Cyclooxygenase-2 Expression Is Up-regulated by 2-Aminobiphenyl in

Jan 30, 2012 - ... in a ROS and MAPK-Dependent Signaling Pathway in a Bladder Cancer Cell Line ... *Tel: +886 7 615 1100 ext. ... through NADPH oxidas...
0 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/crt

Cyclooxygenase-2 Expression Is Up-regulated by 2-Aminobiphenyl in a ROS and MAPK-Dependent Signaling Pathway in a Bladder Cancer Cell Line Chien-Cheng Chen,† Yu-Yang Cheng,† Ssu-Ching Chen,‡ Yen-Fan Tuan,† Yun-Ju Chen,§ Chien-Yen Chen,∥ and Lei-Chin Chen*,⊥ †

Department of Biotechnology, National Kaohsiung Normal University, No. 62, Shenjhong Road, Yanchao District, Kaohsiung City 82444, Taiwan ‡ Department of Life Sciences, National Central University, No. 300, Jhongda Road, Jhongli City, Taoyuan County 32001, Taiwan § Department of Biological Science and Technology, I-Shou University, No. 8, Yida Road, Jiaosu Village, Yanchao District, Kaohsiung City 82445, Taiwan ∥ Department of Earth and Environmental Sciences, National Chung Cheng University, No. 168, University Road, Min-Hsiung Township, Chiayi County 62102, Taiwan ⊥ Department of Nutrition, I-Shou University, No. 8, Yida Road, Jiaosu Village, Yanchao District, Kaohsiung City 82445, Taiwan ABSTRACT: Overexposure to biphenyl amine compounds, which are found in smoke and azodyes, is linked to the occurrence of bladder cancer. However, the molecular mechanisms of biphenyl amine compound-induced bladder cancer are still unclear. Many studies have demonstrated that overexpression of cyclooxygenase-2 (COX-2) in neoplastic lesions is associated with carcinogenesis. In this study, we have demonstrated that 2-aminobiphenyl (2-ABP) up-regulated the expression of COX-2 in a dose- and time-dependent manner in TSGH-8301 bladder cancer cells. This 2-ABPinduced COX-2 expression was attenuated by ROS scavenger NAC and NADPH oxidase inhibitors apocynin and DPI. The p22phox subunit of NADPH oxidase, but not p67, and Nox2 was up-regulated by 2-ABP. Knocking down p22phox by siRNA significantly reduced 2-ABP-induced COX-2 expression. Furthermore, 2-ABP also activated the ERK/JNK-AP1 pathways, and this effect was also abolished by NADPH oxidase inhibitors. Blocking the ERK/JNK-AP1 signaling pathways by pharmacological inhibitors attenuated 2-ABP-induced COX-2 expression. Overexpression of the upstream ERK activator MEK1 significantly and consistently increased 2-ABP-mediated COX-2 expression. Transfection of a dominant negative c-Jun mutant, TAM-67, blocked 2-ABP-mediated COX-2 expression, demonstrating that c-Jun was responsible for the transcriptional activation. Taken together, these results demonstrate that 2-ABP induces the carcinogenic factor COX-2 and that this induction is mediated through NADPH oxidase-derived ROS-dependent JNK/ERK-AP-1 pathways.

■

INTRODUCTION Urothelial carcinomas are the fourth most common type of tumor after prostate cancer, lung cancer, and colorectal cancer. Bladder tumors account for 90−95% of urothelial carcinomas, and it is estimated that 386 300 new cases and 150 200 deaths from bladder cancer occur worldwide.1 Bladder cancer develops through complex molecular pathways. Most commonly, mutations in cell cycle regulatory genes and expression of the mutated protein products lead to deregulation of cellular growth control mechanisms and account for tumor proliferation in bladder cancer. Alterations in signal transduction pathways that modulate growth signals can result in the deregulation of genes that control cellular homeostasis. Important signaling pathways in bladder cancer include the Ras−mitogen-activated protein kinase (MAPK) and the Janus kinase (JAK)−signal transducer and activator of transcription (STAT) signaling cascades.2 Neoplastic conditions require angiogenesis to maintain malignant growth and metastatic livelihood. Several angiogenic factors that may play a carcinogenic role in bladder cancer have been identified.3 Cyclooxygenase-2 (COX-2), an angiogenic © 2012 American Chemical Society

factor, is present in higher concentrations in malignant bladder lesions and has been associated with higher pathological stages and grades.4 Cyclooxygenase is a key regulatory enzyme in the conversion of arachidonic acid, a 20-carbon polyunsaturated fatty acid. There are two known isoforms of cyclooxygenase, COX-1 and COX-2, which are encoded by different genes and show cellspecific regulation. COX-1 is constitutively expressed in many tissues and mediates the synthesis of prostaglandins (PGs), which are required for normal physiological functions. COX-2 is an inducible gene that is not found in normal conditions but is induced by a variety of pathological conditions affecting the tissues, such as growth factors, inflammatory stimuli, oncogenes, and carcinogens.5 A growing body of evidence shows that expression of COX-2 strongly correlates with local invasion, lymphovascular space involvement, and recurrence of bladder cancer.6 Currently, trials of COX-2 inhibitors as preventative and therapeutic agents in bladder are ongoing.7 Received: October 30, 2011 Published: January 30, 2012 695

