminescence of the QDs, Figure 8(A). Treatment of CDN “S” with the trigger T1 stabilizes and up-regulates the constituent AA', and concomitantly up-regulates the content of BB', to yield the CDN “X”, cf. Figure 1. The stabilization and up-regulation of the constituent AA' increases the content of BB', resulting in the enhanced cleavage of hairpin H2 and the intensified generation of the CRET signal. Figure 8(B) shows the luminescence spectra generated by CDN “S” (curve a) and CDN “X” (curve b), upon the CDNs-guided aggregation of the QDs for a time-interval of 5 h. In the presence of the CDN “S”, the chemiluminescence spectrum generated in the presence of H2O2/luminol, and the accompanying CRET signal at λ = 540 nm, are substantially lower than the chemiluminescence spectrum and CRET signal generated by CDN “X”. The results are consistent with the enhanced cleavage of H2 that results in the higher aggregation of the hemin/G-quadruplex-bridged QDs. In analogy, the CDN “S” was subjected to hairpin H3 and the 610 nm-emitting CdSe/ZnS QDs. Two kinds of (3) and (4)-modified CdSe/ZnS QDs are


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

applied, where the strands (3) and (4) includes 3/4 and 1/4 sequences of the G-quadruplex, respectively. The interaction of CDN “S” with hairpin H3 leads to the cleavage of H3, by the constituent BA', and the released strand H3-1 crosslinks the QDs through the formation of hemin/G-quadruplex, Figure 8(C). Under these conditions, the hemin/G-quadruplex catalyzes the generation of chemiluminescence that stimulates the CRET process and leads to the luminescence of the 610 nm luminescent QDs, Figure 8(D), curve (a). In the presence of the trigger T2, CDN “S” is reconfigured into CDN “Y”, where the constituent AB' is stabilized and up-regulated, and concomitantly, the content of BA' increases. As a result, the reconfiguration of CDN “S” to “Y” enhances the cleavage of H3 and the resulting strand H3-1 increases the aggregation of the 610 nm-emitting QDs that are crosslinked by the hemin/Gquadruplex bridges. As a result, the transition of CDN “S” to CDN “Y”, leads in the presence of hairpin H3 to the enhanced chemiluminescence and the CRET process, that intensifies the luminescence of the 610 nm QDs, Figure 8(D), curve (b). The CDN “S” was, then, subjected to the two-sized QDs (the (1)- and (2)-modified QDs emitting at 540 nm and the (3)- and (4)modified CdSe/ZnS QDs emitting at 610 nm). Treatment of CDN “S” with the two hairpins H2 and H3 resulted in the concomitant cleavage of H2 by the BB' constituent and of H3 by the BA' constituent. The cleaved-off strands H2-1 and H3-1 stimulate the aggregation of the 540 nm-emitting QDs and of the 610 nm-emitting QDs, respectively, Figure 9(A). The resulting hemin/G-quadruplex QDs aggregates lead then, in the presence of H2O2/luminol, to the generation of chemiluminescence and to the activation of the CRET processes in the two types of aggregated QDs. Figure 9(B), curve (a) (black), shows the CRET-stimulated luminescence bands of the respective aggregated QDs in the presence of CDN “S” (formed upon the catalyzed cleavage of H2 and H3 and upon the subsequent aggregation of the QDs by the cleaved-off strand H2-1 and H3-1 for a time-interval of 5 h). Treatment of CDN “S” with the trigger T1 reconfigures CDN “S” to CDN “X” where the constituents AA' and BB'


