Cucurbituril and Azide Cofunctionalized Graphene Oxide for

Subscriber access provided by READING UNIV

Article

Cucurbituril and Azide Co-Functionalized Graphene Oxide for Ultrasensitive Electro-Click Biosensing Tianxiang Wei, Tingting Dong, Hong Xing, Ying Liu, and Zhihui Dai Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.7b03068 • Publication Date (Web): 18 Oct 2017 Downloaded from http://pubs.acs.org on October 22, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 8

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Cucurbituril and Azide Co-Functionalized Graphene Oxide for Ultrasensitive Electro-Click Biosensing Tianxiang Wei,†,‡ Tingting Dong,† Hong Xing,† Ying Liu,† Zhihui Dai*,†,§ †

Jiangsu Key Laboratory of Biofunctional Materials, School of Chemistry and Materials Science, Nanjing Normal University, Nanjing, 210023, P. R. China. ‡ School of Environment, Nanjing Normal University, Nanjing, 210023, P. R. China § Nanjing Normal University Center for Analysis and Testing, Nanjing, 210023, P. R. China * Tel./Fax: +86-25-85891051. E-mail: [email protected].

ABSTRACT: To achieve high selectivity and sensitivity simultaneously in an electrochemical biosensing platform, cucurbituril and azide co-functionalized graphene oxide, a new functional nanomaterial that acts as a go-between to connect the recognition element with amplified signal architecture, is developed in this work. The cucurbituril and azide co-functionalized graphene oxide features a high specific surface area with abundant levels of the two types of functional groups. Specifically, it emerges as a powerful tool to link recognition elements with simplicity, high yield, rapidity and highly selective reactivity through azide-alkynyl click chemistry. Moreover, it possesses many host molecules to interact with guest molecules (also signal molecules)-grafted branched ethylene imine polymer, through which the detection sensitivity can be greatly improved. Together with electro-click technology, a highly controllable, selective and sensitive biosensing platform can easily be created. For VEGF165 protein detection, the electroclick assay has high selectivity and sensitivity; a dynamic detection range from 10 fg mL-1 to 1 ng mL-1 with a detection limit of 8 fg mL-1 was achieved. The electro-click biosensing strategy based on cucurbituril and azide co-functionalized graphene oxide would have great promise for other target analytes with a broad range of application.

Electrochemical biosensing is an important biosensing strategy due to its advantages of simple manipulation, portable instrumentation and low cost1-5. In particular, electrochemical biosensing is both more convenient and simpler than many other assays, as many chemical assays are solution-based assays, while electrochemical processes occur on solid surfaces6,7. A typical elctrochemical biosensor contains two basic functional units: a recognition element and a transducer8. The selectivity of the biosensor is determined by the recognition element, and the sensitivity is conferred by the transducer, which converts the recognition units into an electrochemical signal. Constructing an electrochemical biosensor with both high selectivity and sensitivity is in high demand in analysis fields. Thus, researchers should consider the recognition element and transducer simultaneously. We consider joining the recognition element and transducer in one step to reach this goal. For the purpose, it is crucial to develop effective coupling methods between the recognition element and transducer. In the past decade, copper(I)-catalyzed alkyne-azide cycloaddition (CuAAC) “click” chemistry has emerged as a very efficient method to modify solids due to its simplicity, moderate reaction conditions, high yield and highly selective reactivity9,10. Hence, when constructing elctrochemical biosensors, CuAAC chemistry is clearly an excellent option to efficiently ligate the recognition element to the electrode surface, join the recognition elements, modify the transducer, and conjugate with signal tags on the surface of the transducer to enable effective signal amplification. However, the conventional generation of catalytic Cu(I) species lacks spatial and temporal con-

trol. Electro-click chemistry is an electrochemical strategy to generate Cu(I) from Cu(II) in situ instead of using a reductant. In addition, it can achieve spatial and temporal control of the click reaction11. Considering the connections in an electrochemical biosensor, electro-click chemistry might be an excellent fit. For recognition elements, nucleic acids and aptamers have many advantages, such as being thermally stable, reusable, and easily producible12-14, and they can be easily modified with reporter molecules (e.g., electron mediators, fluorophores, and enzymes) and functional groups (e.g., thiol, amino, carboxyl, alkyne, and biotin). Therefore, nucleic acids or aptamers were chosen as the recognition elements of our electrochemical biosensor. For the transducer, with the development of nanotechnology, functional nanomaterials have been widely applied as the transducer when constructing highly sensitive biosensors15-17. Carbon nanomaterials have often been applied as the transducer material18-20, typically graphene, which has drawn increasing attention in the field of electrochemical biosensing and can act as the transducer nanomaterial due to its extraordinary electronic properties and high surface area21. Graphene can be functionalized by conjugating biomolecules or signal molecules on its surface to prepare nanoprobes that enable target recognition and effective signal amplification. Accordingly, to connect the recognition element and transducer, azide-functionalized graphene oxide (N3-GO) was prepared first (Figure 1A). Then, by taking advantage of the azide groups at the GO surface, cucurbit[7]urils (a member of the cucurbit[n]uril (CB[n], n = 5–8, 10) macrocycle family22 that can form extremely stable complexes with ami-

