Cytotoxic Spliceostatins from Burkholderia sp. and Their Semisynthetic

Aug 6, 2014 - The spliceostatin class of natural products was reported to be potent .... cepacia Complex Species, Isolated from Malaysian Tropical Pea...
0 downloads 0 Views 673KB Size
Download PDF
Article pubs.acs.org/jnp

Cytotoxic Spliceostatins from Burkholderia sp. and Their Semisynthetic Analogues Haiyin He,*,† Anokha S. Ratnayake,† Jeffrey E. Janso,† Min He,‡ Hui Y. Yang,§ Frank Loganzo,⊥ Boris Shor,⊥ Christopher J. O’Donnell,† and Frank E. Koehn† †

Natural Products Laboratory, Worldwide Medicinal Chemistry, Pfizer Worldwide Research and Development, 558 Eastern Point Road, Groton, Connecticut 06340, United States ‡ Developmental Therapeutics Program, Division of Cancer Treatment and Diagnosis, National Cancer Institute, National Institutes of Health, 9609 Medical Center Drive, Bethesda, Maryland 20892, United States § Novartis Institutes for BioMedical, Research, Inc., 250 Massachusetts Avenue, Cambridge, Massachusetts 02139, United States ⊥ Pfizer Oncology, 401 N. Middletown Road, Pearl River, New York 10965, United States S Supporting Information *

ABSTRACT: The spliceostatin class of natural products was reported to be potent cytotoxic agents via inhibition of the spliceosome, a key protein complex in the biosynthesis of mature mRNA. As part of an effort to discover novel leads for cancer chemotherapy, we re-examined this class of compounds from several angles, including fermentation of the producing strains, isolation and structure determination of new analogues, and semisynthetic modification. Accordingly, a group of spliceostatins were isolated from a culture broth of Burkholderia sp. FERM BP-3421, and their structures identified by analysis of spectroscopic data. Semisynthesis was performed on the major components 4 and 5 to generate ester and amide derivatives with improved in vitro potency. With their potent activity against tumor cells and unique mode of action, spliceostatins can be considered potential leads for development of cancer drugs.

S

potent inhibitory activities against human cancer cell lines and efficacies in several xenograft tumor models.9 FR901464 (1) and its methyl ketal, designated spliceostatin A, were also shown to inhibit the spliceosome by interaction with SF3b.10,11 Synthetic studies on the spliceostatins resulted in the total synthesis of FR901464 (1)12−14 and its analogue meayamycin with increased in vitro potency against cancer cells.15 Other synthetic efforts provided insights into structure−activity relationships of this class.16,17 The antitumor potencies and unique mode of action of the spliceostatins prompted us to examine this class of compounds for analogues possessing biological and physicochemical properties suitable for drug lead generation. As a result of our investigation, a group of spliceostatin analogues, 4−12, were isolated from a three-day fermentation broth, and their structures were identified by analysis of spectroscopic data. The major components, 4 and 5, which contained a carboxyl group, were derivatized to afford a series of analogues. These natural products and their semisynthetic derivatives demonstrated improved chemical stability compared to FR901464 (1) and spliceostatin A. In this paper we report on taxonomy and fermentation of the producing organism and the isolation, structure determination, and biological activity of the

plicing is a process of removing noncoding introns from pre-mRNA to form mature mRNA. Cancer cells have increased splicing levels and therefore are more susceptible to spliceosome inhibitors. Targeting the spliceosome may inhibit tumor growth at drug concentrations tolerated by normal cells.1−3 The pladienolides, natural products from Streptomyces platensis,4 are known to inhibit the spliceosome by interaction with the SF3b subunit of the U2 snRNA subcomplex, an essential component of the spliceosome.5 The semisynthetic analogue pladienolide, E-7107, was developed as an experimental drug based on its in vitro potency against tumor cells and efficacy in tumor preclinical in vivo xenograft models.6 Spliceostatins belong to the only other class of natural products reported to potently inhibit tumor cells by binding to the spliceosome. First described in 1997, spliceostatin analogues FR901464 (1), FR901465 (2), and FR901463 (3) were isolated from the fermentation broth of strain no. 2663 deposited in the International Patent Organism Depositary (IPOD) at the National Institute of Bioscience and HumanTechnology, Agency of Industrial Science and Technology (AIST), Japan, with accession no. FERM BP-3421.7,8 This organism was originally described as a Pseudomonas sp. based on physiological characteristics, but 16S rRNA sequence analysis shows that the correct phylogenetic classification of FERM BP-3421 is a Burkholderia sp. The spliceostatins exhibit © 2014 American Chemical Society and American Society of Pharmacognosy