Page 22 of 38

Page 23 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

are up-regulated and the constituents AB' and BA' are down-regulated. The reconfiguration of CDN “S” to CDN “X” in the presence of the hairpins H2 and H3 leads then to enhanced cleavage of H2, as compared to the cleavage of H2 by CDN “S”, and to the decrease in the cleavage process of H3. That is, the enhanced cleaved-off strand H2-1 by BB' and the retarded cleaved-off product H3-1 in CDN “X”, as compared to CDN “S” lead to enhanced aggregation and CRET-induced luminescence of the 540 nm-emitting QDs and to the retarded aggregation and CRET-induced luminescence of the 610 nm-emitting QDs, as compared to the behavior of the QDs in CDN “S”. Figure 9(B) curve (b), (red), shows the CRET-induced fluorescence bands of the two types of QDs dictated by CDN “X”. The intensity of the CRET-induced luminescence of the 610 nm-emitting QDs decreases, as compared to the process in CDN “S” (consistent with the decrease of the constituent BA') and the CRETinduced luminescence of the 540 nm-emitting QDs intensified, as compared to the CDN “S”, due to the up-regulation of the constituent BB'. Alternatively, treatment of CDN “S” with the trigger T2 reconfigured CDN “S” into CDN “Y” where AB' and BA' are up-regulated and AA' and BB' are down-regulated. Subjecting CDN “Y” to the hairpins H2 and H3 results in the enhanced cleavage of H3, as compared to the cleavage of H3 by CDN “S”, and the retarded cleavage of H2 by CDN “Y”, as compared to the cleavage of H2 by CDN “S”. As a result, the cleaved-off strand H3-1 enhances the aggregation and the resulting CRET-induced luminescence of the aggregated 610 nm-emitting QDs, while the retardation of the released H2-1 decreases the rate of aggregation and accompanying CRET-induced luminescence of the hemin/G-quadruplex-crosslinked 540 nm-emitting QDs. Figure 9(B), curve (c) (blue), shows the CRET-induced luminescence spectrum generated by the CDN “Y” guided aggregated assemblies of the 540 nm- and 610 nm-emitting QDs. The CRET-induced signal generated by the 540 nm-emitting QDs is weakened as compared to the respective CRET signal generated by CDN “S” (due to the down-regulation of the constituent BB'), whereas the


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

CRET-induced signal of the 610 nm-emitting aggregated QDs is intensified, as compared to the CDN “S” system, due to the up-regulation of the constituent BA'.

Figure 9. Schematic orthogonal control of the luminescence properties of a mixture of 540 nm- and 610 nm-emitting CdSe/ZnS QDs that includes the hairpins H2 and H3 that undergoes aggregation induced by H2-1 and H3-1. In the absence of the triggers T1 or T2, the respective CDN “S”-stimulated CRET process to the QDs proceeds. Subjecting CDN “S” to trigger T1


Page 24 of 38

Page 25 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

results in CDN “X” where the overexpression of H2-1 proceeds leading to the enhanced CRET-induced luminescence of the 540 nm-emitting QDs. Subjecting CDN “S” to trigger T2 results in the transition of CDN “S” to CDN “Y”. The resulting overexpressed H3-1 leads to the enhanced CRET-induced luminescence of the 610 nm-emitting QDs. (B) Luminescence spectra generated by: (a) CDN “S”, (b) CDN “X” generated by reconfiguration and reequilibration of CDN “S”, in the presence of T1. (c) CDN “Y”, formed by the reconfiguration and equilibration of CDN “S” in the presence of T2. CONCLUSIONS In conclusion, the present study has coupled the adaptive functions of equilibrated nucleic acid-based constitutional dynamic networks with the plasmonic and optical properties of sizecontrolled nanomaterials, such as metallic nanoparticles or semiconductor quantum dots. Specifically, we have demonstrated the CDNs guided aggregation of Au nanoparticles and the control over the plasmonic or catalytic functions of the nanoparticles by means of the auxiliary CDN systems. In addition, we demonstrated the control over the optical properties of different-sized semiconductor quantum dots. We showed that CDNs lead to molecular fragments that dictate the aggregation of the quantum dots and control emerging optical properties, such as CRET-induced luminescence features of quantum dots. EXPERIMENTAL SECTION The nucleic acid sequences used in the study include: A: 5'-GATATCAGCGATACGATACAAACTTACACACTTCACAC-3' A': 5'-ACTCTACTCTATTCTGTTTGTATCGTCACCCATGTTCGTCA-3' B: 5'-CTGCTCAGCGATACGATACAAACTACACTACCGTACCA-3' B': 5'-ATCACTATCCACTCTGTTTGTATCGTCACCCATGTTACTCT-3' Amod: 5'-TCTCTCTCTCTCTCTCTCTCAAGATATCAGCGATACGATACAAACTT ACACACTTCACAC-3' B'mod: 5'-ATCACTATCCACTCTGTTTGTATCGTCACCCATGTTACTCTCTCTCTCT