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

nomethylferrocene (Fc) through host-guest interaction with high binding strength at almost the same level as that between biotin and avidin23-25) were immobilized on the GO surface through photocrosslinking with part of the azide groups26 to form cucurbituril and azide co-functionalized graphene oxide (CB[7]-N3-GO). CB[7]-N3-GO can act as a go-between to connect the recognition element with the amplified signal architecture for the following reasons. First, the remaining azide groups on the surface of GO can be connected to the alkynefunctionalized DNA, and thus, CB[7]-N3-GO can be immobilized on the electrochemical electrode surface. Second, the plenty of CB[7] molecules at the surface of GO with its high specific surface area are available for the construction of hostguest complexes with Fc, and thus, CB[7]-N3-GO can act as a bridge between the electrode surface and the effective and abundant electrochemical signals. Third, through synthesizing Fc-grafted branched ethylene imine polymer (BPEI-Fc), signal tags further increase due to the formation of BPEI-Fc/CB[7]N3-GO complexes, and thus, the detection sensitivity can be immensely improved. Vascular endothelial growth factor 165 (VEGF165) plays a key role in the process of tumor angiogenesis27-29. The expression of VEGFR165 is up-regulated in various diseases such as breast cancer and rectal cancer and is closely related to the disease stage. Therefore, the development of simple and sensitive detection methods for VEGF165 is strongly needed to mon-

Page 2 of 8

itor the progress of the diseases. Therefore, we chose VEGF165 protein as our current detection target. By using our synthesized CB[7]-N3-GO, an electro-click biosensing platform with high selectivity and sensitivity was constructed. As shown in Figure 1B, VEGF165 aptamer strand was firstly hybridized with alkyne-functionalized S1 strand in the sample solution. In the presence of target protein-VEGF165, the aptamer bound to VEGF165 and S1 strand was unwound from the aptamer. A hairpin DNA strand (S2) modified on the gold electrode can hybridize with S1 and unwind the hairpin structure, so that the alkyne on S1 was brought to the electrode surface. Then, through an electro-click reaction, Cu2+ near the sensing surface was electroreduced to Cu+, thus realizing Cu+-catalyzed intramolecular organic azide and alkyne cyclization. Finally, the BPEI-Fc/CB[7]-N3-GO composites were linked to the electrode surface through electro-click reaction. Therefore, an amplified electrochemical signal can be detected. That meant, this detection system was controlled by both the target VEGF165 and the electrochemical stimulation. The CB[7]-N3GO acted as an efficient mediator, and based on it, an ultrasensitive electro-click biosensing platform for VEGF165 determination could be easily constructed. The cucurbituril and azide co-functionalized GO would have wide applications in constructing different electrochemical biosensors and shows great promise for various target analysis.

Figure 1. (A) Schematic of the BPEI-Fc/CB[7]-N3-GO composite preparation. (B) Schematic representation of the electro-click biosensing platform for VEGF165 analysis based on BPEI-Fc/CB[7]-N3-GO.

EXPERIMENTAL SECTION Reagents and Materials. Bovine serum albumin (BSA), sodium azide (NaN3), 6-mercapto-1-hexanol (MCH) and CB[7] were purchased from Sigma-Aldrich. Sodium borohydride (NaBH4), graphite powder, and N, N-dimethyl formamide (DMF) were acquired from Sinopharm Chemical Rea-

gent Co., Ltd. (Shanghai, China). BPEI (M.W. 10,000) and ferrocenecarboxaldehyde (Fc-CHO) were obtained from Aladdin Company (China). The BPEI-Fc copolymer was synthesized based on an procedure integrated from previous reports6,30,31, and the details are in the Supporting Information. Recombinant human VEGF165 was purchased from ZhongKeWuYuan Biotechnology Co., Ltd. (Beijing, China). The DNA sequences of this experiment were synthesized and purified by Takara Biotechnology Co., Ltd. (Dalian, China), and the sequences are listed in Table 1. Other chemical regents were all analytical reagents. All solutions, unless mentioned,