Received: April 16, 2014 Published: August 6, 2014 1864

dx.doi.org/10.1021/np500342m | J. Nat. Prod. 2014, 77, 1864−1870

Journal of Natural Products

Article

Figure 1. Structures of spliceostatin analogues 1−12.

Upon evaporation under reduced pressure, the organic extract was subjected to repeated chromatography on reversed-phase HPLC or purified on Sephadex LH20 followed by RP-HPLC to yield the purified spliceostatin analogues 4−12 (Figure 1). The structures of these compounds were elucidated by detailed spectroscopic analyses. During the course of this work, compounds 5, 6, and 10 were reported as thailanstatin A,20 spliceostatin B,21 and thailanstatin B20 by Liu and co-workers. Herein we describe the structures of the remaining compounds isolated from the culture broth of FERM BP-3421. The molecular formula of spliceostatin C (4) was determined to be C28H41NO8 by high-resolution Fourier transform ion cyclotron resonance mass spectrometry (FTICRMS). Detailed analysis of 1D and 2D NMR spectroscopic data, including COSY, TOCSY, HMBC, and HMQC spectra, revealed that 4 was identical to 5 in the central framework (C-6 to C-16), the C-17/C-18 carboxymethyl group, the 2-pentenamide (C-1′ to C-5′) side chain, and the acetyl functionality, but different in the tetrahydropyran moiety (C-1 to C-5). The COSY spectrum delineated a spin system from methylene H2-4 at δH 1.65/1.63 to methines H-5 at δH 4.50, to H-6 at δH 5.57, and to H-7 at δH 6.27. In the HMBC spectrum, the proton signals of the epoxide methylene at δH 2.61 (s, 2H) was correlated to C-2 at δC 36.5 and C-4 at δC 37.2 and to the quaternary carbon C-3 at δC 54.7. On the other hand, the methine proton H-5 at δH 4.50 showed

metabolites produced by FERM BP-3421, along with some initial semisynthetic studies.

■

RESULTS AND DISCUSSION Taxonomy of the Producing Strain FERM BP-3421. Previous investigators described FERM BP-3421 as a Pseudomonas sp. based on morphological and physiological characteristics.7 However, BLASTN analysis of the nearly complete (1494 bp) 16S rRNA gene indicates that FERM BP3421 is most closely related to Burkholderia spp. In fact, FERM BP-3421 shares 100% 16S sequence identity with strain A396 (NRRL B-50319), which has recently been described as a new species, “Burkholderia rinojensis”.18 Like FERM BP-3421, A396 has also been reported to produce FR901465 (2). 19 Phylogenetically, FERM BP-3421, a soil isolate, forms a clade with the soil isolate “B. rinojensis” and several plant-associated Burkholderia species such as B. glumae, B. gladioli, B. plantarii, and B. cocovenenans (Figure 2). Therefore, FERM BP-3421 should be reclassified as a Burkholderia sp. Production and Structure Determination of the Natural Products. Spliceostatins were produced by fermentation of strain FERM BP-3421 in a liquid medium at 25 °C for 3 days. The secondary metabolites in the broth were adsorbed onto HP-20 resin, which was then extracted with ethyl acetate. 1865