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

CT-3' T1: 5’-GTGTGAAGTGTGTAAGGAGAATAGAGTAGAGT-3’ T1': 5’-ACTCTACTCTATTCTCCTTACACACTTCACAC-3’ T2: 5’-GTGTGAAGTGTGTAAGGAGAGTGGATAGTGAT-3’ T2': 5’-ATCACTATCCACTCTCCTTACACACTTCACA-3’ H1: 5'-CACTTGGTCACTCAGAGTATrAGGAGCAGCTAGTAGTGACCAAGTGTCG AT-3' p: 5'-GTCACTACTAGAAAAAAAAAA-SH-3' q: 5'-SH-AAAAAAAAAAATCGACACTTG-3' H2: 5'-GTACTGGTGACCATTTGACGATrAGGAGCAGTAGCAGGTCACCAGTACAT CG-3' (1): 5'-NH2-TCGATGTACTGTGGGTAGGGCGGG-3' (2): 5'-TGGGTGTGACCTGCTT-NH2-3' H3: 5'-ACACTTGGTCACTAATTAGAGTATrAGGAGCAGTAGTAGTGACCAAGTGTC GA-3' (3): 5'-NH2-ATCGACACTTGTGGGTAGGGCGGG-3' (4): 5'-TGGGTGTCACTACTAG-NH2-3' Sub1 (AB'): 5'-FAM-AGAGTATrAGGATATC-BHQ1-3' Sub2 (BB'): 5'-ROX-TGACGATrAGGAGCAG-BHQ2-3' Sub3 (BA'): 5'-CY5-AGAGTATrAGGAGCAG-BHQ2-3' Sub4 (AA'): 5'-CY5.5-TGACGATrAGGATATC-IBRQ-3' Sub1-noFQ (AB'): 5'-AGAGTATrAGGATATC-3' Sub2-noFQ (BB'): 5'-TGACGATrAGGAGCAG-3' Sub3-noFQ (BA'): 5'-AGAGTATrAGGAGCAG-3' Sub4-noFQ (AA'): 5'-TGACGATrAGGATATC-3'


Page 26 of 38

Page 27 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

The ribonucleobase cleavage site, rA, in the substrates of the different Mg2+-ion-dependent DNAzymes is indicated in bold, the respective Mg2+-ion-dependent DNAzyme sequences are underlined. Details on the preparation of the CDNs, the quantitative evaluation of the constituents of the CDNs, and details on the quantitative page-gel separation of the constituents associated with the different CDNs are provided in the supporting information. Probing the constituents in the CDNs. 100 µL of the equilibrated mixture of AA', AB', BA' and BB' (CDNs) was treated with the corresponding fluorophore/quencher-modified substrate while the other substrates lacked modification with the fluorophore/quencher pairs. As an example, to probe constituent the activity of AA', 100 µL of the equilibrated mixture of CDNs (1 µM) was treated with the sub4, sub1-noFQ, sub2-noFQ and sub3-noFQ, 5 µL of 100 µM each. Subsequently, the time-dependent fluorescence changes generated from the cleavage of sub4 by the Mg2+-ion-dependent DNAzyme associated with the AA' were followed. Using the appropriate calibration curve corresponding to the rates of cleavage of the different substrates by different concentrations of the intact constituents (see detailed description in Figures S2 and S3 for [2×2] CDN), the contents of the constituents in the different CDNs were evaluated. Controlling the optical and catalytic properties of aggregated Au NPs by CDNs. The equilibrated mixtures of CDN “S” or “X” (5 µL, 2 µM) was subjected to the hairpins H1 (2.5 µL, 2 µM), and to the nucleic acid p- and q-modified Au NPs (100 µL). The resulting mixture was incubated for different time-intervals, and the absorption spectra of the mixture were monitored. For the catalytic oxidation of L-DOPA, the respective CDNs and AuNPs mixtures were subjected to 45 µL of L-DOPA (10 mM) and 1.5 µL of 9.8 M H2O2, and incubated for 20 min. The catalytic oxidation of L-DOPA was followed spectroscopically by measuring the absorbance changes in the absorption of dopachrome, λmax = 475 nm.