Page 3 of 8

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


were prepared with ultrapure water (18.2 MΩ cm) purified by a Millipore Ultra-pure water purifier. Some solution formulations are listed below: PBS solution: 137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.4 DNA hybridization buffer: 10 mM PB, 0.25 M NaCl, pH 7.4 TE buffer: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 Table 1. DNA sequences used in this work Name

Sequence

Apt

5’-TGTGGGGGTGGACTGGGTGGGTACC-3’

S1

5’-Alkyne-GGTACCCACCCAGT-3’

S2

5’-SH-C6TTTTTTCGTACCTTCAAGAGACTGGGTGGG TACGA-3’

Apparatus. Electrochemical experiments including cyclic voltammetry (CV) and square wave voltammetry (SWV) were conducted with a CHI 660D electrochemical workstation. Electrochemical impedance spectroscopy (EIS) was recorded by an Autolab PGSTAT302N electrochemical workstation in 10 mM [Fe(CN)6]3−/4− solution containing 0.1 M KCl. The voltage frequency ranged from 105 Hz to 0.1 Hz, and the amplitude was 5 mV. UV-Vis measurements were performed at room temperature on a Cary 50 UV-Vis absorption spectrometer. FT-IR spectra were acquired in the range of 4000−400 cm−1 on a Tensor 27 at room temperature. Transmission electron microscopes (TEM) observation was carried out on Hitachi H7650 microscopes with accelerating voltages of 80 kV. Atomic Force microscope (AFM) image was recorded with a Nanoscope IIIa scanning probe microscope (Agilent, USA). The X-ray photoelectron spectroscopy (XPS) data were obtained using a scanning X-ray microprobe (PHI 5000 Verasa, ULACPHI, Inc.) with Al Kα radiation. The corresponding binding energies were calibrated with a C 1s peak of 284.6 eV. Preparation of Azide-Functionalized Graphene Oxide (N3-GO). Graphite oxide powder was prepared by Hummers method32 from graphite powder. The obtained graphite oxide powder was dispersed in ultrapure water with sonication for 2 h to obtain graphene oxide (GO). GO was further treated by centrifugation filtering to get the optimized size (Figure S-1, GO size range: 100-400 nm, average size: 300 nm). N3-GO was synthesized utilizing a ring-opening addition reaction following a previous report 33 with some modification. The N3GO synthesis pathway is illustrated in Figure S-2. Briefly, GO (0.05 g) was sonicated into 100 mL of DMF until dissolved completely, and then NaN3 (optimized weight: 0.5 g, Figure S4A, Supporting Information) was added and stirred for 48 h at 40 °C. The product was centrifuged at 10000 rpm for 20 min. The unreacted NaN3 was removed after washing with DMF and centrifuging three times. Finally, N3-GO was dried in a vacuum oven. Preparation of CB[7]-N3-GO. CB[7] was photocrosslinked with azide groups at the surface of GO. Specifically, N3-GO and CB[7] were ground and mixed in the mortar at the optimized weight ratio of 10:1 (Figure S-4B, Supporting Information). After UV-irradiation from a high-pressure mercury lamp for 20 min, the mixture was washed with 1 mL of water

