Cooperative Vaccinia Infection Demonstrated at ... - ACS Publications

Jun 26, 2012 - Virus entry and infection are generally monitored by dispensing bulk ... FluidFM combines atomic force microscopy (AFM) with nanofluidi...
0 downloads 0 Views 2MB Size
Download PDF
Letter pubs.acs.org/NanoLett

Cooperative Vaccinia Infection Demonstrated at the Single-Cell Level Using FluidFM Philipp Stiefel,† Florian I. Schmidt,‡ Pablo Dörig,§ Pascal Behr,§ Tomaso Zambelli,*,§ Julia A. Vorholt,† and Jason Mercer*,‡ †

Institute of Microbiology, ‡Institute of Biochemistry, and §Laboratory of Biosensors and Bioelectronics, Institute of Biomedical Engineering, ETH Zurich, Switzerland

Downloaded via IOWA STATE UNIV on January 15, 2019 at 12:25:31 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

S Supporting Information *

ABSTRACT: The mechanisms used by viruses to enter and replicate within host cells are subjects of intense investigation. These studies are ultimately aimed at development of new drugs that interfere with these processes. Virus entry and infection are generally monitored by dispensing bulk virus suspensions on layers of cells without accounting for the fate of each virion. Here, we take advantage of the recently developed FluidFM to deposit single vaccinia virions onto individual cells in a controlled manner. While the majority of virions were blocked prior to early gene expression, infection of individual cells increased in a nondeterministic fashion with respect to the number of viruses placed. Microscopic analyses of several stages of the virus lifecycle indicated that this was the result of cooperativity between virions during early stages of infection. These findings highlight the importance of performing controlled virus infection experiments at the single cell level. KEYWORDS: Poxvirus, virus entry, cooperative infection, fluidFM

V

containing suspension with a calculated infectivity, based on the number of replication competent particles, is added to cells. To date, single-particle single-cell VACV infection studies have not been performed. For other viruses such as adeno-associated virus, influenza virus, and Dengue virus, single particle tracking studies have been performed in individual living cells under bulk infection conditions.6−8 The ability to visualize and track individual events in the lifecycle of a single virus, as demonstrated in these studies, has led to detailed insights into the entry, trafficking pathways, and fusion of these viruses in host cells (reviewed in ref 9). However, to investigate single-particle single-cell infections, the potential influence of multivirus infection on the replication cycle or antiviral evasion, and the stages of replication for which nonproductive virus particles are defective, deposition of single or multiple virions onto a single cells is needed. FluidFM combines atomic force microscopy (AFM) with nanofluidics for operation in a liquid environment.10,11 By allowing for precise manipulation of microchanneled cantilevers, surfaces can be approached automatically with force set points in the piconewton range and positional control in the nanometer range. Volumes smaller than a femtoliter can be dispensed from the aperture of the cantilever using over pressure. Using FluidFM technology to place VACV particles

accinia virus (VACV) is the prototypic poxvirus, once used as the vaccine for the eradication of smallpox.1 VACV is a large (360 × 250 nm) double-stranded DNA virus characterized by its complexity and exclusively cytoplasmic replication. During its lifecycle VACV produces two types of infectious particles, the most abundant form being mature virions (MVs). MVs contain a single lipid bilayer that surrounds a viral core containing a 180 kbp viral genome with approximately 200 open reading frames. MVs are released from host cells upon lysis and are responsible for host-to-host transmission.1 Infectious stocks of VACV consisting of high amounts of MVs can be readily produced.2 For VACV the classic measurement of infectivity within a virus stock is the plaqueforming unit (PFU). This measurement reflects the number of virus particles within a viral stock that can complete a replication cycle from virus entry to virus spread. However, the majority of assembled viral particles are incapable of completing an infectious cycle upon encountering a susceptible host cell.3 One reason for this may be that the viral particles are defective, that is, lack structural components or properties required for infection. For VACV, the ratio between total and replication competent virions is known as the particle:PFU ratio. This ratio can be determined using several different techniques.4,5 To date there is little information regarding the critical stages of virus infection in which naturally occurring biological defects in viral particles occur or cellular antiviral responses are most effective. Most experimental procedures performed with VACV MVs are done using bulk infection. Under these conditions, a virus © 2012 American Chemical Society

Received: May 14, 2012 Revised: June 21, 2012 Published: June 26, 2012 4219

dx.doi.org/10.1021/nl3018109 | Nano Lett. 2012, 12, 4219−4227

Nano Letters

Letter

Figure 1. Lifecycle of VACV WR pE/L-EGFP/mCherry-A5. (a) Schematic of VACV MV replication cycle from virus binding to egress. Stages of the VACV lifecycle that can be visualized, binding and internalization, early and late gene expression, and virion assembly to spread, are shown. (b−d) Confocal images representing each stage of infection that can be visualized. (b) binding (mCherry virions), (c) early gene expression (EGFP), and (d) virus assembly (mCherry virions). Actin is visualized using phalloidin (blue).