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 38

Controlling the aggregation and CRET of QDs by CDNs. This is exemplified with the CDNs-induced aggregation of the 540 nm-emitting QDs, a mixture of 0.5 µM hemin, (1)- and (2)-modified 540 nm-emitting QDs (0.5 µM) in 10 mM HEPES buffer solution (pH 7.2), that included 20 mM MgCl2, 100 mM K+ and 0.5 µM hemin was prepared. The resulting mixture was added to the equilibrated mixture of H2 (1 µM) and CDN “S” (1 µM) or the equilibrated mixture of H2 (1 µM) and CDN “X” (1 µM), respectively. For the CRET assay, luminol (0.5 mM) and H2O2 (0.8 mM) were added to the systems, and adjusted to pH = 9.0. Chemiluminescence and CRET luminescence spectra were monitored at different time-intervals. ASSOCIATED CONTENT Supporting

Information.

Materials

and

instrumentation,

methods

and

systems,

measurements, calibration curves, and additional results are provided. This material is available free of charge via the Internet at http://pubs.acs.org. AUTHOR INFORMATION Corresponding Author *[email protected] Author Contributions ‡

These authors contributed equally.

The authors declare no competing financial interests. REFERENCES (1) Lehn, J.-M. From Supramolecular Chemistry towards Constitutional Dynamic Chemistry and Adaptive Chemistry. Chem. Soc. Rev. 2007, 36, 151-160.


Page 29 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

(2) Rowan, S. J.; Cantrill, S. J.; Cousins, G. R. L.; Sanders, J. K. M.; Stoddart, J. F. Dynamic Covalent Chemistry. Angew. Chem. Int. Ed. 2002, 41, 898-952. (3) Corbett, P. T.; Leclaire, J.; Vial, L.; West, K. R.; Wietor, J.-L.; Sanders, J. K. M.; Otto, S. Dynamic Combinatorial Chemistry. Chem. Rev. 2006, 106, 3652-3711. (4) Herrmann, A. Dynamic Combinatorial/Covalent Chemistry: a Tool to Read, Generate and Modulate the Bioactivity of Compounds and Compound Mixtures. Chem. Soc. Rev. 2014, 43, 1899-1933. (5) Belowich, M. E.; Stoddart, J. F. Dynamic Imine Chemistry. Chem. Soc. Rev. 2012, 41, 2003-2024. (6) Hunt, R. A. R.; Otto, S. Dynamic Combinatorial Libraries: New Opportunities in Systems Chemistry. Chem. Commun. 2011, 47, 847-858. (7) Au-Yeung, H. Y.; Cougnon, F. B. L.; Otto, S.; Pantoş, G. D.; Sanders, J. K. M. Exploiting Donor–acceptor Interactions in Aqueous Dynamic Combinatorial Libraries: Exploratory Studies of Simple Systems. Chem. Sci. 2010, 1, 567-574. (8) Lehn, J.-M. Perspectives in Chemistry-Aspects of Adaptive Chemistry and Materials. Angew. Chem. Int. Ed. 2015, 54, 3276-3289. (9) Wei, Z.; Yang, J. H.; Zhou, J.; Xu, F.; Zrínyi, M.; Dussault, P. H.; Osada, Y.; Chen, Y. M. Self-healing Gels based on Constitutional Dynamic Chemistry and Their Potential Applications. Chem. Soc. Rev. 2014, 43, 8114-8131. (10) Lehn, J.-M. Dynamers: Dynamic Molecular and Supramolecular Polymers. Prog. Polym. Sci. 2005, 30, 814-831. (11) Holub, J.; Vantomme, G.; Lehn, J.-M. Training a Constitutional Dynamic Network for Effector Recognition: Storage, Recall, and Erasing of Information. J. Am. Chem. Soc. 2016, 138, 11783-11791.