three times and centrifuged at 10000 rpm for 10 min. Finally, the obtained N3-GO-CB[7] was dried in a vacuum oven. Preparation of Hairpin DNA (S2)-Modified Sensing Electrodes and Procedure for VEGF165 Detection. Gold electrodes were first immersed in piranha solution for 5 min and subsequently rinsed with water. The electrodes were polished with alumina slurries (0.05 µm, 0.3 µm, and 1 µm) to a mirror finish and ultrasonically treated in ethanol and water. Then, the gold electrodes were soaked in 50% nitric acid for 30 min and electrochemically cleaned with 1 M H2SO4. Finally, the gold electrodes were thoroughly washed with water and dried under nitrogen gas for later use. Ten microliters of 100 nM Apt was mixed with isopyknic 150 nM S1 in a metal bath at 90 °C for 5 min. Then, the mixture was slowly cooled to room temperature to produce the Apt-S1 hybrid duplex. Subsequently, isopyknic different concentrations of VEGF165 were added to react at room temperature for 50 min to obtain the protein-aptamer conjugates and unwind the S1 strand. We described the above mixture as solution a. Meanwhile, 1 µM S2 dissolved in TE buffer was added to isopyknic 10 mM TCEP solution to react for 1 h at room temperature, and then, 6 µL of the obtained 0.5 µM S2 solution was dropped on the Au surface and allowed to react at 4 °C for 6 h. After washing 3 times with 20 µL of PBST solution (PBS containing 0.05% Tween 20), 6 µL of 1 mM MCH was dropped to coat the S2 monolayer on the Au electrode surface at room temperature for 1 h to block excess active groups and nonspecific binding sites. After washing 3 times with 20 µL of PBST, the electrode was incubated with 6 µL of solution a at 37 °C for 2 h to let the free S1 strand hybridize with the S2 strand. Next, CV was performed in the voltage range of 0.5 to -0.3 mV for 10 min, and then, the electrode was soaked in the supporting electrolyte for another 12 h to carry out the electro-click ligation. In this process, Cu2+ was electro-reduced to Cu+, and then, click chemistry was initiated adjacent to the gold electrode that catalyzed the Huisgen 1,3dipolar cycloadditions between the alkynyl S1 strand and azidated BPEI-Fc/CB[7]-N3-GO composites. The supporting electrolyte was prepared with 1 µg mL-1 BPEI-Fc/CB[7]-N3GO, 10 µM CuSO4·5H2O in aqueous solution and 0.1 M KCl. BPEI-Fc/CB[7]-N3-GO composites were prepared through the following procedure: 1 mL of 20 mg mL-1 BPEI-Fc and isopyknic 1 mg mL-1 CB[7]-N3-GO were stirred at room temperature for 4 h to allow the host-guest interaction between Fc and CB[7], and then, the products, BPEI-Fc/CB[7]-N3-GO composites, were obtained by centrifugation at 10000 rpm for 10 min, washed 3 times with 1 mL of water, and re-dissolved in 1 mL of water. Finally, the modified electrode was removed from the electrolyte and washed 3 times with 20 µL of PBST. The electrochemical detection was performed in 0.1 M NaClO4 with a three-electrodes system. RESULTS AND DISCUSSION Characterization of CB[7]-N3-GO. As shown in Figure S1, through the AFM and TEM characterization, we can see the size range of GO is from 100 to 400 nm, and the average size was about 300 nm. Such GO with the optimized size fitted perfectly for signal amplification in this work, this may due to the following two aspects: (1) GO with larger size tends to stack together, which would greatly impact the homogeneous functionalization of azide and CB[7], (2) GO with too small size would weaken the effect of signal amplification. Next, the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

functionalization of GO with azide groups and the conjugation of CB[7] with N3-GO through photochemical reaction was verified by FT-IR spectra (Figure 2). GO presented peaks at approximately 1740 and 1630 cm-1 corresponding to C=O and C-OH stretching vibration (curve a). After functionalization with the azide groups, a peak at 2120 cm-1 was observed (curve b), which was attributed to the absorptions of N≡N, indicating that azide-functionalized GO was successfully obtained. After UV irradiation, the peak value at 2120 cm-1 clearly decreased, which was due to the depletion of the azido group. Meanwhile, the emergence of peaks at 1740 and 1470 cm-1, which are characteristic of CB[7], suggested that CB[7] was successfully conjugated to the surface of GO (curve c). Notably, the CB[7]-N3-GO dispersion was stable in water (Figure S-3). The above results indicated that N3-GO and CB[7]-N3-GO were successfully synthesized. The successful synthesis of each product was also verified by XPS measurements (Figure 3). The relative atomic concentration percentages obtained from XPS measurements (Table S-1) can give us a basic understanding of the elemental changes induced by the sequential attachment of different functional groups. By carefully evaluating the N 1s region of N3-GO and CB[7]-N3-GO, the functionalization of GO with azide groups and the conjugation of CB[7] with N3-GO through photochemical reaction can be further confirmed. Figure 3A shows the N 1s region for N3-GO. A smaller peak at 404.1 eV and a larger peak at 400.2 eV can be observed, which match the double-

Page 4 of 8

peak structure of azide34. The above results indicated that azide groups had been successfully grafted on the surface of GO. The subsequent conjugation with CB[7] led to an obvious change in the N 1s region (Figure 3B). The N 1s signal of the azide group became weaker, and the N 1s signal (401.3 eV) of the N-C 35 in the structure of CB[7] increased greatly. This further indicated the successful synthesis of N3-GO-CB[7].

Figure 2. FT-IR spectra of GO (a), N3-GO (b), and CB[7]-N3GO (c).