dx.doi.org/10.1021/np500342m | J. Nat. Prod. 2014, 77, 1864−1870

Journal of Natural Products

Article

spliceostatin molecular framework, such as the conjugated diene, the central tetrahydropyran moiety, and an α,βunsaturated amide side chain bearing an acetyl group (Table 1). Further examination of the 2D spectra established the connectivity between these structural fragments, thus allowing us to assemble the left-hand portion of 8, which was identical to the common core structure of the spliceostatin analogues.8,9 The right-hand portion of this molecule accounted for a formula of C6H8O2+ with 3 degrees of unsaturation. Analysis of the 2D NMR data revealed a network of 2JC/H and 3JC/H correlations from the methine singlet H-2 at δH 5.78 (δC 115.6) to C-1 at δC 164.4, C-17 at δC 22.3 (δ3H 1.97), C-3 at δC 159.0, and C-4 at δC 34.5 (δ2H 2.44, 2.47), thus establishing connectivity of the α,β-unsaturated ester fragment. HMBC correlations from H-5 at δH 4.79 and H-6 at δH 5.68 to C-4 at δC 34.5 as well as COSY correlations from H2-4 at δH 2.44 and 2.47 to H-5 at δH 4.97 established the framework of a 5,6dihydro-α-pyrone moiety (C-1 to C-5) with a methyl group attached to C-3. Spliceostatin E (8) represents a molecular framework that is distinctively different from those of the other analogues of this class.8,9,12−14,20,21 The molecular formula of spliceostatin F (9) was determined by HRESIMS to be C28H42ClNO8. The NMR spectroscopic assignment for the core structure of 9 was essentially identical to that of thailanstatin B (10).20 The only difference was the presence of a C-4 methylene at δC 39.9 (δH 1.43, 1.58) on the tetrahydropyran ring of 9 in place of the C-4 hydroxymethine in thailanstatin B. For spliceostatin G (11), the molecular formula was determined by HRESIMS to be C21H31NO6. During the examination of the HPLC chromatograms for the minor components, we noticed that compound 11 showed a UV chromophore (λmax 280 nm) that was different from the other spliceostatin analogues (λmax 236 nm). 2D NMR data allowed us to quickly confirm the presence of a diene framework, via 3 JC/H correlations from the H2-6 signals at δH 2.37 and 2.28 and from H-2 at δH 5.75 to the quaternary carbon C-4 at δC 133.9. Furthermore, the H-2 signal exhibited strong HMBC correlations to the terminal carboxylic acid signal C-1 at δC 168.4 as well as the adjacent methine signal C-3 at δC 148.8. The partial structure (C-1 to C-5) of 11 was further confirmed by COSY correlations between H-2 (δH 5.75) and H-3 (δH 7.20) and between H-5 at δH 6.00 and H2-6. The NMR data for the left-hand portion of 11 were identical to those of other spliceostatins. It should be noted that the aldehyde counterpart of this diene acid (11) has been described in the literature as a degradation product of 1, formed under acidic conditions.16 On the basis of this information, we demonstrated that the same diene aldehyde can be generated from acid-catalyzed hydrolysis of compounds 2 and 4, under a variety of conditions (50% AcOH, 5% HCl, and 1 M TsOH; 4−5 h, RT). Compound 12 was identified to be a heterodimer formed via coupling between 2 and 9. The attachment point between the two monomers was established on the basis of a weak HMBC correlation from the carbonyl C-18b at δC 171.3 of one molecule to the hydroxymethyl H2-18a at δH 4.04 (δC 60.7) of the other. Compound 12 was not detected in the crude extract, which suggests the dimerization occurred during the isolation process. Semisynthetic Analogues. Spliceostatin C (4) and thailanstatin A (5) were treated with lithium chloride in acetic acid at ambient temperature to afford their corresponding

Figure 2. Phylogenetic relationship of FERM BP-3421 to other Burkholderia determined with nearly complete (1400 bp) 16S rRNA sequences. The neighbor-joining phylogenetic tree was rooted with Burkholderia pickettii, and bootstrap values based on 1000 replicates are shown at their respective nodes if values were above 50%. The scale bar represents 0.02 substitution per nucleotide. GenBank accession numbers appear in parentheses.