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(12) Vantomme, G.; Jiang, S.; Lehn, J.-M. Adaptation in Constitutional Dynamic Libraries and Networks, Switching between Orthogonal Metalloselection and Photoselection Processes. J. Am. Chem. Soc. 2014, 136, 9509-9518. (13) Kovaříček, P.; Lehn, J.-M. Merging Constitutional and Motional Covalent Dynamics in Reversible Imine Formation and Exchange Processes. J. Am. Chem. Soc. 2012, 134, 94469455. (14) Giuseppone, N.; Schmitt, J.-L.; Lehn, J.-M. Generation of Dynamic Constitutional Diversity and Driven Evolution in Helical Molecular Strands under Lewis Acid Catalyzed Component Exchange. Angew. Chem. 2004, 116, 5010-5014. (15) Ingerman, L. A.; Waters, M. L. Photoswitchable Dynamic Combinatorial Libraries: Coupling Azobenzene Photoisomerization with Hydrazone Exchange. J. Org. Chem. 2009, 74, 111-117. (16) Chaur, M. N.; Collado, D.; Lehn, J.-M. Configurational and Constitutional Information Storage: Multiple Dynamics in Systems Based on Pyridyl and Acyl Hydrazones. Chem. Eur. J. 2011, 17, 248-258. (17) Wang, S.; Yue, L.; Shpilt, Z.; Cecconello, A.; Kahn, J. S.; Lehn, J.-M.; Willner, I. Controlling the Catalytic Functions of DNAzymes within Constitutional Dynamic Networks of DNA Nanostructures. J. Am. Chem. Soc. 2017, 139, 9662-9671. (18) Yue, L.; Wang, S.; Cecconello, A.; Lehn, J.-M.; Willner, I. Orthogonal Operation of Constitutional Dynamic Networks Consisting of DNA-Tweezer Machines. ACS Nano 2017, 11, 12027-12036. (19) Wang, S.; Yue, L.; Li, Z.-Y.; Zhang, J.; Tian, H.; Willner, I. Light-Induced Reversible Reconfiguration of DNA-Based Constitutional Dynamic Networks: Application to Switchable Catalysis. Angew. Chem. Int. Ed. 2018, 57, 8105-8109.


Page 30 of 38

Page 31 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

(20) Yue, L.; Wang, S.; Lilienthal, S.; Wulf, V.; Remacle, F.; Levine, R. D.; Willner, I. Intercommunication of DNA-Based Constitutional Dynamic Networks. J. Am. Chem. Soc. 2018, 140, 8721–8731. (21) Wang, F.; Lu, C.-H.; Willner, I. From Cascaded Catalytic Nucleic Acids to Enzyme– DNA Nanostructures: Controlling Reactivity, Sensing, Logic Operations, and Assembly of Complex Structures. Chem. Rev. 2014, 114, 2881-2941. (22) Soloveichik, D.; Seelig, G.; Winfree, E. DNA as a Universal Substrate for Chemical Kinetics. Proc. Natl. Acad. Sci. USA 2010, 107, 5393-5398. (23) Zhang, D. Y.; Seelig, G. Dynamic DNA Nanotechnology Using Strand-displacement Reactions. Nat. Chem. 2011, 3, 103-113. (24) Gehring, K.; Leroy, J.-L.; Guéron, M. A Tetrameric DNA Structure with Protonated Cytosine-cytosine Base Pairs. Nature 1993, 363, 561-565. (25) Chen, L.; Cai, L.; Zhang, X.; Rich, A. Crystal Structure of a Four-stranded Intercalated DNA: d(C4). Biochemistry 1994, 33, 13540-13546. (26) Hu, Y.; Cecconello, A.; Idili, A.; Ricci, F.; Willner, I. Triplex DNA Nanostructures: From Basic Properties to Applications. Angew. Chem. Int. Ed. 2017, 56, 15210-15233. (27) Chen, Y.; Lee, S.-H.; Mao, C. A DNA Nanomachine Based on a Duplex–Triplex Transition. Angew. Chem. Int. Ed. 2004, 43, 5335-5338. (28) Leitner, D.; Schröder, W.; Weisz, K. Influence of Sequence-Dependent Cytosine Protonation and Methylation on DNA Triplex Stability. Biochemistry 2000, 39, 5886-5892. (29) Lu, C.-H.; Qi, X.-J.; Orbach, R.; Yang, H.-H.; Mironi-Harpaz, I.; Seliktar, D.; Willner, I. Switchable Catalytic Acrylamide Hydrogels Cross-Linked by Hemin/G-Quadruplexes. Nano Lett. 2013, 13, 1298-1302. (30) Aleman-Garcia, M. A.; Orbach, R.; Willner, I. Ion-Responsive Hemin-G-Quadruplexes for Switchable DNAzyme and Enzyme Functions. Chem. Eur. J. 2014, 20, 5619-5624.