Figure 3. XPS spectra for the N (1s) region of (A) N3-GO and (B) CB[7]-N3-GO. Characterization of BPEI-Fc. BPEI-Fc was synthesized via amine-aldehyde reaction. FT-IR spectra (Figure 4A) can be used to confirm its successful synthesis. As shown in the spectrum of Fc-CHO (Figure 4A, curve a), the peaks at 1680 and 3090 cm-1 can be assigned to the aldehyde group, attributed to C=O and C–H stretching vibrations36. Compared with the FT-IR spectra of BPEI (Figure 4A, curve b), the spectrum of BPEI-Fc showed a broader transmittance peak at about 3090 cm-1, which is attributed to the C–H stretching vibrations of ferrocene; the peak at 3300 cm-1, which is attributed to N–H stretching vibrations, notably decreased 37. Furthermore, the

peaks at 1580 and 1408 cm-1 corresponded to C=O stretching vibrations and N-H bending, indicating the formation of BPEIFc. Two absorption peaks at 341 and 470 nm were observed from the Fc-CHO solution (Figure 4B, curve a), which were caused by the ferrocenyl groups36. The absorbance spectrum of BPEI-Fc showed two broad and wider absorption peaks (Figure 4B, curve a). Compared with the spectra of BPEI and FcCHO (Figure 4B, curve b and c), these two peaks corresponded to the ferrocenyl groups, and the change was attributed to the covalent binding. All the above results demonstrated the successful synthesis of BPEI-Fc.


Page 5 of 8

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. (A) FT-IR spectra and photographs of (a) Fc-CHO, (b) BPEI and (c) BPEI-Fc; (B) UV-Vis absorption spectra and photographs of (a) Fc-CHO, (b) BPEI and (c) BPEI-Fc.

Figure 5. Nyquist diagrams of (a) bare Au electrode, (b) S2/Au, (c) MCH/S2/Au, (d) S1/MCH/S2/Au, and (e) BPEIFc-CB[7]-N3-GO/S1/MCH/S2/Au in 10 mM [Fe(CN)6]3-/4containing 0.1 M KCl. Characterization of the Biosensor. EIS was used to characterize the assembly process of the biosensor (Figure 5). As shown in Figure 5, Nyquist diagrams gradually changed with successive modification of the biosensor. The Nyquist diagram of the bare Au electrode appeared as a small semicircle (curve a). Then, the diameter of semicircle gradually increased after S2, MCH, S1 and BPEI-Fc/CB[7]-N3-GO were sequentially modified on the Au electrode, and the diameter of the semicircle increased gradually (curve b, c, d and e), which demonstrated that electron transfer resistance value increased with the successive modification. The impedance change in the electrode modification process proved that S2、MCH、S1 and BPEI-Fc/CB[7]-N3-GO were successfully successively modified on the surface of the Au electrode. Performance of Elctrochemical Biosensor Towards VEGF165. Under the optimized conditions (Figure S-4, Supporting Information), the CB[7]-N3-GO transducer-based electro-click biosensor was used to quantitatively determine the concentrations of the VEGF165 protein. As shown in Figure 6A, SWV peak currents increased with the increasing concen-

tration of VEGF165 from 10 fg mL-1 to 1 ng mL-1. It can be seen in Figure 6B that the reduction peak current was proportional to the logarithm of the VEGF165 concentration. The linear regression equation of the calibration curve was Ipc(µA) = −0.1134+0.2384 lg[VEGF165(fg mL-1)] in the range of 10 fg mL-1 to 1.0 ng mL-1 with a detection limit of 8 fg mL-1 (S/N = 3) and a correlation coefficient of 0.993. The result revealed that our CB[7]-N3-GO transducer-based electro-click biosensor could provide a wide detection range and an ultrasensitive detection limit towards VEGF165. The detection limit is better than most of the reported research results for quantitative determination of VEGF165 (Table 2). These results confirmed enhanced signal amplification effects from the BPEIFc/CB[7]-N3-GO composition. To investigate the specificity of the biosensor towards VEGF165, different proteins, such as BSA, HSA, VEGFR1, VEGFR2 and VEGF121 were chosen as possible interferents. From the results in Figure 7, it can be seen that the SWV responses of BSA (10 ng mL−1), HSA (10 ng mL−1), VEGFR1 (10 ng mL−1), VEGFR2 (10 ng mL−1) and VEGF121 (10 ng mL−1) were similar to the SWV response of the blank solution. Furthermore, the SWV response of the biosensor with a mixture solution (500 pg mL−1 VEGF165 containing 10 ng mL−1 BSA, 10 ng mL−1 HSA, 10 ng mL−1 VEGFR1, 10 ng mL−1 VEGFR2 and 10 ng mL−1 VEGF121) approached that with only 500 pg mL−1 VEGF165. The results indicated that the electrochemical biosensor has good selectivity. Recovery experiments were done to study the applicability of our electrochemical biosensor towards VEGF165 in real samples. Different concentrations of VEGF165 were spiked into clinical serum samples and then analyzed for recovery. The results showed that recoveries were in the range of 99.6−112% (Table S-2), which showed the high accuracy of the CB[7]-N3GO transducer-based electro-click biosensor and its potential for practical application in clinical diagnosis. A recent literature demonstrated a better and more efficient “insertion approach” to modify the gold electrode,49 and achieved excellent reproducibility. So, in our future work, “insertion approach” would be applied to further improve the performance of this kind of elctrochemical biosensor so as to be better applied to practical usage.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 8