dx.doi.org/10.1021/tx2004689 | Chem. Res. Toxicol. 2012, 25, 695−705

Chemical Research in Toxicology

Article

cellswere used at the exponential phase. Cells were seeded at 6 × 105 cells/60 mm culture dish. After overnight incubation, cells were grown to 50−60% confluence, and the medium was replaced with DMEM medium containing 1% FBS for 24 h before the indicated treatment. The control cells were exposed to equivalent amounts of DMSO, which was the solvent for 2-ABP and inhibitors, and were cultured for the same periods of time as 2-ABP-treated cultures. Cell Viability Assay. Cell viability was measured by the MTT reduction method as previously described.15 In brief, after incubation with 2-aminobiphenyl at different concentrations, cells were incubated with the MTT solution (0.5 mg/mL) for another 3 h at 37 °C. Subsequently, DMSO was added into the mixture and mixed thoroughly. The color change was recorded using spectrophotometry with the MQX200 microplate reader (Bio-Tek Instruments Inc., Winooski, VT) at 570 nm. This test was repeated three times, and the optical density was calculated for statistical analysis. Immunoblot Analysis. TSGH-8301 cells were lysed in RIPA buffer (25 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, and 0.1% SDS) with supplemental protease and phosphatase inhibitors. The protein content of the total cell lysate was measured using the Bio-Rad protein assay reagent. Aliquots of proteins were heated for 5 min at 95 °C and analyzed on sodium dodecyl sulfate−polyacrylamide gel. The separated proteins were electrophoretically transferred onto a PVDF membrane. The membranes were blocked with 5% nonfat dry milk in 0.01 M Tris-buffered saline (pH 7.4) containing 0.05% Tween-20 (TBST) at room temperature for 1 h. Subsequently, the membrane was incubated with primary antibodies overnight at 4 °C. The blots were washed in TBST three times and then incubated with secondary peroxidase-conjugated antibodies for 1 h. The blots were detected by an enhanced chemiluminescence system (Minipore) and exposed to an X-ray film. The density of the immunoblot was quantified with the software of Fujifilm Multi Gauge Version 3.0 (Fujifilm, Tokyo, Japan). Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Total RNA was isolated using the Trizol reagent according to the manufacturer's recommendations. The RNA concentration was determined with a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE) at 260 nm. One microgram of total RNA from each sample was used to generate the first-strand cDNA by using the SuperScript III kit in accordance with the manufacturer's instructions. The PCR primer sequences of COX-2 were as follows: sense primer, GATGGAGAGATGTATCCTCC 3′; antisense primer, CCATTCAGGATGCTCCT GTT. The amplification step was carried through 27 cycles of 95 °C for 30 s, 50 °C for 30 s, and 72 °C for 30 s. The PCR products were transferred onto a 1.5% agarose gel and visualized by ethidium bromide staining. The correct molecular weight was confirmed by a molecular weight marker and normalized with GAPDH, which served as the loading control. Reactive Oxygen Species (ROS) Detection. Detection of ROS was performed by flow cytometry using DCFH-DA as a sensitive nonfluorescent precursor dye according to a published standard procedure.16 Accumulation of intracellular ROS was detected with DCFHDA, which crosses cell membranes and is hydrolyzed by intracellular nonspecific esterases to nonfluorescent DCFH. In the presence of ROS, DCFH is oxidized to highly fluorescent DCF and is readily detected by flow cytometry. The DCF fluorescence intensity is proportional to the amount of intracellular ROS. TSGH-8301 cells were seeded onto 24-well plates at a density of 7 × 104 cells per well and preincubated with 1% serum medium for 24 h followed by incubation with 2-ABP as indicated. Cells were harvested and incubated with 10 μM DCFH-DA at 37 °C for 30 min. Following centrifugation to remove DCFH-DA, cells were suspended in phosphate-buffered saline. The fluorescence was determined by flow cytometry (BD Biosciences, San José, CA) with excitation at 495 nm and emission at 525 nm. The data are presented as the percentage of DMSO-treated control cells. Transfection. The transfection method was performed with TransIT-2020 reagent according to the manufacturer's instruction with a slight modification. TSGH-8301 cells were subcultured for 24 h before transfection at a density of 2 × 105 cells in a six-well plate per well. For use in transfection, 1 μL of TransIT-2020 was mixed with

Human exposure to aromatic amines has long been associated with an elevated risk of urinary bladder cancer.8 Epidemiological studies have revealed that occupational exposure to hair dye and frequent use of hair dyes are risk factors for urinary bladder cancer.9,10 Analytical data revealed that the aromatic amine, 2aminobiphenyl (2-ABP), was present in some permanent hair dyes at quantifiable levels10 and was also detected in the smoke of tobacco cigarettes.11 It has been reported that 2-ABP can bind covalently to DNA bases, which leads to DNA adduct formation and DNA damage.12 Moreover, there was a 2-ABPrelated increase in the incidence of inflammatory cells within the kidneys and interstitial fibrosis in dosed male rats.13 It is well-known that chronic inflammation of both infectious and noninfectious etiologies is thought to contribute to the development of neoplasia.14 Inflammatory mediators can contribute to carcinogenesis by enhancing the levels of reactive oxygen and nitrogen species that have mutagenic effects on DNA, thus contributing to tumor initiation. Inflammatory mediators may also create an environment that supports sustained growth, angiogenesis, migration, and invasion of tumor cells, thus supporting tumor progression and metastasis. COX-2 closely associates with inflammation and appears to be crucial for bladder carcinogenesis. Moreover, MAPK pathways have been implicated in bladder carcinogenesis.2 In this study, we provide evidence to characterize the relationship between COX-2, MAPK, and 2-ABP. 2-ABP could induce ROS generation, activate MAPK pathways, and further increase the expression of COX-2. In this work, we provide a new finding that 2-ABP may play a role in maintaining or supporting the carcinogenic environment of aromatic amines associated with bladder cancer.

■

MATERIALS AND METHODS

Chemicals and Reagents. Chemicals and cell culture materials were obtained from the following sources. 2-Mercaptoethanol, ammonium persulfate, bovine serum albumin, bromophenol blue, dithiothreitol (DTT), ethylene glycol tetraacetic acid, dimethyl sulfoxide, 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), tanshinone IIA (TSIIA), N-acetyl-cysteine (NAC), and apocynin were purchased from Sigma-Aldrich (St. Louis, MO). 2′,7′-Dichlorofluorescin diacetate (DCFH-DA), Trizol, Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), penicillin streptomycin glutamine 100×, SuperScript III kit, and trypsin-EDTA solution 0.25% were obtained from Invitrogen, Inc. (Carlsbad, CA). Immunobilon Western Chemiluminescence HRP solution substrate and PVDF transfer membrane (0.45 μm pore size) were purchased from Minipore (Billerica, MA). Acrylamide 37.5:1 (40%) was obtained from J. T. Baker (Phillipsburg, NJ). SP600125 and UO126 were obtained from Calbiochem (La Jolla, CA). Antibodies including COX-2, ERK2, JNK1/3, p38, actin, p22phox, p67phox, Nox2, and donkey anti-goat IgG-HRP were purchased from Santa Cruz (Santa Cruz, CA). Phospho-p44/42 MAPK (ERK1/2) (Thr202/Tyr204) mAb, phosphoSAPK/JNK (Thr183/Tyr185) mAb, phospho-p38 MARK (Thr180/ Tyr182) mAb, and c-Jun C-terminus mAb were obtained from Cell Signaling Technology (Beverley, MA). Phospho-ATF2 (Thr71) and phospho-c-Jun (Ser63) were purchased from Epitomics, Inc. (Burlingame, CA). TransIT-2020 transfection reagent was purchased from Mirus Bio LLC (Madison, WI). Control siRNA and p22siRNA were obtained from Dharmacon Inc. (Lafayette, CO). Empty vector and expression vector of TAM-67, mJNK, and MEK1 were kindly provided by Dr. B. K. Chen of the National Cheng Kung University (Tainan, Taiwan). Cell Culture. TSGH-8301 (human bladder cancer cell line) cells were grown in DMEM medium supplemented with 10% FBS in a humidified 5% CO2 at 37 °C containing 100 units/mL penicillin, 100 μg/mL streptomycin, and 1.5 mg/mL L-glutamine. For all experiments, 696