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(31) Miyake, Y.; Togashi, H.; Tashiro, M.; Yamaguchi, H.; Oda, S.; Kudo, M.; Tanaka, Y.; Kondo, Y.; Sawa, R.; Fujimoto, T.; Machinami, T.; Ono, A. MercuryII-Mediated Formation of Thymine−HgII−Thymine Base Pairs in DNA Duplexes. J. Am. Chem. Soc. 2006, 128, 2172-2173. (32) Ono, A.; Cao, S.; Togashi, H.; Tashiro, M.; Fujimoto, T.; Machinami, T.; Oda, S.; Miyake, Y.; Okamoto, I.; Tanaka, Y. Specific Interactions between Silver(i) Ions and Cytosine–cytosine Pairs in DNA Duplexes. Chem. Commun. 2008, 4825-4827. (33) Freeman, R.; Finder, T.; Willner, I. Multiplexed Analysis of Hg2+ and Ag+ Ions by Nucleic Acid Functionalized CdSe/ZnS Quantum Dots and Their Use for Logic Gate Operations. Angew. Chem. 2009, 121, 7958-7961. (34) Wang, Z.-G.; Elbaz, J.; Willner, I. DNA Machines: Bipedal Walker and Stepper. Nano Lett. 2011, 11, 304-309. (35) Wang, Z. G.; Elbaz, J.; Remacle, F.; Levine, R. D.; Willner, I. All-DNA Finite-state Automata with Finite Memory. Proc. Natl. Acad. Sci. USA 2010, 107, 21996-22001. (36) Kamiya, Y.; Asanuma, H. Light-Driven DNA Nanomachine with a Photoresponsive Molecular Engine. Acc. Chem. Res. 2014, 47, 1663-1672. (37) Asanuma, H.; Ito, T.; Yoshida, T.; Liang, X.; Komiyama, M. Photoregulation of the Formation and Dissociation of a DNA Duplex by Using the cis-trans Isomerization of Azobenzene. Angew. Chem. Int. Ed. 1999, 38, 2393-2395. (38) Meng, F.-N.; Li, Z.-Y.; Ying, Y.-L.; Liu, S.-C.; Zhang, J.; Long, Y.-T. Structural Stability of the Photo-responsive DNA Duplexes Containing One Azobenzene via a Confined Pore. Chem. Commun. 2017, 53, 9462-9465. (39) Osborne, S. Aptamers as Therapeutic and Diagnostic Reagents: Problems and Prospects. Curr. Opin. Chem. Biol. 1997, 1, 5-9.


Page 32 of 38

Page 33 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

(40) Famulok, M.; Mayer, G. Aptamer Modules as Sensors and Detectors. Acc. Chem. Res. 2011, 44, 1349-1358. (41) Famulok, M.; Hartig, J. S.; Mayer, G. Functional Aptamers and Aptazymes in Biotechnology, Diagnostics, and Therapy. Chem. Rev. 2007, 107, 3715-3743. (42) Joyce, G. F. Directed Evolution of Nucleic Acid Enzymes. Annu. Rev. Biochem. 2004, 73, 791-836. (43) Willner, I.; Shlyahovsky, B.; Zayats, M.; Willner, B. DNAzymes for Sensing, Nanobiotechnology and Logic Gate Applications. Chem. Soc. Rev. 2008, 37, 1153-1165. (44) Travascio, P.; Li, Y.; Sen, D. DNA-enhanced Peroxidase Activity of a DNA Aptamerhemin Complex. Chem. Biol. 1998, 5, 505-517. (45) Travascio, P.; Bennet, A. J.; Wang, D. Y.; Sen, D. A Ribozyme and a Catalytic DNA with Peroxidase Activity: Active Sites versus Cofactor-binding Sites. Chem. Biol. 1999, 6, 779-787. (46) Golub, E.; Lu, C.-H.; Willner, I. Metalloporphyrin/G-quadruplexes: From Basic Properties to Practical Applications. J. Porphyrins Phthalocyanines 2015, 19, 65-91. (47) Breaker, R. R. DNA Enzymes. Nat. Biotechnol. 1997, 15, 427-431. (48) Breaker, R. R.; Joyce, G. F. A DNA Enzyme with Mg2+-dependent RNA Phosphoesterase Activity. Chem. Biol. 1995, 2, 655-660. (49) Qian, Z.; Ginger, D. S. Reversibly Reconfigurable Colloidal Plasmonic Nanomaterials. J. Am. Chem. Soc. 2017, 139, 5266-5276. (50) Wang, F.; Liu, X.; Willner, I. DNA Switches: From Principles to Applications. Angew. Chem. Int. Ed. 2015, 54, 1098-1129. (51) Wang, W.; Liu, H.; Liu, D.; Xu, Y.; Yang; Zhou, D. Use of the Interparticle i-Motif for the Controlled Assembly of Gold Nanoparticles. Langmuir 2007, 23, 11956-11959.