correlations to C-1 at δC 68.2 and C-3, C-4, and C-6 at δC 126.6. These data clearly indicated that 4 is closely related to 5 with the exception of lacking a 4-OH group in the tertahydropyran ring. For the relative configuration, strong correlations between H-5 at δH 4.50 and H2-17 at δH 2.58 and 2.49 were observed in the ROESY spectrum, requiring the diene and the C-17/C-18 substituents to have a trans (1S, 5S) orientation. The 1H, 13C, and HMBC data of 4 are summarized in Table 1, and the key HMBC and ROESY correlations that defined the structure and configuration are illustrated in Figure 3. The molecular formula of spliceostatin D (7) was determined by high-resolution FTICR mass spectrometry to be C28H41NO8. An analysis of NMR spectroscopic data indicated that the core skeleton of 7 and several of its partial structures were identical to that of 6 except for an additional hydroxyl group attached to C-4 of the tetrahydropyran moiety (C-1 to C-5). In an HMBC spectrum, the sp2 methylene signals H2-19 at δH 5.04 and 4.80 and the methine protons H-5 at δH 3.88 and H-6 at δH 5.57 were all correlated to the oxygenbearing C-4 at δC 72.4. These data, together with its molecular formula, provided convincing evidence that spliceostatin D (7) contains an exocyclic methylene at C-3 and a hydroxyl group at C-4. The relative configuration at C-4 was determined by the observation of a ROESY correlation between H-4 at δH 3.64 and H-6 at δH 5.57, which required a 4R configuration. The 1H, 13 C, and HMBC data of 7 are summarized in Table 1. For spliceostatin E (8), high-resolution electrospray ionization mass spectrometry (HRESIMS) determined a molecular formula of C 26 H 37 NO 6 with 9 degrees of unsaturation. Preliminary analysis of the 1D and 2D NMR spectra of 8 reflected many of the characteristic features of the 1866

dx.doi.org/10.1021/np500342m | J. Nat. Prod. 2014, 77, 1864−1870

Journal of Natural Products

Article

Table 1. 1H and 13C NMR Data for Spliceostatins C (4), D (7) (400 MHz, DMSO-d6), and E (8) (500 MHz, DMSO-d6) spliceostatin C (4) position

δC, type

δH, mult. (J in Hz)

1 2

68.2, CH 36.5, CH2

3 4

54.7, C 37.2, CH2

5

70.4, CH

6

126.6, CH

7 8 9

135.4, CH 133.7, C 129.0, CH

a

spliceostatin D (7) HMBC

δC, type

δH, mult. (J in Hz)

4.29, m 1.76, m 1.40, dd, (11.5, 7.2)

3, 5 1, 4, 17 1, 3, 4, 17, 19

69.5, CH 37.0, CH2

4.18, m 2.33, m 2.23, m

3, 5 1, 3, 19 1, 3, 19

1.65, m

2, 3, 5, 6, 19

144.6, C 72.4, CH

3.64, mb

2, 3, 5, 6, 19

1.63, m 4.50, ddd (5.5, 5.5, 5.5) 5.57, dd (15.6, 5.8)

2, 3, 5, 6, 19 1, 3, 4, 6, 7

77.0, CH

3.88, dd (5.8, 5.8)

4, 5, 8

125.2, CH

6.27, br d (15.8)

5, 8, 9, 20 7, 10, 11, 20

136.1, CH 133.8, C 128.7, CH

8, 9, 11, 12 8, 9, 11, 12 12, 15, 21

31.7, CH2

10

31.7, CH2

11

80.0, CH

5.50, br dd (7.0, 7.0) 2.28, m 2.18, m 3.48, m

12 13

28.7, CH 35.2, CH2

1.65, m 1.79, m

11 11, 15, 21

28.7, CH 35.2, CH2

14 14-NH 15 16 17

46.4, CH

1.79, m 3.62, m 7.80, d (7.9)a 3.63, m 1.06, d (6.4) 2.58, dd (16.0, 8.5) 2.49, m

15 14, 15, 1′ 11 14, 15 1, 2, 18 1, 2, 18

46.3, CH

74.9, CH 17.8, CH3 39.1, CH2

18 18-OH 19

172.9, C

20 21 1′ 2′

12.4, 14.2, 164.6, 122.8,

3′

80.0, CH

74.8, CH 17.7, CH3 38.1, CH2

2, 3, 4

108.9, CH2

1.68, s 0.94, d (7.0)