be monitored by the expression of EGFP (Figure 1c). At late times post infection, the mCherry-A5 was used as a marker for successful virus assembly as it is incorporated into assembling virus particles (Figure 1d). Thus, this fluorescent virus can be used to monitor virions from binding to virus assembly. It can be used to distinguish between virions that lead to successful infection from those that do not and to determine the stage of infection at which particles are blocked. For all experiments the MV form of VACV was utilized. FluidFM Can Be Used for the Controlled Release of VACV MVs. FluidFM has not yet been applied to deliver particles in general and viruses in particular. Therefore, the starting point was to establish whether viruses could freely move within the cantilever microchannel and be released one-by-one from the aperture of the tipless cantilever. A concentration of 2.3 × 106 virions/ml was empirically determined to be the optimal concentration of viruses for deposition and adopted for all subsequent experiments. To test the delivery of single virus particles, fluorescent VACV MVs were loaded into the cantilever. The virus-loaded cantilever clipped to the probe holder was then fixed to the AFM and mounted into the chamber containing Tris buffer (for details see Material and Methods). To determine the appropriate pressure needed to release single virions, different pressures ranging from 0 to 20 mbar were applied with a pressure controller while monitoring the movement of viruses within the cantilever channel. A pressure of 5 mbar assured single virus release in a reproducible manner. In Figure 2a single fluorescent MV can be seen traversing the hollow channel within the transparent cantilever whose edges and aperture are visible due to slight autofluorescence (Figure 2; 0−4 s). Upon reaching the cantilever aperture, the particle leaves the cantilever (Figure 2; 5−11 s) (Supporting Information Video 1). This demonstrated that FluidFM

onto cells in a controlled manner we investigated single-cell infection by single and multiple VACV virions. In this report, we demonstrate that FluidFM can be successfully used for the controlled delivery of single VACV virions onto selected host cells. These studies provide proof-ofconcept for controlled, image-based, single-cell infection studies using FluidFM. By placing single VACV particles on host cells we could accurately assess the fate of individual viruses and categorized the stage of the lifecycle at which each virus particle was blocked. In addition, we observed that the success rate of infection increased with the number of particles placed on a single cell in a greater than linear fashion. This suggests that cooperativity between virus particles influences the infection process during the earliest stages of infection up to and including early gene expression. The same strategy of local dispensing could be applied for any small nonbiological or biological particle, including viral and bacterial pathogens. Thus, it may be used for a diverse array of studies aimed at understanding biological phenomena at the single cell and/or single particle level. Results. Microscopic Analysis of the Virus Lifecycle Using Fluorescent Recombinant VACV WR pE/L-EGFP/mCherry-A5. In order to monitor several stages of the VACV lifecycle microscopically, a recombinant virus, WR pE/L-EGFP/ mCherry-A5, was constructed. This virus incorporates a mCherry fluorescent fusion of the virus core protein A5 and expresses EGFP from an early/late viral promoter after entry into host cells. A simplified schematic of the VACV lifecycle illustrating the stages of replication that can be detected utilizing WR pE/LEGFP/mCherry-A5 is depicted in Figure 1a. By following the mCherry-A5 signal at early stages of infection, it could be determined if individual virus particles placed on selected cells bind and internalize (Figure 1b). Early or late virus gene expression from virus particles that successfully entered could 4220

dx.doi.org/10.1021/nl3018109 | Nano Lett. 2012, 12, 4219−4227

Nano Letters

Letter

Figure 2. Virus release from FluidFM cantilever. pE/L-EGFP/mCherryA5 vaccinia viruses released from the hollow FluidFM cantilever into liquid using 5 mbar overpressure. The virus (blue arrowhead) and the aperture at the tip of the cantilever (red circle) can be visualized. The virion traverses the cantilever channel (0−4 s) before emerging from the cantilever tip (5 s). The released virion can be seen drifting away from the cantilever after release (6−11 s). The 100× oil objective and red fluorescence was used to monitor this event (Supporting Information Video 1).

Figure 3. Deposition of a single VACV MV. (a) Image of the FluidFM cantilever in gentle contact with a cell selected for delivery of a virus particle. (b) Visualization of a single VACV MV on the target cell after virus deposition. A merged bright field and red fluorescence image shows the single mCherry-A5 VACV MV (arrowhead) on the cell surface. The laser is not visible due to the use of a green fluorescence filter. (c) FluidFM VACV deposition procedure. (i) Positioning of the cantilever above a specific cell, (ii) force-controlled approach onto the cell and release of a virus by applying overpressure, (iii) retraction of the cantilever with pressure suspension to prevent unwanted virion delivery, and (iv) representation of virion entry and early gene expression.