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(52) Chen, Y.; Mao, C. pH-Induced Reversible Expansion/Contraction of Gold Nanoparticle Aggregates. Small 2008, 4, 2191-2194. (53) Hurst, S. J.; Hill, H. D.; Macfarlane, R. J.; Wu, J.; Dravid, V. P.; Mirkin, C. A. Synthetically Programmable DNA Binding Domains in Aggregates of DNA-Functionalized Gold Nanoparticles. Small 2009, 5, 2156-2161. (54) Li, Z.; Mirkin, C. A. G-Quartet-Induced Nanoparticle Assembly. J. Am. Chem. Soc. 2005, 127, 11568-11569. (55) Yan, Y.; Chen, J. I. L.; Ginger, D. S. Photoswitchable Oligonucleotide-Modified Gold Nanoparticles: Controlling Hybridization Stringency with Photon Dose. Nano Lett. 2012, 12, 2530-2536. (56) Wei, Y.; Han, S.; Kim, J.; Soh, S.; Grzybowski, B. A. Photoswitchable Catalysis Mediated by Dynamic Aggregation of Nanoparticles. J. Am. Chem. Soc. 2010, 132, 1101811020. (57) Hazarika, P.; Ceyhan, B. l.; Niemeyer, C. M. Reversible Switching of DNA-Gold Nanoparticle Aggregation. Angew. Chem. Int. Ed. 2004, 43, 6469-6471. (58) Storhoff, J. J.; Lazarides, A. A.; Mucic, R. C.; Mirkin, C. A.; Letsinger, R. L.; Schatz, G. C. What Controls the Optical Properties of DNA-Linked Gold Nanoparticle Assemblies? J. Am. Chem. Soc. 2000, 122, 4640-4650. (59) Mirkin, C. A.; Letsinger, R. L.; Mucic, R. C.; Storhoff, J. J. A DNA-based Method for Rationally Assembling Nanoparticles into Macroscopic Materials. Nature 1996, 382, 607609. (60) King, N. S.; Liu, L.; Yang, X.; Cerjan, B.; Everitt, H. O.; Nordlander, P.; Halas, N. J. Fano Resonant Aluminum Nanoclusters for Plasmonic Colorimetric Sensing. ACS Nano 2015, 9, 10628-10636.