dx.doi.org/10.1021/tx2004689 | Chem. Res. Toxicol. 2012, 25, 695−705

Chemical Research in Toxicology

Article

Figure 1. 2-ABP induces cox-2 gene expression. (A) 2-ABP induced cox-2 gene expression in a time-dependent manner. TSGH-8301 cells were incubated with 10 μM 2-ABP for different periods of time as indicated. The protein level of COX-2 was determined by immunoblot analysis. (B) 2ABP induced cox-2 mRNA expression in a time-dependent manner. TSGH-8301 cells were incubated with 10 μM 2-ABP for different periods of time as indicated. The expression level of mRNA was analyzed by RT-PCR. (C) 2-ABP induced cox-2 gene expression in a dose-dependent manner. TSGH-8301 cells were incubated with various concentrations (0.5−10 μM) of 2-ABP for 24 h. COX-2 protein expression was determined by immunoblot analysis. COX-2 protein and mRNA expression were quantified and normalized to actin and GAPDH. Values are means ± SEMs of three determinations (bottom panel). (D) 2-ABP had no effect on cell viability. TSGH-8301 cells were incubated with various concentrations (5− 20 μM) of 2-ABP for 24 h. The cell viability was measured by the MTT reduction method. Values are means ± SEMs of three determinations. The statistical significance between the 2-ABP treatment and the control cells was analyzed by Student”s t test (*p < 0.05, **p < 0.01, and ***p < 0.001). 50 nM siRNA or 1 μg of plasmid and incubated for 30 min at room temperature. Cells were transfected by changing the medium to 1 mL of serum-free DMEM containing TransIT-2020:DNA complex. Following incubation at 37 °C for 5 h, the TransIT-2020:DNA complex/ DMEM mixture was replaced with DMEM medium containing 1% FBS for 19 h. Cells were then treated with 10 μM 2-ABP for 18 h. Subsequently, cells were lysed and analyzed by immunoblot. Statistical Analysis. Results were expressed as the mean ± SEM. Statistical analysis was performed using Student's t test. Those p values that were less than 0.05 were considered statistically significant.

■

mRNA expression was detected using RT-PCR, and this assay revealed that 2-ABP induced COX-2 in a time-dependent manner (Figure 1B). The COX-2 mRNA expression pattern was consistent with COX-2 protein expression levels in cells treated with 2-ABP. Furthermore, incubation of cells with 2-ABP (0.5, 1, 2, 5, and 10 μM) for 24 h resulted in the induction of COX-2 in a concentration-dependent manner. 2-ABP at concentrations ranging from 5 to 20 μM had no effect on TSGH-8301 cell viability and indicated that the applied concentrations of 2-ABP were not toxic to TSGH-8301 cell (Figure 1D). These results indicate that the 2-ABP can increase the inflammatory and carcinogenic factor, COX-2, expression in bladder cancer cells. 2-ABP Induces COX-2 Expression through NADPH Oxidase-Derived ROS Generation. Aromatic amines have been shown to induce the production of ROS in diverse cell types and then mediate their effects on various cellular events.17 Several studies have also demonstrated that ROS contribute to COX-2 expression in various cell types.18 Therefore, we attempted to determine whether ROS participate in 2-ABP-induced COX-2 expression. As shown in Figure 2A, 2-ABP increased the ROS

RESULTS

2-ABP Increases COX-2 Gene Expression in TSGH8301 Cells. To investigate the effects of 2-ABP on COX-2 gene expression, TSGH-8301 cells were treated with various concentrations of 2-ABP, and COX-2 protein expression levels were determined using immunoblot analysis. Treatment of control cells with solvent of 2-ABP, DMSO, had no effect on the expression of COX-2. However, there was a significant increase in COX-2 protein expression within 1 h and reached a maximum at 24 h after 2-ABP stimulation (Figure 1A). Subsequently, 697

dx.doi.org/10.1021/tx2004689 | Chem. Res. Toxicol. 2012, 25, 695−705

Chemical Research in Toxicology

Article

Figure 2. ROS are fundamental elements during 2-ABP-induced COX-2 expression. (A) 2-ABP induces ROS production in a time-dependent manner. TSGH-8301 cells were incubated with 10 μM 2-ABP for different periods of time as indicated. The DCFH-DA method was used to determine the intracellular ROS generation as described in the Materials and Methods. The original pictures of control and 2-ABP-treated for 1 h from the flow cytometric analysis are shown in the upper panel. Values are means ± SEMs of three replicates (bottom panel). (B) NAC significantly attenuates 2-ABP-induced COX-2 expression. TSGH-8301 cells were preincubated with different concentrations of NAC for 0.5 h followed by treatment with 10 μM 2-ABP for 24 h. The COX-2 protein level was determined by immunoblot analysis and normalized to actin. Values are means ± SEMs of three replicates (bottom panel). (C) Suppression of Nox activity by the pharmacological inhibitor apocynin attenuates 2-ABP-induced ROS production and COX-2 expression. TSGH-8301 cells were preincubated with different concentrations of apocynin for 0.5 h followed by treatment with 10 μM 2-ABP for 1 (for DCFH-DA method) or 24 h (for immunoblot analysis). The COX-2 protein level was determined by immunoblot analysis and normalized to actin. Values are means ± SEMs of three replicates (upper and middle panels). The intracellular ROS generation was determined by DCFH-DA method (bottom panel). (D) Suppression of Nox activity by the pharmacological inhibitor DPI attenuates 2-ABP-induced ROS production and COX-2 expression. TSGH-8301 cells were preincubated with different concentrations of DPI for 0.5 h followed by treatment with 10 μM 2-ABP for 1 (for DCFH-DA method) or 24 h (for immunoblot analysis). The COX-2 protein level was determined by immunoblot analysis and normalized to actin. Values are means ± SEMs of three replicates (upper and middle panel). The intracellular ROS generation was determined by DCFH-DA method (bottom panel). (E) 2-ABP increases Nox subunit p22phox expression in a time-dependent manner. TSGH-8301 cells were incubated with 10 μM 2-ABP for different periods of time as indicated. The protein levels of the Nox subunit p22phox, p67phox, and Nox2 were determined by immunoblot analysis and normalized to actin. (F) Knocking down p22phox by specific siRNA abolished 2-ABP-induced COX-2 expression. TSGH-8301 cells were transiently transfected with control or p22phox siRNA as as described in the Materials and Methods. The protein levels of COX-2, p22phox, and actin were determined by immunoblot analysis.

generation in a time-dependent manner with a maximal response within 1 h and slightly reduced after 3 h of treatment but sustained to 6 h. To demonstrate whether ROS participated in 2-ABP-induced COX-2 expression, NAC, a ROS scavenger, was employed. Preincubation of TSGH-8301 cells with 0−20 mM NAC led to a dose-dependent inhibition of COX-2 induction (Figure 2B). The ROS scavenging effects of NAC was confirmed

by measuring ROS generation (Figure 2B, bottom panel). NADPH oxidase (Nox) has been characterized as the main source of intracellular ROS generation.19 Thus, we investigated whether ROS generated by Nox participates in the regulation of COX-2 induction by 2-ABP. Apocynin is a well-known Nox inhibitor; treatment with apocynin effectively reduced the 2-ABPinduced COX-2 protein expression levels in a dose-dependent 698