technology can be used to deliver particles in the nanometer size range. Single VACV MVs Can Be Deposited onto Selected Cells Using FluidFM. The following step was to determine if FluidFM could be used to place a single VACV MV onto the surface of a target cell. In Figure 3, the stages of a single virus placement are shown. A cell was chosen for infection and the cantilever positioned above this cell by manipulating the micrometric x,y stage. The AFM was brought into gentle contact with the cell surface using the AFM force-feedback (Figure 3a). The AFM was maintained at a constant height and 5 mbar of pressure was applied to the tubing to release a single VACV MV from the cantilever aperture. Upon virus delivery, the pressure was suspended and the cantilever removed. Exemplarily, a single fluorescent MV bound to the cell surface is shown in Figure 3b. In cases where the virion drifted away, under-pressure was used to draw the virion back into the channel to prevent virus binding to surrounding cells. To demonstrate the control and precision of this procedure, four single viruses were placed onto four individual cells at the corners of a single image plane (Supporting Information Figure S1). A schematic of FluidFM virion deposition is illustrated in Figure 3c. FluidFM Virus Deposition Allows for Analysis of Single Cell Infection. Before undertaking single-cell infection experiments we assured that each stage of the virus lifecycle could be reliably detected after virus deposition. Using FluidFM, WR pE/LEGFP/mCherry-A5MVs were placed onto individual HeLa cells that were then monitored for 24 h. Virus entry, early gene expression, and virus assembly could each be reliably detected. Upon binding of VACV MVs to host

cells, they are difficult to remove even upon trypsin or protease treatment.5,12 After internalization viral cores undergo rapid disassembly and disappear as visible cytosolic structures.13 During the course of our experiments we could observe instances in which bound viruses were internalized and remained near the plasma membrane (evidenced by weak fluorescence) prior to their disappearance (Supporting Information Figure S2). Careful monitoring of the cells in the area of the target cell was performed during each experiment to ensure that bound virions did not become unattached and bind to surrounding cells. Neither an aberrant binding nor infection event was observed in all of the experiments performed throughout this study. Thus, loss of a fluorescent virus from the cell surface was interpreted as a successful internalization event. A representative example of virus entry is shown in Figure 4. Three viruses were placed on a single cell and by 55 min post deposition (min p.d.) one virus particle had internalized. This was followed by a second at approximately 2.5 h post deposition (h p.d.) (Supporting Information Figure S3; 2 h 20 min and 2 h 50 min p.d.). In fact, the third virus remained at the cell surface for at least 14 h p.d. (Supporting Information Figure S3; 13 h 50 min p.d.). Within six hours, this cell contained detectable levels of virus-expressed EGFP (Supporting Information Figure S3). This indicated that at least one of the internalized particles was capable of expressing EGFP from 4221

dx.doi.org/10.1021/nl3018109 | Nano Lett. 2012, 12, 4219−4227

Nano Letters

Letter

well as virus assembly during single particle infection was delayed when compared to bulk infections (Figure 1b−d) and known kinetics of the VACV replication cycle.1 Virus spread to neighboring cells could also be observed after single cell infection. EGFP expression in cells neighboring a primary infected cell could be seen around 15 h p.d. An example of such an outcome is shown in Supporting Information Figure S4. These results indicated that FluidFM can be used to investigate multiple stages of the VACV lifecycle at the level of single-cell infection. The Majority of VACV MVs Are Blocked at Early Stages of the Virus Lifecycle. The particle/PFU ratio of a virus stock is routinely used as a measurement of the total number of virus particles in relation to the number of viruses capable of initiating plaque formation. However, to date there is no systematic, single-virion analysis technique to identify the stages of the lifecycle nonreplicating VACV particles are blocked. To this end, single MVs were placed onto individual HeLa cells. These cells were then monitored for up to 24 h. In total, 73 single-virus, single-cell infections were analyzed for virus entry, EGFP expression, and virus assembly (Figure 6a). We found that 48% of VACV MVs were capable of entering cells, and that 9.6% of the total viruses placed were capable of directing early gene expression. Less than 2% of VACV MVs were capable of completing the entire virus lifecycle and directing assembly of progeny virions. The low level of assembly events we observed was consistent with the measured particle/PFU (58:1) of the VACV stock used in these experiments. Figure 6b is a schematic representation depicting the percentage of total particles capable of reaching each stage of the virus lifecycle (black numbers). The percentage of particles that could (green arrows) or could not (red arrows) proceed from one stage of the virus lifecycle to the next are also displayed. The Rate Single Cell VACV MV Infection Is Influenced by the Number of Virions Placed. Using bulk infection techniques one cannot determine if infectivity correlates with the number of virions present on the cell surface, or if the number of virions that bind or internalize have a positive or negative effect on the rate or kinetics of successful infection. The ability to place a defined number of viruses onto a single cell using FluidFM