Figure 6. (A) SWV responses of the biosensor incubated with different concentrations of VEGF165: 0 fg mL−1, 5 fg mL−1, 10 fg mL−1, 50 fg mL−1, 500 fg mL−1, 5 pg mL−1, 50 pg mL−1, 500 pg mL−1, 1 ng mL−1, and 5 ng mL−1. (B) Calibration plots of the proposed electrochemical biosensor. Table 2. Comparison of the detection range and sensitivity for different modified electrodes for the VEGF165 assay Method

Detection range

Detection limit

Reference

Luminescent

0.52-52.00 pM

0.17 pM

38

Fluorescence

0.1 nM-16 nM

0.08 nM

39

Surface-Enhanced Fluorescent

25 pg mL-1-25 µg mL-1 (1.25 pM-1.25 µM)

1.25 pM

40

Rolling Circle Amplification Assisted Surface Plasmon Resonance

100 pg mL-1-1 µg mL-1

100 pg mL-1

41

Enhanced Surface-Enhanced Raman Scattering

0.1 pg mL-1-10 ng/mL-1

7 fg mL-1

42

Chemiluminescence

0.5-15 nM

50 pM

43

Field-Effect Transistor

100 fM-10 nM

100 fM

44

Electrochemiluminescence

1 pM-20 nM

0.2 pM

45

Electrochemical

1-120 pM

0.32 pM

46

Electrochemical

10-300 pg mL-1

1.0 pg mL-1

47

Electrochemical

50 pM-0.15 nM

50 pM

48

Electrochemical

10 fg mL-1-1 ng mL-1 (0.26 fM-26 pM)

8 fg mL-1

This work

(0.21 fM) Figure 7. Selectivity of the electrochemical biosensor towards VEGF165 (500 pg mL−1) against the interferent proteins: BSA (10 ng mL−1), HAS (10 ng mL−1), VEGFR1 (10 ng mL−1), VEGFR2 (10 ng mL−1) and VEGF121 (10 ng mL−1).

CONCLUSIONS To achieve high selectivity and sensitivity simultaneously, a new functional nanomaterial, CB[7]-N3-GO, which combined click chemistry with host-guest interactions in constructing an electrochemical biosensing platform, was developed. Its azide groups linked with alkynyl recognition elements on the electrode surface through a simple, high yield, highly selective, and controllable electro-click method. Meanwhile, it coupled with BPEI-Fc to amplify the electrochemical signal through


Page 7 of 8

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CB[7]-Fc host-guest interactions. Based on this material, the constructed VEGF165 electrochemical detection platform achieved good performance with high controllability, selectivity and sensitivity. The electro-click biosensing strategy based on CB[7]-N3-GO would have great promise for other target analytes in a wide range of applications.

ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website. Preparation of BPEI-Fc copolymer, optimization of the modification conditions, characterization of the size of GO (Figure S-1), synthesis pathway of N3-GO (Figure S-2), photographs of CB[7]N3-GO dispersions in water (Figure S-3), the relative percentage of atomic concentration obtained from X-ray photoelectron (Table S-1), and recoveries for VEGF165-spiked serum samples (Table S2) (PDF)

AUTHOR INFORMATION Corresponding Author * Tel./Fax: +86-25-85891051. E-mail: [email protected].

ORCID Zhihui Dai: 0000-0001-7049-7217 Notes The authors declare no competing financial interest.

ACKNOWLEDGMENTS This work was supported by the Natural Science Foundation of China (21625502, 21475062 and 21705079), the Natural Science Foundation of Jiangsu Province (BK20171033), and the Natural Science Foundation of the Jiangsu Higher Education Institutions of China (17KJB150026). We appreciate the financial support from the Priority Academic Program Development of Jiangsu Higher Education Institutions and the Program for Jiangsu Collaborative Innovation Center of Biomedical Functional Materials.