dx.doi.org/10.1021/tx2004689 | Chem. Res. Toxicol. 2012, 25, 695−705

Chemical Research in Toxicology

Article

the ERK signaling pathway and that the JNK signaling pathway played an auxiliary role. 2-ABP-Induced COX-2 Expression Is Mediated through NADPH Oxidase-Derived ROS-Dependent MAPK Activation. As mentioned above, Nox-derived ROS generation and MAPK activation are involved in 2-ABP-induced COX-2 expression. To determine the specific relationship between the Nox-mediated ROS generation and the MAPK signaling pathways, TSGH-8301 cells were stimulated by 2-ABP in the presence or absence of either NAC or apocynin and subjected to immunoblotting with anti-p-ERK and p-JNK antibodies. Pretreatment of TSGH-8301 cells with apocynin significantly reduced 2-ABP-induced phosphorylation of ERK and JNK in a dose-dependent manner (Figure 4A). Similarly, the increased phosphorylation of JNK and ERK induced by 2-ABP was attenuated in the presence of NAC (Figure 4B). These results suggest that Nox-driven ROS generation is essential for 2-ABP-mediated COX-2 expression via the activation of the ERK/JNK MAPK signaling pathways. To further determine whether the activation of ERK/JNK MAPK by 2-ABP played a role in sustaining ROS production, TSGH-8301 cells were stimulated by 2-ABP in the presence or absence of either U0126 or SP600125. Treatment of TSGH-8301 cells with 2-ABP resulted in ROS production, which was significantly suppressed by the addition of U0126. However, SP600125 had no significant inhibitory effect on 2-ABP-induced ROS generation (Figure 4C). These results suggest that the activation of ERK by 2-ABP played a role in sustaining ROS production. Induction of Transcription Factor AP-1, Which Is Mediated through ROS-Dependent ERK and JNK Cascades, Is Required for 2-ABP-Induced COX-2 Expression. Several reports have demonstrated that COX2 expression can be regulated by MAPKs via activation of AP-1 transcription factor.25 To determine whether 2-ABP-induced COX-2 expression was mediated through the transcription factor AP-1, TSIIA, which is an AP-1 inhibitor, was used. As shown in Figure 5A, pretreatment with the AP-1 inhibitor TSIIA attenuated 2-ABP-induced COX-2 protein expression in a concentration-dependent manner. ATF-2 and c-Jun, components of the AP-1 transcription factor, play a central role in the regulation of cox-2 gene expression in many cell types.24,25 To further determine whether 2-ABP could regulate the AP-1, c-Jun, and ATF-2, TSGH-8301 cells were treated with 2-ABP for different periods of time. As shown in Figure 5B, 2-ABP induced the expression of c-Jun, phosphorylated c-Jun, and phosphorylated ATF-2 in a time-dependent manner. The activation of c-Jun and ATF-2 by 2-ABP reached a peak within 24 h. To further assess whether the transcriptional activity of c-Jun affects 2-ABP-activated COX-2 gene expression, the dominant negative c-Jun TAM-67, which lacks the transactivation domain but retains the DNA-binding and dimerization domains,26 was used. As shown in Figure 5C, TAM-67 dramatically decreased the 2-ABP-induced expression of COX-2, indicating the involvement of c-Jun transcriptional activity in the 2-ABP-mediated gene expression of COX-2. To investigate whether ERK and JNK pathways were involved in 2-ABPinduced AP-1 activation, as shown in Figure 5D, 2-ABP-induced c-Jun and phosphorylated c-Jun expression were completely inhibited by pretreatment with U0126 combined with SP600125. 2-ABP-stimulated expression of phosphorylated ATF-2 was significantly attenuated by pretreatment with U0126, whereas SP600125 had a minimal effect. To further verify the involvement of AP-1 in ROS-mediated induction of COX-2 expression, cells were pretreated for 30 min with NAC or apocynin followed by treatment with 2-ABP for an additional 24 h.

manner (Figure 2C). The inhibitory effects of apocynin on NADPH oxidase were confirmed by measuring ROS generation (Figure 2C). Another Nox inhibitor, diphenyleneiodonium (DPI), also strongly suppressed the 2-ABP-induced COX-2 expression (Figure 2D). The Nox family is a group of multisubunit enzymes that is composed of a catalytic subunit, one of seven Nox family members (Nox1−5, Duox1, and Duox2), several regulatory subunits, including p47phox and p67phox, and the small G protein Rac1. It has been demonstrated that a smaller p22phox subunit associates and heterodimerizes with Nox that formed Nox/p22phox complex at particular cellular membranes is essential for catalytic activity.20−22 Hence, the regulation of specific subunits of Nox by 2-ABP was characterized further. As shown in Figure 2E, 2-ABP significantly increased the level of p22phox protein in a time-dependent manner. However, the catalytic subunit Nox2 (gp91), a highly glycosylated protein that appears as a broad smear on SDS-PAGE, and the regulatory subunit p67phox were not up-regulated by 2-ABP (Figure 2E). To examine the involvement of p22phox in 2-ABP-mediated COX-2 expression, p22phox knockdown was performed using p22phox siRNA. The expression of endogenous p22phox was selectively reduced upon p22phox-specific siRNA transfection. Knocking down p22phox significantly attenuated the 2-ABP-induced expression of COX-2 (Figure 2F). These results suggest that Nox-derived ROS plays a role in 2-ABPinduced COX-2 expression in TSGH-8301 cells. Involvement of MAPK Pathways in 2-ABP-Induced COX-2 Expression. COX-2 expression is regulated via the activation of MAPKs in many cell types.23 To determine whether phosphorylation of these MAPKs was necessary for 2-ABPinduced COX-2 expression, activation of these kinases was assayed using immunoblotting with an antibody specific for the phosphorylated form of ERK1/2, p38MAPK, or JNK. As shown in Figure 3A, 2-ABP stimulated phosphorylation of ERK1/2 and JNK but failed to stimulate p38 MAPK phosphorylation. Time-dependent incubation of cells with 2-ABP resulted in phosphorylation of ERK1/2 and JNK at 1 and 6 h, reaching a maximum at approximately 24 h after treatment. To determine whether 2-ABP-induced expression of COX-2 was mediated by ERK and JNK activation, pharmacological inhibitors (U0126 and SP600125) and dominant positive/ negative plasmids of ERK and JNK were used. As shown in Figure 3B, 2-ABP-induced phosphorylation of ERK1/2 and induction of COX-2 protein expression were inhibited by treatment with U0126 in a dose-dependent manner. Transfection of a dominant positive plasmid containing MEK1, an upstream activator of ERK, increased 2-ABP-induced COX-2 expression (Figure 3B, bottom panel). However, inhibition of the JNK signaling cascade with SP600125 did not significantly attenuate COX-2 protein expression after 2-ABP treatment, whereas 2-ABP-induced JNK phosphorylation was completely inhibited by 10 μM SP600125 (Figure 3C). Transfection of a dominant negative JNK plasmid also had no effect on the 2-ABP-induced expression of COX-2 (Figure 3C, bottom panel). It has been reported that the ERK signaling pathway with cooperation of JNK activation is required for COX-2 expression.24 To determine whether cooperation of ERK and JNK signaling pathways was required for 2-ABP-induced gene expression of COX-2, cells were treated with U0126 combined with SP600125. As shown in Figure 3D, U0126 combined with SP600125 has a greater inhibitory effect on 2-ABP-induced COX-2 expression than U0126 alone. These results indicated that the 2-ABPinduced gene expression of COX-2 was largely mediated through 699