Figure 4. Entry of deposited VACV MVs. (a) Three pE/L-EGFP/ mCherry-A5 VACV MVs (arrowhead) were placed onto an individual HeLa cell. (b,c) Entry of one VACV MV between 50 and 55 min p.d. (d) At 60 min p.d. two virions remain cell associated. Shown are merged bright field and red fluorescence images. Insets are the red fluorescence image of VACV MVs. Additional time points are shown in Supporting Information Figure S3.

the viral genome. However, the cell never became mCherry positive, indicating that the internalized virus did not reach late gene expression. Consistent with this, assembly of progeny virus was not detected (Supporting Information Figure S3; 13 h 50 min p.d.). An example of virus assembly and spread after single-cell infection can be seen in Figure 5. After successful VACV MV deposition (Figure 5a), EGFP was detected 6 h later (data not shown). By 11 h p.d. there was a noticeable boost in EGFP expression, concomitant with strong late viral gene expression (Figure 5b). Virus assembly was observed shortly after with the appearance of fluorescent virions in the infected cell (Figure 5c). Of note, the kinetics of early and late gene expression, as

Figure 5. Single cell infection directed by a single deposited MV. (a) A single pE/L-EGFP/mCherry-A5 vaccinia virus (arrowhead) was placed onto a single HeLa cell. (b) Expression of late EGFP could be detected at 11 h p.d. (c) Visualization of newly assembled virus particles (red) at 15 h p.d. Images are merged brightfield, red fluorescence, and green fluorescence. Insets are close ups of individual infected cell in each channel. 4222

dx.doi.org/10.1021/nl3018109 | Nano Lett. 2012, 12, 4219−4227

Nano Letters

Letter

the number of viruses placed (Figure 7a). When two viruses were placed on a single cell the infection rate greater than tripled to 34.8%. When three viruses were placed the rate increased by over 6-fold to 65.4%. Four viruses caused infection in 90% of the cases, and when more viruses (8−12) were placed on a single cell, 100% of these cells were infected. Thus, the empirical percentage of infection was significantly greater than the expected deterministic infectivity of multiple particles. As can be seen in Figure 7b, the deterministic model falls clearly out of the 95% confidence interval of the measurements and thus cannot explain the observations. A logistic regression of the experimental data shows that the results can be clearly explained assuming the number of placed virions as the only parameter. These results strongly indicate that VACV infection shows cooperative behavior. In contrast to infection, the number of virions placed on a cell did not influence entry of VACV. While the number of entering particles increased when more viruses were placed (e.g., 1 of 2 vs 2 of 4), the probability of each virus to enter remained at 47−55% (Figures 7a, Supporting Information S5a,b). Regardless of the number placed, most frequently half of the virions entered (Supporting Information Figure S5c). These results indicate that VACV entry is not cooperative. Thus, postentry events, up to and including expression of early genes, are the main contributor to the cooperative infection process. The number of cells in which virus assembly could be observed increased with the number of virions placed (Figure 7a; # of cells with assembly). In fact, 14 of 18 assembly events occurred in cells on which 4 or more viruses were added. When only considering the 69 cells that expressed early genes, the probability of assembly remained unchanged in cells on which 1, 2, or 3 virions were placed (Figure 7a; % assembly from EGE cells). However, when four viruses were added the chance of virus assembly increased 2-fold. When 8−12 virions were placed, the assembly probability increased to 3.6-fold over that of 1, 2, or 3 viruses. These results suggest that cooperativity may also occur at the level of virus assembly. VACV Cooperativity May Influence Bulk Infection. Next we wanted to determine if cooperativity also influences virus early gene expression during bulk infection. Using a virus that expresses EGFP under the control of an early promoter, WR pE-EGFP, cells were infected at either a multiplicity of infection (MOI) of 1 or 10. Flow cytometry analysis showed that at 2 h post infection (hpi), the number of cells expressing early genes was greater in cells infected at an MOI of 10 than in cells infected at an MOI of 1 (Figure 8; red lines). At this time point, the intensity of early gene expression in cells infected at MOI 10 was also greater. At 4 hpi, there was still a marked difference in the number of cells expressing early genes as well as the intensity of early gene expression in cells infected at MOI 10 versus MOI 1 (Figure 8; green lines). By 6 hpi, although more cells were infected at MOI 10, the level of early gene expression in cells infected at either MOI was equivalent. These results demonstrate that the more virus particles used for infection, the faster and more robust the expression of early genes occurs. These findings are consistent with the occurrence of early cooperativity during bulk infection. Discussion. The aims of this study were to demonstrate single-virus delivery by FluidFM and to investigate VACV MV infection at the single-cell level. We showed that fluorescent VACV virions could be loaded into a FluidFM cantilever and that these viruses could move freely inside the microchannel.