7, 8, 9 11, 12, 13

6.10, d (11.2)

1′, 4′

12.3, 14.2, 164.5, 122.8,

142.7, CH

5.85, dd (11.8, 7.3)

1′, 2′, 4′, 5′

142.6, CH

4′

68.1, CH

6.35, dq (6.0, 6.0)

2′, 3′, 1″

5′ 1″ 2″

20.0, CH3 169.6, C 21.0, CH3

1.24, d (6.4)

3′, 4′

1.96, s

1″

CH3 CH3 C CH

HMBC

CH3 CH3 C CH

68.0, CH 19.9, CH3 169.6, C 21.0, CH3

δC, type

δH, mult. (J in Hz)

HMBC

164.4, C 115.6, CH

5.78, s

159.0, C 34.5, CH2

2.44, m

1, 4, 6, 7

77.2, CH

2.47, m 4.97, m

2, 3, 5, 6, 17 3, 4, 6, 7

5.57, dd (15.5, 5.8) 6.22, br d (15.8)

4, 5, 7, 8

124.4, CH

4, 5, 8

5, 8, 9, 20

5.48, br dd (7.0, 7.0) 2.27, m 2.17, m 3.49, ddd (6.0, 6.0, 2.5) 1.65, m 1.79, m

7, 11, 20

137.6, CH 133.9, C 131.2, CH

5.68, dd (15.8, 6.7) 6.38, m 5.62, t (7.0)

7, 10, 11, 18 9, 11, 12

1.79, 3.63, 7.76, 3.63, 1.06, 2.37, 2.37,

m m d (7.9)a m d (6.4) m m

8, 9, 11 8, 9, 11 15, 21

32.1, CH2 80.2, CH

2.33, m 2.22, m 3.52, m

11 11, 14, 21

28.9, CH 35.3, CH2

1.67, m 1.82, m

11, 16 14, 15, 1′ 11, 16 14, 15 1, 2, 18

46.5, CH

172.4, C 12.13, br sa 2.61, s

52.2, CH2

spliceostatin E (8)

5.04, 4.80, 1.68, 0.94,

br s br s s d (7.0)

2, 3, 4 2, 4 7, 8, 9 11, 12, 13

1, 4, 17

5, 8, 18

9, C13, 15, 19

11, 12, 14, 15, 19

75.2, CH 17.9, CH3 22.3, CH3

1.82, m 3.67, m 7.82, d (6.9)a,b 3.66, m 1.08, d (6.3) 1.97, s

11, 14, 16 14, 15 1, 2, 4

12.4, CH3

1.74, s

7, 8, 9

14.3, CH3

0.97, d (7.1)

11, 12, 13

6.13, dd (11.6, 1.2) 5.88, dd (11.6, 7.5) 6.37, m

1′, 4′, 5′

1.26, d (6.5)

3′, 4′

2.00, s

1″, 4′

6.10, d (11.2)

1′, 4′

165.0, C 123.2, CH

5.85, dd (11.8, 7.3) 6.35, dq (6.0, 6.0)

1′, 4′, 5′

143.1, CH 68.0, CH

1.24, d (6.4)

2′, 3′, 5′, 1″ 3′, 4′

1.97, s

1″

20.1, CH3 170.1, C 21.0, CH3

12, 13

1′, 4′, 5′ 1′, 2′, 3′, 5′

D2O exchangeable. bBroad and/or overlapped signals, HMBC correlations are not observed.

chlorohydrins 9 and 10, respectively, in high yields. The chlorohydrins were further derivatized by activating the carboxyl group with N-hydroxysuccinamide, which triggered the ring closure between the 3-OH and COOH to form lactones 13 and 14. The formation of 13 further confirmed the configuration of the tetrahydropyran moiety (C-1 to C-5) in 4. These reactions are illustrated in Figure 4. Previous investigators reported the isolation of chlorohydrin compounds FR901463 (3) from FERM BP-34217−9 and closely related thailanstains B (10) and C from Burkholderia sp. MSMB43,20 all as major components. However, in our fermentation broths, the chlorohydrin analogues 3, 9, and 10 were consistently detected at very low levels. By examining the

Figure 3. Selected HMBC and ROESY correlations for 4.