dx.doi.org/10.1021/tx2004689 | Chem. Res. Toxicol. 2012, 25, 695−705

Chemical Research in Toxicology

Article

Figure 3. Involvement of MAPK pathways in 2-ABP-induced COX-2 expression. (A) Activation of ERK1/2 and JNK by 2-ABP in a time-dependent manner. TSGH-8301 cells were incubated with 10 μM 2-ABP for different periods of time, and the cell lysate was homogenized for immunodetection of phospho- and nonphospho-ERK1/2, JNK, or p38 by immunoblot. (B) ERK1/2 activation is required for 2-ABP-mediated COX-2 expression. Upper panel: TSGH-8301 cells were preincubated with different concentrations of U0126 for 30 min followed by treatment with 10 μM 2-ABP for 24 h. The protein levels of phospho-ERK1/2 and COX-2 were determined by immunoblot analysis. Bottom panel: Overexpression of MEK1 up-regulates COX-2 expression. TSGH-8301 cells were transiently transfected with empty vector or MEK1 as described in the Materials and Methods. The protein levels of COX-2, phospho-ERK1/2, and actin were determined by immunoblot analysis. (C) Blocking of JNK pathway by SP600125 or dominant negative mutant mJNK could not attenuate 2-ABP-induced COX-2 expression. Upper panel: TSGH-8301 cells were preincubated with different concentrations of SP600125 for 30 min followed by treatment with 10 μM 2-ABP for 24 h. The protein levels of phospho-JNK, COX-2, and actin were determined by immunoblot analysis. Bottom panel: TSGH-8301 cells were transiently transfected with empty vector or mJNK as described in the Materials and Methods. The expression levels of COX-2, JNK, and actin were determined by immunoblot analysis. (D) Suppression of ERK1/2 and JNK pathways by pharmacological inhibitors synergistically attenuates 2-ABP-induced COX-2 expression. TSGH-8301 cells were incubated with 10 μM 2-ABP for 24 h in the absence or presence of 2 μM U0126 combined with 5 μM SP600125 preincubated for 30 min. COX-2 protein expression was determined by immunoblot analysis and normalized to actin. Values are means ± SEMs of three replicates (bottom panel). The statistical significance between 2-ABP treatment and 2-ABP combined with inhibitor was analyzed by Student's t test (*p < 0.05, **p < 0.01, and ***p < 0.001).

activation of the Nox-derived ROS-dependent signaling pathway. Our results suggest that the activation of ERK1/2 and JNK might be involved in signal transduction leading to this expression. Epidemiological studies have shown a correlation between the exposure to aromatic amines and the incidence of bladder cancer in humans. Abnormally elevated COX-2 expression has frequently been observed in urinary bladder tumors.4 The underlying mechanisms of COX-2 tumorigenicity have been

NAC and apocynin abrogated 2-ABP-induced expression of c-Jun, phosphorylated c-Jun, and phosphorylated ATF-2 in a concentration-dependent manner (Figure 5E,F). These findings suggest that 2-ABP induces ROS-dependent ERK/JNKAP1 activation and subsequently induces COX-2 expression.

■

DISCUSSION The findings of this study show that 2-ABP induces COX-2 expression in human bladder cancer cells (TSGH-8301) through 700

dx.doi.org/10.1021/tx2004689 | Chem. Res. Toxicol. 2012, 25, 695−705

Chemical Research in Toxicology

Article

and this effect was enhanced by the addition of 2-ABP (Figure 3B). Blocking of the JNK pathway by a pharmacological inhibitor or transfection of dominant negative mutant of JNK did not attenuate 2-ABP-induced COX-2 expression (Figure 3C). However, the combination of MEK and JNK pharmacological inhibitors had a stronger effect than the MEK inhibitor alone (Figure 3D). These results suggest that the MEK/ERK pathway may play a more critical role than JNK in the induction of COX-2 in TSGH-8301 cells. These results are in agreement with previous studies showing that ERK and JNK pathways mediate the induction of COX-2 expression by epidermal growth factor in human epidermoid carcinoma A431 cells.24 In NIH 3T3 cells, activation of ERK and JNK pathways is required for platelet-derived growth factor-mediated COX-2 induction.29 Whereas JNK and p38MAPK pathways regulate interleukin1β-stimulated COX-2 expression in renal mesangial cells,30 all three MAPK cascades (ERK, JNK, and p38MAPK) are involved in the induction of COX-2 expression by physiological hypertonicity in renal medullary collecting duct cells.31 These studies demonstrate the central role of MAPK cascades in regulating COX-2 expression in response to a variety of extracellular stimuli. Activation of the MAPK pathway is a frequent event in tumorigenesis. A growing body of evidence has demonstrated that MAPKs implicated in cell migration, proteinase induction, regulation of apoptosis, and angiogenesis are essential for successful metastasis.32 In this study, we have shown that 2-ABP up-regulates COX-2 expression mediated through the ERK and JNK signaling pathways and implies that 2-ABP might contribute to bladder cancer carcinogenesis. A variety of transcription factors, such NFκB, c-Jun, ATF-2, and Sp1, are required for COX-2 expression in response to different stimuli.33,34 Previous evidence has suggested that NFκB activation plays an important role in regulating COX-2 expression.35 However, Bay 11-7085, an NFκB inhibitor, did not significantly attenuate the 2-ABP-induced COX-2 expression (data not shown), suggesting that the NFκB signaling pathway may not be involved in the 2-ABP-induced COX-2 expression. Considerable evidence has suggested that activation of the ERK and JNK signaling pathways following c-Jun induction and ATF-2 phosphorylation are essential for COX-2 expression.24,25 The phosphorylation of c-Jun at Ser63 and Ser73, which is mediated by ERK1/ERK2 and JNK, is required for increased AP-1 transactivation.36 The phosphorylation of Thr69 and Thr71 is necessary for the transcriptional activation of ATF-2 in response to UV and genotoxic agents.37 In this study, we showed that 2-ABP stimulated an increase in the phosphorylation of c-Jun at Ser63 and ATF-2 at Thr71 (Figure 5B). Inhibition of ERK and JNK activation by U0126 and SP600125 suppressed c-Jun and COX-2 expression and c-Jun/ATF-2 phosphorylation (Figure 5D). In addition, pretreatment with the AP-1 inhibitors TSIIA (Figure 5A) or transfection of dominant negative c-Jun mutant TAM-67 (Figure 5C) significantly attenuated 2-ABP-induced COX-2 expression, suggesting that c-Jun was responsible for the transcriptional activation. Taken together, our results suggest that c-Jun and ATF-2, at least in part, play an essential role in 2-ABP-induced COX-2 expression. Our findings are supported by studies showing that AP-1 activation mediates the induction of COX-2 in response to stimulation with bradykinin in glioma cells,38 deoxycholate in esophageal cancer cells,39 and 12-O-tetradecanoylphorbol-13-acetate (TPA) in embryonic fibroblasts.40 ROS have been implicated in the induction of gene expression through their ability to regulate several distinct intracellular

Figure 4. 2-ABP-induced COX-2 expression is mediated through NADPH oxidase-derived ROS-dependent MAPK activation. (A) Suppression of NADPH oxidase activity by apocynin attenuates ERK1/2 and JNK activation. TSGH-8301 cells were preincubated with different concentrations of apocynin for 30 min followed by treatment with 10 μM 2-ABP for 24 h. The phosphorylation levels of ERK1/2 (pERK1/2) and JNK (p-JNK) were determined by immunoblot analysis. (B) Suppression of ROS production by NAC attenuates ERK1/2 and JNK activation. TSGH-8301 cells were preincubated with different concentrations of NAC for 30 min followed by treatment with 10 μM 2-ABP for 24 h. The phosphorylation levels of ERK1/2 (p-ERK1/2) and JNK (p-JNK) were determined by immunoblot analysis. (C) MAPK pharmacological inhibitors suppress 2-ABP-induced ROS generation. TSGH-8301 cells were preincubated with U0126 (20 μM) or the JNK inhibitor SP600125 (10 μM) for 30 min followed by treatment with 50 μM 2-ABP for 1 h. The DCFH-DA method was used to determine the intracellular ROS generation as described in the Materials and Methods. Values are means ± SEMs of three replicates. The statistical significance between 2-ABP treatment and 2-ABP combined with inhibitors was analyzed by Student's t test (*p < 0.05, **p < 0.01, and ***p < 0.001).