Figure 6. The majority of VACV MVs are blocked early in the virus lifecycle. (a) Seventy-three individual single-cell, single VACV MV infections were monitored for virus entry, early gene expression (EGE), and virus assembly. The percentage of virions successful for each stage, the percentage of particles blocked at each stage, and the overall percentage of blocked particles is represented. (b) Schematic representation of data presented in (a).

provided a unique opportunity to test if VACV MV infection was deterministic or cooperative. Assuming that infection is a deterministic effect of a single infecting virion, one can calculate the probability of a single cell to be infected. This probability is a function of the number of particles placed on that cell and the probability of infection by one particle. When a single virus was placed on a single cell we found that 9.6% of cells were infected (Figures 6a and 7a). If infection was deterministic then 18.3% of cells would be expected to become infected after placing two viruses, 26.1% expected after placing three viruses, 33.2% expected after placing four viruses, and so on. To investigate infection relative to the number of viruses placed, a series of experiments was performed in which 1, 2, 3, 4, and 8−12 viruses were positioned on single cells. These cells were then monitored for virion entry, early gene expression, and assembly. Interestingly, by analyzing over 160 single cell infections, we found that the chance of a cell to become infected increased in a nondeterministic fashion with regard to 4223

dx.doi.org/10.1021/nl3018109 | Nano Lett. 2012, 12, 4219−4227

Nano Letters

Letter

Figure 7. VACV MV single-cell infection is cooperative. (a) Varying numbers of VACV MVs were deposited on individual HeLa cells using FluidFM technology. Virus bound cells were monitored for virus entry, early gene expression (EGE), and virion assembly. The summary of 26 individual experiments with a total of 161 positions is summarized in the table. Single virion data from Figure 6 is also displayed for comparison. (b) Graphical representation of the probability that a cell becomes infected (EGE) dependent on the number of placed virions. A logistic regression (white triangle) was calculated for the experimental data (black triangle), which fits the data and into the 95% confidence interval (gray area). The expected deterministic probability of infection calculated from the empirical value of a single virus infection (black circle), as well as for the worst case within the confidence interval (white circle) are shown.

Single VACV particles could be released in a controlled manner into a liquid filled chamber. In the course of a single experiment the same cantilever could be used to systematically place single or multiple virions onto selected cells within a population. The delivery of solid particles using FluidFM technology represents a critical step forward in this technology and opens a widerange of experimental possibilities. The flexibility in cantilever design, in which the height of the channel, the aperture shape and size, and the cantilever surface coating can be altered, allows for adaptation to specific experimental needs.10 Taking these parameters into account, the FluidFM particle delivery procedure could be applied to any other small fluorescent biological or nonbiological particle. This includes other viruses or bacteria, coated beads, quantum dots, or fluorescently labeled small compounds. This technology could be used to study aspects of signaling, endocytosis, or membrane rearrangement at the single-cell level. Using FluidFM to study infection of single cells with single VACV MVs allowed us to determine at which stages of

infection nonproductive viruses were blocked. For VACV, the early stages of infection were the most critical. We found that 90% of particles were arrested prior to early gene expression. Although, we did not distinguish between virus entry by macropinocytosis and direct fusion of virions with the plasma membrane,14−16 52% of particles were blocked at virus entry. Of the 48% of virions that did enter cells, 80% were incapable of directing early gene expression. These virions may have been defective in escaping macropinosomes (in the case of endocytic entry), virus core activation, early gene expression itself, or overcoming a host defense mechanism (see Figure 1a). Arrested virus entry likely results from defects in the virion, since host cell restriction of VACV usually takes place after internalization.17 For post entry blocks, defects in virus particles or restriction of virus infection in host cells are both likely contributors. One could speculate that infection by a single virion is more readily inhibited by host cell antiviral mechanisms than infection by multiple virions. For instance, endogenous levels of the viral DNA replication restriction 4224

dx.doi.org/10.1021/nl3018109 | Nano Lett. 2012, 12, 4219−4227

Nano Letters

Letter

Figure 8. Bulk infection kinetics support early VACV cooperativity. HeLa cells infected with WR pE-EGFP at an MOI of 1 (left) or 10 (right) were analyzed by flow cytometry for EGFP expression at 2, 4, and 6 hpi for both number of infected cells and fluorescence intensity.