REFERENCES (1) Akanda, M. R.; Ju, H. X. Anal. Chem. 2016, 88, 9856-9861. (2) Chen, S. X.; Dou, Y. Z.; Zhao, Z. H.; Li, F. W.; Su, J.; Fan, C. H.; Song, S. P. Anal. Chem. 2016, 88, 3476-3480. (3) Jia, X. F.; Dong, S. J.; Wang, E. K. Biosens. Bioelectron. 2016, 76, 80-90. (4) Wang, J. Acc. Chem. Res. 2002, 35, 811-816. (5) Shu, J.; Qiu, Z. L.; Wei, Q. H.; Zhuang, J. Y.; Tang, D. P. Sci. Rep. 2015, 5, 15113. (6) Gao, T.; Li, L. D.; Wang, B.; Zhi, J.; Xiang, Y.; Li, G. X. Anal. Chem. 2016, 88, 9996-10001. (7) Wei, T. X.; Dong, T. T.; Wang, Z. Y.; Bao, J. C.; Tu, W. W.; Dai, Z. H. J. Am. Chem. Soc. 2015, 137, 8880-8883. (8) Bandodkar, A. J.; Wang, J. Trends Biotechnol. 2014, 32, 363-371. (9) Castro, V.; Rodriguez, H.; Abericio, F. ACS Comb. Sci. 2016, 18, 1-14. (10) Chen, Y. P.; Xianyu, Y. L.; Wu, J.; Yin, B. F.; Jiang, X. Y. Theranostics 2016, 6, 969-985. (11) Choi, E. J.; Shin, J.; Khaleel, Z. H.; Cha, I.; Yun, S. H.; Cho, S. W.; Song, C. Polym. Chem. 2015, 6, 4473-4478. (12) Teengam, P.; Siangproh, W.; Tuantranont, A.; Henry, C. S.; Vilaivan, T.; Chailapakul, O. Anal. Chim. Acta 2017, 952, 32-40. (13) Li, H.; Arroyo-Curras, N.; Kang, D.; Ricci, F.; Plaxco, K. W. J. Am. Chem. Soc. 2016, 138, 15809-15812. (14) Justino, C. I. L.; Freitas, A. C.; Pereira, R.; Duarte, A. C.; Santos, T. A. P. R. Trac-Trend Anal. Chem. 2015, 68, 2-17.