linked to several factors, including the inhibition of apoptosis, promotion of angiogenesis, modulation of immune surveillance, and increase in tumor cell invasiveness.27 In this study, we found that 2-ABP caused concentration- and time-dependent increases in COX-2 mRNA and protein levels in TSGH-8301 cells (Figure 1). MAPK pathways mediate the stimulatory effects of different extracellular stimuli on COX-2 expression in a stimulus- and cell type-specific manner.28 There are three general classes of MAPKs, ERK, JNK, and p38MAPKs. Of these, ERK and JNK, but not p38MAPK, were activated by 2-ABP (Figure 3A). Our data show that the inhibition of MEK (responsible for activation of ERK) by U0126 significantly attenuated the ERK1/2 protein activation and COX-2 expression induced by 2-ABP (Figure 3B). Constitutive activation of ERK by transfection of MEK1 led to an increase in COX-2 expression, 701

dx.doi.org/10.1021/tx2004689 | Chem. Res. Toxicol. 2012, 25, 695−705

Chemical Research in Toxicology

Article

Figure 5. AP-1 transcription factor is required for 2-ABP-induced COX-2 expression. (A) An AP-1 inhibitor significantly attenuates 2-ABP-induced COX-2 expression. TSGH-8301 cells were preincubated with different concentrations of TSIIA for 30 min followed by treatment with 10 μM 2-ABP for 24 h. COX-2 protein expression was determined by immunoblot analysis and normalized to actin. Values are means ± SEMs of three replicates (bottom panel). (B) 2-ABP activates transcription factors c-Jun and ATF2 in TSGH-8301 cells. TSGH-8301 cells were incubated with 10 μM 2-ABP for different periods of time, and the cell lysate was homogenized for immunodetection of c-Jun, phospho-c-Jun, and phospho-ATF-2. (C) Overexpression of TAM-67 attenuates 2-ABP-induced COX-2 expression. TSGH-8301 cells were transiently transfected with empty vector or TAM-67 as described in the Materials and Methods. The expression levels of COX-2, TAM-67, and actin were determined by immunoblot analysis. (D) Suppression of ERK1/2 and JNK activation by specific inhibitors attenuates 2-ABP-induced c-Jun and ATF2 activation. TSGH-8301 cells were incubated with 10 μM 2-ABP for 24 h in the absence or presence of 2 μM U0126 combined with 5 μM SP600125 and were preincubated for 30 min. The protein levels of c-Jun, phospho-c-Jun, and phospho-ATF-2 were determined by immunoblot analysis. (E) Suppression of ROS production by NAC attenuates 2-ABP-induced c-Jun and ATF2 activation. TSGH-8301 cells were preincubated with different concentrations of NAC for 0.5 h followed by treatment with 10 μM 2-ABP for 24 h. The protein levels of c-Jun, phospho-c-Jun, and phospho-ATF-2 were determined by immunoblot analysis. (F) Suppression of NADPH oxidase activity by apocynin attenuates 2-ABP-induced c-Jun and ATF2 activation. TSGH-8301 cells were preincubated with different concentrations of apocynin for 0.5 h followed by treatment with 10 μM 2-ABP for 24 h. The protein levels of c-Jun, phospho-c-Jun, and phospho-ATF-2 were determined by immunoblot analysis.

signaling cascades and may play a pathogenic role in carcinogenesis.41 Our data suggest a reciprocal relationship between ROS production and ERK activation in the induction of COX-2 by 2-ABP. The antioxidant NAC suppressed 2-ABP-induced ROS production (Figure 2B), ERK/JNK activation (Figure 4B), and COX-2 expression (Figure 2B). Furthermore, NAC blocked the expression of c-Jun, phosphorylated c-Jun, and phosphorylated ATF-2 induced by 2-ABP (Figure 5E). These findings suggest that ERK and JNK can function as downstream

effectors of ROS in transducing 2-ABP-initiated signals to induce COX-2 expression in TSGH-8301 cells. Moreover, inhibition of ERK by U0126 inhibited ROS production, suggesting that ERK activation caused ROS accumulation. This role of ERK activation as a moderator of ROS production has also been found in lung endothelial cells, where hyperoxia-induced ERK activation was necessary for hyperoxia-induced NADPH oxidase activation, which can result in ROS production.42 However, the mechanisms by which ERK regulates ROS 702

dx.doi.org/10.1021/tx2004689 | Chem. Res. Toxicol. 2012, 25, 695−705

Chemical Research in Toxicology

Article

Here, we show that 2-ABP stimulation directly induced expression of p22phox (Figure 2E). Knockdown of p22phox by siRNA had a significant inhibitory effect on the 2-ABP-induced expression of COX-2 (Figure 2F), suggesting that p22phox at least participated in the NADPH oxidase-mediated increase in COX-2 expression stimulated by 2-ABP. The protein levels of the catalytic subunit Nox2 and the regulatory subunit p67phox were not changed by 2-ABP (Figure 2E). However, we could not rule out the possibilities of the induction of other subunits or regulation of the activity level of NADPH oxidase by 2-ABP. Further study is needed to elucidate the details of the underlying mechanisms. In summary, this study identified pathways in TSGH-8301 cells through which COX-2 is up-regulated by 2-ABP. Our data indicate that 2-ABP might regulate Nox to elicit ROS generation and the activation of the ERK and JNK pathways, which, in turn, initiates AP-1 activation, finally causing COX-2 expression in TSGH-8301 cells. The ERK pathway plays a more critical role, while the JNK signaling pathway plays an auxiliary role in the induction of COX-2 by 2-ABP. The proposed mechanisms for the signaling pathway by which 2-ABP induces COX-2 expression in a human bladder cancer cell line (TSGH-8301) are depicted in Figure 6.

■

AUTHOR INFORMATION

Corresponding Author

Figure 6. Schematic pathway for 2-ABP-induced ROS-dependent AP1 up-regulation and COX-2 expression in TSGH-8301 cells. Each solid line and arrow represents a step in an activating pathway. 2-ABP activates ERK (significant role) and JNK (minor role) through the Nox/ROS-dependent pathway to induce activation of c-Jun and ATF2 phosphorylation, respectively. Activation of c-Jun and ATF-2 leads to sequential up-regulation and activation of AP-1 followed by increased gene expression of COX-2. AP-1, activator protein 1; 2-ABP, 2aminobiphenyl; ERK, extracellular signal-regulated kinase; JNK, c-Jun N-terminal kinase; and Nox, NADPH oxidase.