Cooperativity during early VACV infection is further supported by the increased kinetics of gene expression seen when using an MOI of 1 versus an MOI of 10 for bulk infection. Consistent with known virus gene expression and assembly kinetics,1 infection with many particles resulted in early gene expression by 2 hpi and assembly of new virions by 6 hpi. When single VACV virions were placed on cells, early gene expression could be detected at 6 hpi, late gene expression by 11 hpi, and virion assembly at 12 hpi. This is more than double the time required during bulk infection experiments. These results suggest that during bulk infection, cooperativity may serve to increase the rate of infection. In turn, increased kinetics may provide the advantage of rapid virus replication and spread before immune recognition or response. In this report, we also observed that the number of cells in which virus assembly occurred, increased when four or more viruses were added to a single cell. Consistent with this finding, it has been reported that poxviruses including VACV, as well as other viruses such as influenza can undergo “multiplicity reactivation”.19−22 These experiments showed that plaque formation by inactivated viruses can be rescued in a nondeterministic fashion by coinfection with competent viruses. Occurring late in infection, multiplicity reactivation of poxviruses has been attributed to recombination between defective and competent virus genomes, although a role for genome uncoating in trans has not been rule out.20 In line with the requirement for recombination, the increase in VACV assembly that we observed was dependent on the number of virus particles that entered the cell. In other words, the more viral genomes available for recombination the higher the probability that multiplicity reactivation could occur. We suspect that the mechanisms of VACV cooperativity and multiplicity reactivation may complement each other to promote successful full-cycle replication. It will be of future interest to determine if early VACV cooperativity influences late multiplicity reactivation. Collectively these findings highlight the variety of strategies used by viruses to ensure their reproduction. While not previously described for viruses, early cooperativity may prove to increase the chances of successful infection and subsequently enhance virus replication kinetics. Cooperativity is likely to be a strategy used by many pathogens to circumvent defective particles or potent cellular antiviral responses.

factor BAF may be more effective against single, as opposed to multiple, uncoated viral genomes.18 In either case, these studies have increased our knowledge of the stages of replication at which VACV particles are naturally vulnerable. From this we may glean information regarding the viral processes that would make sensible targets for future antiviral development. By placing different numbers of VACV particles on single cells we could effectively demonstrate that the frequency of successful internalization and infection rises as more virions are placed per cell. While virus entry was found to be linearly dependent on the number of viruses bound to the cell, the cooperativity observed at the level of virus early gene expression is likely to occur after entry of the virions. An explanation of postentry cooperativity may be that viruses lacking a critical factor can be complemented in trans by other viruses. Another possibility is that two particles can more readily overcome a host defense that would normally prevent replication by a single particle. To investigate if post entry cooperativity might be explained by the ability of multiple viruses to overcome a host cell antiviral defense, we subjected our experimental data to a limited resources model. In this model it is assumed that the cell has a finite amount of antiviral factors to defend against infection, that all virions that enter a single cell are capable of infecting, and that each virus has the same capacity to counteract host defenses. The probability that a virus is blocked is proportional to the remaining free defense resources. Under these assumptions, the defense capability of the cell linearly degrades with the virion number, indicating that there should be a critical number of virions against which the cell can no longer defend itself (i.e., viruses overwhelm the host restriction factor). Such an assumption is consistent with our experimental data (Supporting Information Figure S6) and the critical number of virions at which the cell should always become infected is predicted to be 4.4. Below this, the cell is theoretically able to successfully block infection depending upon the amount of free defense resources and the probability that they encounter the incoming virion. Thus, the fewer virions “attacking” the cell, the better the chances are that the cell can defend against infection. This suggests that the observed cooperativity prior to early gene expression in fact reflects the capacity of multiple virions to more readily overcome a host antiviral mechanism. 4225

dx.doi.org/10.1021/nl3018109 | Nano Lett. 2012, 12, 4219−4227

Nano Letters

Letter

Single Virus Placement. The tubing and probeholder were filled with viruses diluted in 1 mM Tris buffer (pH 9). The hollow probe was then mounted to the probeholder and loaded with virus solution by applying overpressure. The outside of the cantilever and probeholder were rinsed to eliminate any loose viruses before fixing the probeholder and dipping it into the culturing chamber. Imaging. A Zeiss AxioObserver D1 microscope with a PlanNeofluar 40×/0.6 LD and a Plan-Apochromat 100 tme/1.40 oil objective was used to optically control the AFM. EXFO X-Cite series 120Q illumination system at second highest intensity was used for fluorescence imaging. Zeiss filterset 38 HE was used for green and filterset 43 HE for red fluorescence. Exposure times of 750 ms for red and 500 ms for green fluorescence were used. Images were taken with an AxioCam MRm and edited with the Zeiss AxioVision and Adobe Photoshop software. Statistical Analysis. For statistical analysis, several experiments in which single or multiple vaccinia viruses were placed onto single HeLa cells were performed. In each experiment, viruses were placed at up to eight positions on the same glass slide. The different positions were at least 1 mm away of each other to avoid any interaction. Viruses could be relocated based on the coordinate information on the stage screw. After 60−90 min of manipulation, the culturing chamber was closed and one of the positions followed by automatically taking a brightfield, EGFP, and mCherry fluorescence image every 5 min for the first 2.5 h and for every 30 min after that. The other positions were checked at 7 h post deposition for early gene expression and at 14 h after deposition for virus assembly. For each position the following information was collected: number of viruses deposited, number of viruses remaining on the cell membrane 7 h after deposition, expression of early genes 7 h after deposition (green fluorescence), and new virus assemby 14 h after deposition (red fluorescence). The probability of entry, early gene expression, and assembly was then calculated depending of the number of viruses deposited. The confidence interval of the measured data was calculated based on a binomial test using MATLAB and the binofit function. The confidence level was set to 95% and was one sided for the cases were all cells were infected. The logistic regression of the data was calculated using MATLAB and its glmfit regression, where binomial distribution was assumed and “logit” was set as link. The intercept resulted in β0 = −3.66 and β1 = 1.46 per placed virion. Infection Probability = exp(β0 + β1*#viruses)/(1 + exp(β0 + β1*#viruses)). For the limited defense resource model the following assumptions were made (not accounting for biological noise). (i) The defense resources of the cell are limited and constant during the observed time; (ii) for each experiment, each cell has the same defense resources; (iii) each virion that binds to the cell engages a certain amount of the cells defense resources; (iv) the probability that a virus infection is blocked is proportional to the host defense resources that remain after sequestration of these resources by each entering virus; and (v) if no cell defense resources are left the virions always infect successfully. This leads to a linear mathematical model, where the probability of blocking the infection P is P = D0 − x*Dv. D0 is the initial cell defense resources, x is the number of infecting virions, and Dv the amount of host resources occupied by each virion. If P falls below 0, the model predicts every infecting virion is successful; if P is above 1 every infecting virion is blocked. Thus, a linear regression of the experimental data