(15) Wang, J. Small 2005, 1, 1036-1043. (16) van Reenen, A.; de Jong, A. M.; Prins, M. W. J. Anal. Chem. 2017, 89, 3402-3410. (17) Bai, L. J.; Yuan, R.; Chai, Y. Q.; Zhuo, Y.; Yuan, Y. L.; Wang, Y. Biomaterials 2012, 33, 1090-1096. (18) Shang, K.; Wang, X. D.; Sun, B.; Cheng, Z. G.; Ai, S. Y. Biosens. Bioelectron. 2013, 45, 40-45. (19) Loo, A. H.; Bonanni, A.; Pumera, M. Nanoscale 2013, 5, 47584762. (20) Guo, Y. J.; Guo, S. J.; Ren, J. T.; Zhai, Y. M.; Dong, S. J.; Wang, E. K. ACS Nano 2010, 4, 4001-4010. (21) Ambrosi, A.; Chua, C. K.; Bonanni, A.; Pumera, M. Chem. Rev. 2014, 114, 7150-7188. (22) Kim, K.; Selvapalam, N.; Ko, Y. H.; Park, K. M.; Kim, D.; Kim, J. Chem. Soc. Rev. 2007, 36, 267-279. (23) Neirynck, P.; Brinkmann, J.; An, Q.; van der Schaft, D. W. J.; Milroy, L. G.; Jonkheijm, P.; Brunsveld, L. Chem. Commun. 2013, 49, 3679-3681. (24) Jeon, W. S.; Moon, K.; Park, S. H.; Chun, H.; Ko, Y. H.; Lee, J. Y.; Lee, E. S.; Samal, S.; Selvapalam, N.; Rekharsky, M. V., et al. J. Am. Chem. Soc. 2005, 127, 12984-12989. (25) Husken, N.; Taylor, R. W.; Zigah, D.; Taveau, J. C.; Lambert, O.; Scherman, O. A.; Baumberg, J. J.; Kuhn, A. Nano Lett. 2013, 13, 6016-6022. (26) Zhu, X. Q.; Fan, X. W.; Ju, G. N.; Cheng, M. J.; An, Q.; Nie, J.; Shi, F. Chem. Commun. 2013, 49, 8093-8095. (27) Freeman, R.; Girsh, J.; Jou, A. F. J.; Ho, J. A. A.; Hug, T.; Dernedde, J.; Willner, I. Anal. Chem. 2012, 84, 6192-6198. (28) Al-Ameen, M. A.; Ghosh, G. Biosens. Bioelectron. 2013, 49, 105-110. (29) Kwon, O. S.; Park, S. J.; Jang, J. Biomaterials 2010, 31, 47404747. (30) Merchant, S. A.; Tran, T. O.; Meredith, M. T.; Cline, T. C.; Glatzhofer, D. T.; Schmidtke, D. W. Langmuir 2009, 25, 7736-7742. (31) Sun, J. K.; Ren, K. F.; Zhu, L. Z.; Ji, J. Colloid Surface B 2013, 112, 67-73. (32) Hummers, W. S.; Offeman, R. E. J. Am. Chem. Soc. 1958, 80, 1339-1339. (33) Huang, W. C.; Wang, S.; Guo, C. X.; Yang, X. M.; Li, Y. W.; Tu, Y. F. Polymer 2014, 55, 4619-4626. (34) Zhu, W.; Li, W. N.; Wang, C.; Cui, J. C.; Yang, H. W.; Jiang, Y.; Li, G. T. Chem. Sci. 2013, 4, 3583-3590. (35) Wang, Z. H.; Ge, Z. L.; Zheng, X. X.; Chen, N.; Peng, C.; Fan, C. H.; Huang, Q. Nanoscale 2012, 4, 394-399. (36) Deng, S. Y.; Lei, J. P.; Liu, Y.; Huang, Y.; Ju, H. X. Chem. Commun. 2013, 49, 2106-2108. (37) Zhu, L. Z.; Zhou, W. B.; Ji, J. A. J. Nanopart. Res. 2010, 12, 2179-2187. (38) Lin, X.; Leung, K.-H.; Lin, L.; Lin, L.; Lin, S.; Leung, C.-H.; Ma, D.-L.; Lin, J.-M. Biosensors Bioelectron. 2016, 79, 41-47. (39) Zhu, D.; Li, W.; Wen, H. M.; Yu, S.; Miao, Z. Y.; Kang, A.; Zhang, A. H. Biosens. Bioelectron. 2015, 74, 1053-1060. (40) Cho, H. S.; Yeh, E. C.; Sinha, R.; Laurence, T. A.; Bearinger, J. P.; Lee, L. P. ACS Nano 2012, 6, 7607-7614. (41) Chen, H. X.; Hou, Y. F.; Qi, F. J.; Zhang, J. J.; Koh, K.; Shen, Z. M.; Li, G. X. Biosens. Bioelectron. 2014, 61, 83-87. (42) Li, M.; Cushing, S. K.; Zhang, J. M.; Suri, S.; Evans, R.; Petros, W. P.; Gibson, L. F.; Ma, D. L.; Liu, Y. X.; Wu, N. Q. ACS Nano 2013, 7, 4967-4976. (43) Li, W. Y.; Zhang, Q. F.; Zhou, H. P.; Chen, J.; Li, Y. X.; Zhang, C. Y.; Yu, C. Anal. Chem. 2015, 87, 8336-8341. (44) Kwon, O. S.; Park, S. J.; Hong, J. Y.; Han, A. R.; Lee, J. S.; Lee, J. S.; Oh, J. H.; Jang, J. ACS Nano 2012, 6, 1486-1493. (45) Zhang, H.; Li, M. X.; Li, C. H.; Guo, Z. H.; Dong, H. L.; Wu, P.; Cai, C. X. Biosens. Bioelectron. 2015, 74, 98-103. (46) Shamsipur, M.; Farzin, L.; Amouzadeh Tabrizi, M.; Molaabasi, F. Biosens. Bioelectron. 2015, 74, 369-75. (47) Tabrizi, M. A.; Shamsipur, M.; Farzin, L. Biosens. Bioelectron. 2015, 74, 764-769. (48) Zhao, S.; Yang, W. W.; Lai, R. Y. Biosens. Bioelectron. 2011, 26, 2442-2447.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(49) Yang, L.; Zhang, C. H.; Jiang, H.; Li, G. J.; Wang, J. H.; Wang E. K. Anal. Chem. 2014, 86, 4657-4662.

for TOC only


Page 8 of 8

Cucurbituril and Azide Cofunctionalized Graphene Oxide for

Recommend Documents