*Tel: +886 7 615 1100 ext. 7916. Fax: +886 7 615 5150. E-mail: [email protected]. Funding

This work was supported by a grant (ISU98-04-04) from I-Shou University to L.-C.C. and a grant (NSC 99-2320-B-017001-MY3) from the National Science Council of Taiwan to C.-C.C. Notes

The authors declare no competing financial interest.

■

production require further studies. A variety of cellular enzyme systems are potential sources of ROS production, including Nox, xanthine oxidase, uncoupled endothelial NO synthase, cytochrome P-450, and enzymes in the mitochondrial respiratory chain.43 In this study, we found that the 2-ABP-induced COX-2 expression was mediated through Nox-dependent ROS generation because pretreatment with the Nox inhibitor apocynin (Figure 2C) and DPI (Figure 2D) attenuated 2-ABPinduced responses. The role of Nox-dependent ROS in 2-ABPinduced COX-2 expression was further confirmed by ROS generation, which was also inhibited by apocynin (Figure 2C), suggesting that Nox-ROS is involved in 2-ABP-induced COX-2 expression in TSGH-8301 cells. To date, several members of the Nox family have been implicated in both phagocytic and nonphagocytic NADPH oxidases. The phagocytic NADPH oxidase is composed of the Nox2 (gp91phox) and p22phox catalytic membrane-associated subunits as well as several regulatory cytosolic subunits.22 Nonphagocytic NADPH oxidases also require both a Nox isoform and a p22phox to generate ROS.19 Recently, studies have shown that growth factors induce transcription to up-regulate p22phox, resulting in increased levels of p22phox protein, complex formation between p22phox and Nox4, and oxidase activity. The p22phox-mediated activation of NADPH oxidase leads to inhibition of apoptosis and thus promotes pancreatic cancer cell survival.20 Moreover, p22phox also has been reported to play a pivotal role in regulation of HIF-2α expression, which is linked to renal carcinogenesis.44

ACKNOWLEDGMENTS We thank Prof. Hsiao-Sheng Liu (Department of Microbiology and Immunology, College of Medicine, National Cheng Kung University) and Prof. Nan-Haw Chow (Department of Pathology, College of Medicine, National Cheng Kung University) for providing the TSGH-8301 cell line.

■

REFERENCES

(1) Jemal, A., Bray, F., Center, M. M., Ferlay, J., Ward, E., and Forman, D. (2011) Global cancer statistics. CA Cancer J. Clin. 61, 69−90. (2) Mitra, A. P., Datar, R. H., and Cote, R. J. (2006) Molecular pathways in invasive bladder cancer: New insights into mechanisms, progression, and target identification. J. Clin. Oncol. 24, 5552−5564. (3) Eissa, S., Swellam, M., Labib, R. A., El-Zayat, T., and El Ahmady, O. (2009) A panel of angiogenic factors for early bladder cancer detection: Enzyme immunoassay and Western blot. J. Urol. 181, 1353−1360. (4) Wadhwa, P., Goswami, A. K., Joshi, K., and Sharma, S. K. (2005) Cyclooxygenase-2 expression increases with the stage and grade in transitional cell carcinoma of the urinary bladder. Int. Urol. Nephrol. 37, 47−53. (5) Rizzo, M. T. (2011) Cyclooxygenase-2 in oncogenesis. Clin. Chim. Acta 412, 671−687. (6) Shirahama, T., Arima, J., Akiba, S., and Sakakura, C. (2001) Relation between cyclooxygenase-2 expression and tumor invasiveness and patient survival in transitional cell carcinoma of the urinary bladder. Cancer 92, 188−193.

703

dx.doi.org/10.1021/tx2004689 | Chem. Res. Toxicol. 2012, 25, 695−705

Chemical Research in Toxicology

Article

in human epidermoid carcinoma A431 cells. Biophys. Biochem. Acta 1683, 38−48. (25) Guo, Y. S., Hellmich, M. R., Wen, X. D., and Townsend, C. M. (2001) Activator protein-1 transcription factor mediates bombesinstimulated cyclooxygenase-2 expression in Intestinal epithelial cells. J. Biol. Chem. 276, 22941−22947. (26) Chen, B.-K., and Chang, W.-C. (2000) Functional interaction between c-Jun and promoter factor Sp1 in epidermal growth factorinduced gene expression of human 12(S)-lipoxygenase. Proc. Natl. Acad. Sci. U.S.A. 97, 10406−10411. (27) Ghosh, N., Chaki, R., Mandal, V., and Mandal, S. C. (2010) COX-2 as a target for cancer chemotherapy. Pharmacol. Rep. 62, 233−244. (28) Lin, W. N., Lin, C. C., Cheng, H. Y., and Yang, C. M. (2011) Regulation of COX-2 and cPLA2 gene expression by LPS through the RNA-binding protein HuR: Involvement of NADPH oxidase, ROS and MAPKs. Br. J. Pharmacol. 163, 1691−1706. (29) Xie, W., and Herschman, H. R. (1996) Transcriptional regulation of prostaglandin synthase 2 gene expression by plateletderived growth factor and serum. J. Biol. Chem. 271, 31742−31748. (30) Guan, Z., Buckman, S. Y., Miller, B. W., Springer, L. D., and Morrison, A. R. (1998) Interleukin-1β-induced cyclooxygenase-2 expression requires activation of both c-Jun NH2-terminal kinase and p38 MAPK signal pathways in rat renal mesangial cells. J. Biol. Chem. 273, 28670−28676. (31) Yang, T., Huang, Y., Heasley, L. E., Berl, T., Schnermann, J. B., and Briggs, J. P. (2000) MAPK mediation of hypertonicity-stimulated cyclooxygenase-2 expression in renal medullary collecting duct cells. J. Biol. Chem. 275, 23281−23286. (32) Reddy, K. B., Nabha, S. M., and Atanaskova, N. (2003) Role of MAP kinase in tumor progression and invasion. Cancer Metastasis Rev. 22, 395−403. (33) Paik, J., Lee, J. Y., and Hwang, D. (2002) Signaling pathways for TNFα-induced COX-2 expression: Mediation through MAP kinases and NFκB, and inhibition by certain nonsteroidal anti-inflammatory drugs. Adv. Exp. Med. Biol. 507, 503−508. (34) Chang, Y. J., Wu, M. S., Lin, J. T., and Chen, C. C. (2005) Helicobacter pylori-induced invasion and angiogenesis of gastric cells is mediated by cyclooxygenase-2 induction through TLR2/TLR9 and promoter regulation. J. Immunol. 175, 8242−8252. (35) Huang, W. C., Chai, C. Y., Chen, W. C., Hou, M. F., Wang, Y. S., Chiu, Y. C., Lu, S. R., Chang, W. C., Juo, S. H. H., Wang, J. Y., and Chang, W. C. (2011) Histamine regulates cyclooxygenase 2 gene activation through Orai1-mediated NFκB activation in lung cancer cells. Cell Calcium 50, 27−35. (36) Wang, Y.-N., Chen, Y.-J., and Chang, W.-C. (2006) Activation of extracellular signal-regulated kinase signaling by epidermal growth factor mediates c-Jun activation and p300 recruitment in keratin 16 gene expression. Mol. Pharmacol. 69, 85−98. (37) Livingstone, C., Patel, G., and Jones, N. (1995) ATF-2 contains a phosphorylation-dependent transcriptional activation domain. EMBO J. 14, 1785−1797. (38) Lu, D. Y., Leung, Y. M., Huang, S. M., and Wong, K. L. (2010) Bradykinin-induced cell migration and COX-2 production mediated by the bradykinin B1 receptor in glioma cells. J. Cell. Biochem. 110, 141−150. (39) Looby, E., Abdel-Latif, M. M., Athie-Morales, V., Duggan, S., Long, A., and Kelleher, D. (2009) Deoxycholate induces COX-2 expression via Erk1/2-, p38-MAPK and AP-1-dependent mechanisms in esophageal cancer cells. BMC Cancer 9, 190. (40) Zhang, D., Li, J., Song, L., Ouyang, W., Gao, J., and Huang, C. (2008) A JNK1/AP-1−dependent, COX-2 induction is implicated in 12-O-tetradecanoylphorbol-13-acetate-induced cell transformation through regulating cell cycle progression. Mol. Cancer Res. 6, 165−174. (41) Halliwell, B. (2007) Oxidative stress and cancer: Have we moved forward? Biochem. J. 401, 1−11. (42) Parinandi, N. L., Kleinberg, M. A., Usatyuk, P. V., Cummings, R. J., Pennathur, A., Cardounel, A. J., Zweier, J. L., Garcia, J. G. N., and Natarajan, V. (2003) Hyperoxia-induced NAD(P)H oxidase activation