Additional FluidFM-based single-virus single-cell studies are likely to help further our understanding of both the mechanisms of VACV MV cooperativity, and its consequences for productive virus replication and immune evasion. Material and Methods. Virus Construction. Recombinant vaccinia virus (VACV) strains are based on strain Western Reserve (WR). VACV WR pE/L-EGFP, encoding EGFP under a synthetic early/late promoter in the thymidine kinase locus, and VACV WR mCherry-A5, encoding a fusion protein of mCherry and A5 in the endogenous locus of A5, were described before.12,15 VACV WR pE-EGFP, encoding EGFP under the J2R early promoter in the thymidine kinase locus, was generated using a derivative of plasmid pJS423 in which the right synthetic early/late promoter was replaced with the J2R early promoter (CGAATAAAGTGAACAATAATTAATTCTTTATT), followed by a 9 nt spacer and the EGFP coding sequence. To build WR pE/L-EGFP/mCherry-A5, BSC-40 cells were coinfected with pE/L-EGFP and mCherry-A5 viruses; dual-colored recombinants of the parental viruses were selected through four rounds of plaque purification on BSC-40 cells. All virus preparations were band purified as previously described.24 Calculation of Particle to Plaque Forming Unit. The particle/PFU was determined by measuring the OD260 under the assumption that 1 OD unit is equivalent to 1.2 × 1010 particles per ml.4 To obtain the particle to PFU ratio the particles per milliliters was then divided by the measured plaque forming units per ml as determined by serial dilution of the virus stock. Cell Growth. HeLa cells were maintained in DMEM (Gibco) containing 10% fetal bovine serum (PAA Laboratories) and 1% penicillin/streptomycin (Gibco) at 37 °C and 5% CO2. The day before the experiment cells were seeded on 40 mm glass cover slides in Petri dishes for 80−90% confluence on the day of the experiment. For experiments, the glass slides were fixed to the stage insert with an aluminum ring which can be filled with 2.5 mL media. The whole working environment is heated to 37 °C by an incubation chamber (Zeiss/PeCon). After manipulation the culturing chamber was closed airtight with an additional cover slide for long-term observation. Bulk Virus Infection. HeLa cells were infected with WR pE/LEGFP/mCherry-A5 at an MOI of 1. Cells were fixed with 4% PFA at varying times post infection, and cells were stained for actin using Alexafluor-647 coupled phalloidin (Invitrogen). Cells were imaged by confocal microscopy for virus particles (mCherry), early/late viral gene expression (green), and actin (far red). Flow Cytometry. Confluent 12-wells of HeLa cells were infected for flow cytometry-based infection assays. MVs in DMEM were bound to HeLa cells on ice for 1 h and subsequently incubated in full medium. At the indicated times, cells were washed with PBS, trypsinized, resuspended, and fixed in 4% formaldehyde in PBS. Cells were analyzed using a BD FACSCalibur flow cytometer and the FlowJo software package. FluidFM and Microchanneled Cantilevers. FluidFM experiments were carried out using the FluidFM from Cytosurge Ltd. (Zurich, CH). The tipless hollow probes (Cytosurge Ltd., Zurich, CH) were made of silicon nitride (length 150 μm, heights 1.5 μm, width 24 μm; circular aperture 8 μm) and have been described before (Dörig et al. 2010). Probes were subjected to plasma cleaning (PDC-32G, Harrick Plasma) for 5 min prior to use. 4226