1867

dx.doi.org/10.1021/np500342m | J. Nat. Prod. 2014, 77, 1864−1870

Journal of Natural Products

Article

Figure 4. Formation of chlorohydrins and lactones.

reported experimental details, we realized that in the case of 37 hydrochloric acid was used in the processing of the culture. Likewise, during the production of thailanstatins B (10) and C, a large quantity of sodium chloride (3 g/L) was contained in the medium and 1 N hydrochloric acid was used to maintain the pH of the fermentation.20 Considering the ease of converting spliceostatin epoxides to chlorohydrins in the presence of chloride ion, we can assume that spliceostatin chlorohydrin analogues are likely generated chemically during fermentation or isolation. Literature data20 as well as our stability studies22 showed that the cyclic ether based spliceostatin analogues spliceostatin C (4) and thailanstatin A (5) were more stable than the hemiketals such as FR901464 (1) in buffers at pH 7.4. However, these ether compounds, particularly 5, were notably less in vitro active against tumor cells than FR901464. We speculated that the weaker cytotoxicity may be a consequence of lower cellular permeability derived from the terminal carboxyl group. The lipophilicity at biological pH, represented by the partition coefficient between octanol and buffer at pH 7.4 (log D7.4), is known to be correlated with cellular permeability, and this parameter has been recognized as one of the key determinants of SAR.23 To test our hypothesis that the carboxyl groups in 4 and 5 give rise to their low permeability and thereby poor cytotoxcity, the log D7.4 values of 4 and 5 were measured by the shake flask method.24 The low lipophilicity of 4 and 5 was supported by the measured log D7.4. On the basis of this data, the carboxyl group in compounds 4 and 5 was modified by semisynthesis to obtain the ester derivative 15 and amide derivatives 16 and 17. As anticipated, these compounds showed improved permeability as reflected by their increased log D7.4 values (Table 2).

Cytotoxicity. The spliceostatin analogues 4−12 and semisynthetic analogues 14−17 were evaluated in cell proliferation assays against a panel of solid tumor cell lines. The results are shown in Table 3. Among the tested compounds, isolated from the fermentation broths or obtained by semisynthesis, 4, 8, 9, 12, 15, 16, and 17 showed potent cytotoxicity with IC50 values ranging from 0.11 to 9.1 nM. The presence of an epoxide or a chlorohydrin functionality at C-3 significantly increases potency. For example, compound 4 (a C3 epoxide) is about 10-fold as potent as 6 (a C-3 alkene). In the cases of epoxide-containing analogues, this effect is further enhanced when a hydroxyl function is attached to the neighboring C-4, as reflected in the potency for 16 and 17. Similar observations have also been reported in the literature.12−16 The log D7.4 data suggests that the reduced in vitro potency of 5 is the result of its lower membrane permeability, apparently derived from the carboxyl group. This is supported by the dramatic enhancement in potency of the more lipophilic ester 15 and amide 17. Furthermore, spliceostatin E (8), with a 5,6-dihydro-α-pyrone moiety, exhibited good potency, indicating that there may be opportunities to modify the tetrahydropyran moiety while retaining the potency.

■

CONCLUSION Nine compounds of the spliceostatin class were isolated from the fermentation broth of FERM BP-3421, which has been reclassified as a Burkholderia sp., and structures of the new analogues were elucidated by spectroscopic analysis. The semisynthetic ester and amide analogues 15 and 17 showed better lipophilicity and significantly higher potency against tumor cell lines than their carboxyl precursor 5. The ease of preparation of 9 and 10 from the corresponding epoxides 4 and 5, in conjunction with the fact that the previously reported procedures to isolate such chrolohydrins all involved the use of chloride in fermentation medium or processing solvent, leads us to believe that spliceostatin chlorohydrins are artificially generated during the fermentation or isolation. The truncated diene carboxylic acid (11) could potentially be useful as an intermediate to generate semisynthetic analogues with improved stability and SAR properties. Spliceostatin E (8), bearing a 5,6-dihydro-α-pyrone, maintained good potency against tumor cell lines, suggesting that there is an opportunity to explore the synthesis of new and potent spliceostatin analogues with alternative electrophilic functionalities in the tetrahydropyran moiety. It is also worth noting that the carboxyl group in 4 and 5 provides a useful handle for the