Page 34 of 38

Page 35 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

(61) Lu, Y.; Liu, J. Smart Nanomaterials Inspired by Biology: Dynamic Assembly of ErrorFree Nanomaterials in Response to Multiple Chemical and Biological Stimuli. Acc. Chem. Res. 2007, 40, 315-323. (62) Rosi, N. L.; Mirkin, C. A. Nanostructures in Biodiagnostics. Chem. Rev. 2005, 105, 1547-1562. (63) Wang, C.; Ma, Z. Colorimetric Detection of Oligonucleotides Using a Polydiacetylene Vesicle Sensor. Anal. Bioanal. Chem. 2005, 382, 1708-1710. (64) Song, Y.; Wei, W.; Qu, X. Colorimetric Biosensing Using Smart Materials. Adv. Mater. 2011, 23, 4215-4236. (65) Liu, J.; Lu, Y. Fast Colorimetric Sensing of Adenosine and Cocaine Based on a General Sensor Design Involving Aptamers and Nanoparticles. Angew. Chem. Int. Ed. 2006, 45, 90-94. (66) Huang, C.-C.; Huang, Y.-F.; Cao, Z.; Tan, W.; Chang, H.-T. Aptamer-Modified Gold Nanoparticles for Colorimetric Determination of Platelet-Derived Growth Factors and Their Receptors. Anal. Chem. 2005, 77, 5735-5741. (67) Liu, J.; Lu, Y. Optimization of a Pb2+-Directed Gold Nanoparticle/DNAzyme Assembly and Its Application as a Colorimetric Biosensor for Pb2+. Chem. Mater. 2004, 16, 3231-3238. (68) Liu, J.; Lu, Y. Accelerated Color Change of Gold Nanoparticles Assembled by DNAzymes for Simple and Fast Colorimetric Pb2+ Detection. J. Am. Chem. Soc. 2004, 126, 12298-12305. (69) Cecconello, A.; Besteiro, L. V.; Govorov, A. O.; Willner, I. Chiroplasmonic DNAbased Nanostructures. Nat. Rev. Mater. 2017, 2, 17039. (70) Cecconello, A.; Kahn, J. S.; Lu, C.-H.; Khosravi Khorashad, L.; Govorov, A. O.; Willner, I. DNA Scaffolds for the Dictated Assembly of Left-/Right-Handed Plasmonic Au


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 38

NP Helices with Programmed Chiro-Optical Properties. J. Am. Chem. Soc. 2016, 138, 98959901. (71) Shen, X.; Song, C.; Wang, J.; Shi, D.; Wang, Z.; Liu, N.; Ding, B. Rolling Up Gold Nanoparticle-Dressed

DNA

Origami

into

Three-Dimensional

Plasmonic

Chiral

Nanostructures. J. Am. Chem. Soc. 2011, 134, 146-149. (72) Kuzyk, A.; Schreiber, R.; Fan, Z.; Pardatscher, G.; Roller, E.-M.; Högele, A.; Simmel, F. C.; Govorov, A. O.; Liedl, T. DNA-based Self-assembly of Chiral Plasmonic Nanostructures with Tailored Optical Response. Nature 2012, 483, 311-314. (73) Mitchell, G. P.; Mirkin, C. A.; Letsinger, R. L. Programmed Assembly of DNA Functionalized Quantum Dots. J. Am. Chem. Soc. 1999, 121, 8122-8123. (74) Kim, T.; Noh, M.; Lee, H.; Joo, S.-W.; Lee, S. Y.; Lee, K. Fluorescence-Based Detection of Point Mutation in DNA Sequences by CdS Quantum Dot Aggregation. J. Phys. Chem. B 2009, 113, 14487-14490. (75) Hu, L.; Liu, X.; Cecconello, A.; Willner, I. Dual Switchable CRET-Induced Luminescence of CdSe/ZnS Quantum Dots (QDs) by the Hemin/G-Quadruplex-Bridged Aggregation and Deaggregation of Two-Sized QDs. Nano Lett. 2014, 14, 6030-6035. (76) Freeman, R.; Liu, X.; Willner, I. Chemiluminescent and Chemiluminescence Resonance Energy Transfer (CRET) Detection of DNA, Metal Ions, and Aptamer–Substrate Complexes Using Hemin/G-Quadruplexes and CdSe/ZnS Quantum Dots. J. Am. Chem. Soc. 2011, 133, 11597-11604. (77)

Liu,

X.;

Freeman,

R.;

Golub,

E.;

Willner,

I.

Chemiluminescence

and

Chemiluminescence Resonance Energy Transfer (CRET) Aptamer Sensors Using Catalytic Hemin/G-Quadruplexes. ACS Nano 2011, 5, 7648-7655. (78) Zhang, Z.; Zhang, X.; Liu, B.; Liu, J. Molecular Imprinting on Inorganic Nanozymes for Hundred-fold Enzyme Specificity. J. Am. Chem. Soc. 2017, 139, 5412-5419.


Page 37 of 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

(79) Sun, Y.; Zhao, C.; Gao, N.; Ren, J.; Qu, X. Stereoselective Nanozyme Based on Ceria Nanoparticles Engineered with Amino Acids. Chem. Eur. J. 2017, 23, 18146-18150.


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

For Table of Contents only


Page 38 of 38

Controlling the Catalytic and Optical Properties of Aggregated

Recommend Documents