dx.doi.org/10.1021/nl3018109 | Nano Lett. 2012, 12, 4219−4227

Nano Letters

Letter

(17) McFadden, G. Nat. Rev. 2005, 3 (3), 201−13. (18) Wiebe, M. S.; Traktman, P. Cell Host Microbe 2007, 1 (3), 187− 97. (19) Berry, G. P.; Dedrick, H. M. J. Bact. 1936, 31, 1. (20) Abel, P. Virology 1962, 17, 511−9. (21) Fenner, F.; Holmes, I. H.; Joklik, W. K.; Woodroofe, G. M. Nature 1959, 183 (4671), 1340−1. (22) Henle, W.; Liu, O. C. J. Exp. Med. 1951, 94 (4), 305−22. (23) Chakrabarti, S.; Sisler, J. R.; Moss, B. Biotechniques 1997, 23 (6), 1094−1097. (24) Mercer, J.; Traktman, P. J. Virol. 2003, 77 (16), 8857−8871.

where P is between 0 and 1 can give D0, Dv as well as the critical virion numbers where P equals 0 or 1. For our experiments this section is between 1 and 4 virion infecting simultaneously. A linear regression gives an R̂ 2 of 0.997 and results in D0 = 1.18, Dv = −0.27, the critical virion number of 4.4 where P = 0.

■

ASSOCIATED CONTENT

S Supporting Information *

Additional figures and video. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail (T.Z.) [email protected] (FluidFM technology); (J.M.) [email protected] (vaccinia). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This study was supported by ETH Zurich, SNSF Ambizione PZ00P3_131988 to J.M. and by the Swiss innovation promotion agency KTI-CTI (11722.1 PFNM-NM to T.Z. and J.A.V.). Nanosurf AG (Liestal CH) is acknowledged for lending a FlexAFM head. The authors would like to thank Stephen Wheeler (ETH LBB workshop) for technical support and Janos Vörös for fruitful discussion. P.S., F.I.S., P.D., P.B., and J.M. performed the experiments; P.S., P.D., F.I.S., T.Z., J.A.V., and J.M. analyzed the data; P.S., F.I.S., T.Z., J.A.V., and J.M. conceived and designed the experiments; and P.S., T.Z., J.A.V., and J.M. wrote the manuscript. F.I.S. is supported by ETHZ, ERC, and InfectX grants awarded to Ari Helenius.

■

REFERENCES

(1) Moss, B.; Knipe, D. M.; Howley, P. M. Poxviridae: The Viruses and Their Replication. In Fields Virology; Lippincott-Raven: Phila., 2007; Vol. 5. (2) Kotwal, G. J.; Abrahams, M. R. Methods Mol. Biol. 2004, 269, 101−12. (3) Overman, J. R.; Sharp, D. G. J. Exp. Med. 1959, 110, 461−80. (4) Joklik, W. K. Virology 1962, 18, 9−18. (5) Vanderplasschen, A.; Smith, G. L. J. Virol. 1997, 71 (5), 4032− 4041. (6) Seisenberger, G.; Ried, M. U.; Endress, T.; Buning, H.; Hallek, M.; Brauchle, C. Science 2001, 294 (5548), 1929−32. (7) Lakadamyali, M.; Rust, M. J.; Babcock, H. P.; Zhuang, X. Proc. Natl. Acad. Sci. U.S.A. 2003, 100 (16), 9280−5. (8) van der Schaar, H. M.; Rust, M. J.; Chen, C.; van der EndeMetselaar, H.; Wilschut, J.; Zhuang, X.; Smit, J. M. PLoS Pathog. 2008, 4 (12), e1000244. (9) Ruthardt, N.; Lamb, D. C.; Brauchle, C. Mol. Ther. 2011, 19 (7), 1199−211. (10) Dörig, P.; Stiefel, P.; Behr, P.; Sarajlic, E.; Bijl, D.; Gabi, M.; Voros, J.; Vorholt, J. A.; Zambelli, T. Appl. Phys. Lett. 2010, 97, 023701. (11) Meister, A.; Gabi, M.; Behr, P.; Studer, P.; Voros, J.; Niedermann, P.; Bitterli, J.; Polesel-Maris, J.; Liley, M.; Heinzelmann, H.; Zambelli, T. Nano Lett 2009, 9 (6), 2501−7. (12) Schmidt, F. I.; Bleck, C. K.; Helenius, A.; Mercer, J. EMBO J. 2011, 30 (17), 3647−61. (13) Joklik, W. K. J. Mol. Biol. 1964, 8, 277−88. (14) Schmidt, F. I.; Bleck, C. K.; Mercer, J. Curr. Opin. Virol. 2012, 2 (1), 20−7. (15) Mercer, J.; Helenius, A. Science 2008, 320 (5875), 531−5. (16) Huang, C. Y.; Lu, T. Y.; Bair, C. H.; Chang, Y. S.; Jwo, J. K.; Chang, W. J. Virol. 2008, 82 (16), 7988−99. 4227

dx.doi.org/10.1021/nl3018109 | Nano Lett. 2012, 12, 4219−4227