(7) Dhawan, D., Craig, B. A., Cheng, L., Snyder, P. W., Mohammed, S. I., Stewart, J. C., Zheng, R., Loman, R. A., Foster, R. S., and Knapp, D. W. (2010) Effects of short-term celecoxib treatment in patients with invasive transitional cell carcinoma of the urinary bladder. Mol. Cancer Ther. 9, 1371−1377. (8) Baan, R., Straif, K., Grosse, Y., Secretan, B., El Ghissassi, F., Bouvard, V., Benbrahim-Tallaa, L., and Cogliano, V. (2008) Carcinogenicity of some aromatic amines, organic dyes, and related exposures. Lancet Oncol. 9, 322−323. (9) Harling, M., Schablon, A., Schedlbauer, G., Dulon, M., and Nienhaus, A. (2010) Bladder cancer among hairdressers: A metaanalysis. Occup. Environ. Med. 67, 351−358. (10) Turesky, R. J., Freeman, J. P., Holland, R. D., Nestorick, D. M., Miller, D. W., Ratnasinghe, D. L., and Kadlubar, F. F. (2003) Identification of aminobiphenyl derivatives in commercial hair dyes. Chem. Res. Toxicol. 16, 1162−1173. (11) Luceri, F., Pieraccini, G., Moneti, G., and Dolara, P. (1993) Primary aromatic amines from side-stream cigarette smoke are common contaminants of indoor air. Toxicol. Ind. Health 9, 405−413. (12) Wang, S. C., Chung, J. G., Chen, C. H., and Chen, S. C. (2006) 2- and 4-Aminobiphenyls induce oxidative DNA damage in human hepatoma (Hep G2) cells via different mechanisms. Mutat. Res. 593, 9−21. (13) Abdo, K. M., Murthy, A. S., Haseman, J. K., Dieter, M. P., Hildebrandt, P., and Huff, J. E. (1982) Carcinogenesis bioassay in rats and mice fed diets containing 2-biphenylamine hydrochloride. Fundam. Appl. Toxicol. 2, 201−210. (14) O'Connor, P. M., Lapointe, T. K., Beck, P. L., and Buret, A. G. (2010) Mechanisms by which inflammation may increase intestinal cancer risk in inflammatory bowel disease. Inflamm. Bowel Dis. 16, 1411−1420. (15) Ozkan, A., and Fiskin, K. (2006) Protective effect of antioxidant enzymes against drug cytotoxicity in MCF-7 cells. Exp. Oncol. 28, 86−88. (16) Yang, M. Y., Lau, S. S., and Monks, T. J. (2005) 2,3,5-tris(Glutathion-S-yl)hydroquinone (TGHQ)-mediated apoptosis of human promyelocytic leukemia cells is preceded by mitochondrial cytochrome c release in the absence of a decrease in the mitochondrial membrane potential. Toxicol. Sci. 86, 92−100. (17) Makena, P. S., and Chung, K.-T. (2007) Evidence that 4aminobiphenyl, benzidine, and benzidine congeners produce genotoxicity through reactive oxygen species. Environ. Mol. Mutagen. 48, 404−413. (18) Kim, E. H., Na, H. K., Kim, D. H., Park, S. A., Kim, H. N., Song, N. Y., and Surh, Y. J. (2008) 15-Deoxy-Δ12,14-prostaglandin J2 induces COX-2 expression through Akt-driven AP-1 activation in human breast cancer cells: A potential role of ROS. Carcinogenesis 29, 688−695. (19) Leto, T. L., Morand, S., Hurt, D., and Ueyama, T. (2009) Targeting and regulation of reactive oxygen species generation by Nox family NADPH oxidases. Antioxid. Redox Signal. 11, 2607−2619. (20) Edderkaoui, M., Nitsche, C., Zheng, L., Pandol, S. J., Gukovsky, I., and Gukovskaya, A. S. (2011) NADPH oxidase activation in pancreatic cancer cells is mediated through Akt-dependent up-regulation of p22phox. J. Biol. Chem. 286, 7779−7787. (21) Sumimoto, H. (2008) Structure, regulation and evolution of Nox-family NADPH oxidases that produce reactive oxygen species. FEBS J. 275, 3249−3277. (22) Bedard, K., and Krause, K.-H. (2007) The NOX family of ROSgenerating NADPH oxidases: Physiology and pathophysiology. Physiol. Rev. 87, 245−313. (23) Kitz, K., Windischhofer, W., Leis, H. J., Huber, E., Kollroser, M., and Malle, E. (2011) 15-Deoxy-[Delta]12,14-prostaglandin J2 induces Cox-2 expression in human osteosarcoma cells through MAPK and EGFR activation involving reactive oxygen species. Free Radical Biol. Med. 50, 854−865. (24) Chen, L. C., Chen, B. K., Chang, J. M., and Chang, W. C. (2004) Essential role of c-Jun induction and coactivator p300 in epidermal growth factor-induced gene expression of cyclooxygenase-2 704

dx.doi.org/10.1021/tx2004689 | Chem. Res. Toxicol. 2012, 25, 695−705

Chemical Research in Toxicology

Article

and regulation by MAP kinases in human lung endothelial cells. Am. J. Physiol. Lung Cell Mol. Physiol. 284, L26−L38. (43) Zhang, D. X., and Gutterman, D. D. (2007) Mitochondrial reactive oxygen species-mediated signaling in endothelial cells. Am. J. Physiol. Heart Circ. Physiol. 292, H2023−2031. (44) Block, K., Gorin, Y., New, D. D., Eid, A., Chelmicki, T., Reed, A., Choudhury, G. G., Parekh, D. J., and Abboud, H. E. (2010) The NADPH oxidase subunit p22phox inhibits the function of the tumor suppressor protein tuberin. Am. J. Pathol. 176, 2447−2455.

705

dx.doi.org/10.1021/tx2004689 | Chem. Res. Toxicol. 2012, 25, 695−705