Table 2. Log D7.4 for Some Spliceostatin Analogues log D7.4

4

5

15

16

17

0.077

−0.658

2.228

3.723

2.215

The methyl ester 15 was prepared in quantitative yield by treatment of 5 with methyl iodide in the presence of sodium carbonate. The n-propylamides 16 and 17 were prepared from compounds 4 and 5, respectively, by treatment with npropylamine in the presence of 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate. The methylation and amide formation are shown in Figure 5. 1868

dx.doi.org/10.1021/np500342m | J. Nat. Prod. 2014, 77, 1864−1870

Journal of Natural Products

Article

Figure 5. Synthesis of methyl ester and n-propyl amides. Chromolith semipreparative RP 18e, 100 × 10 mm column. Preparative HPLC was performed on a Varian ProStar model 330 instrument (diode array detector) using a YMC-Pack-ODS-A, 250 × 30 mm, S-10 um, 12 nm column or Waters ODS-A, 50 × 300 mm, 12 um, 120 A column. All reagents and solvents were purchased from commercial sources, unless otherwise specified. Taxonomy. Genomic DNA was isolated from a pure culture of FERM BP-3421 using the ZR Fungal/Bacterial DNA MiniPrep (Zymo Research), and the nearly complete 16S rRNA gene was PCR amplified using primers 8FPL (5′AGAGTTTGATCCTGGCTCAG3′) and 1492RPL (5′GGTTACCTTGTTACGACTT3′).25 PCR products were purified with the DNA Clean and Concentrator-25 kit (Zymo Research) and directly sequenced with 8FPL and 1492RPL in addition to the following primers: pC FWD (5′CTACGGGAGGCAGCAGTGGG3′), pC REV (5′CCCACTGCTGCCTCCCGTAG3′), pD FWD (5′CAGCAGCCGCGGTAATAC3′), pD REV (5′GTATTACCGCGGCTGCTG3′), pF FWD (5′CATGGCTGTCGTCAGCTCGT3′), pF REV (5′ACGAGCTGACGACAGCCATG3′).26 To determine the taxonomic affiliation of FERM BP-3421, the fully double-stranded 16S rRNA sequence was searched against the GenBank database (National Center for Biotechnology Information) with BLASTN.27 The 16S rRNA sequences of the most closely related Burkholderia spp. type strains and “B. rinojensis” were extracted from GenBank. Sequences were aligned with ClustalX (version 1.81),28 and distance analyses were conducted with TREECON 1.3b.29 Matrices were measured using the method of Jukes and Cantor.30 Trees were inferred by neighbor-joining, and the confidence of the tree topologies was assessed by 1000 bootstrap replicates. The 16S rRNA sequence was deposited in GenBank with accession no. KJ364655. Fermentation. FERM BP-3421 was acquired from the International Patent Organism Depositary (IPOD) at the National Institute of Advanced Industrial Science and Technology (AIST Tsukuba, Central 6, 1-1-1, Higashi, Tsukuba, Ibaraki 305-8566, Japan). FERM BP-3421 was plated onto nutrient agar plates and incubated at 30 °C for 2 to 3 days. Several 250 mL Erlenmeyer flasks containing 50 mL of seed medium (1% polypeptone, 0.5% yeast extract, 0.5% NaCl) were inoculated with an agar-grown culture and incubated at 30 °C with shaking at 220 rpm for 18−20 h. For production, the seed culture was inoculated into 500 mL of production medium (1% soluble starch, 1% glycerol, 0.5% glucose, 1% Hy-Soy soy peptone (Sheffield Bioscience, Kerry, Inc.), 0.5% corn steep liquor (Sigma), 0.2% ammonium sulfate, 0.006% magnesium sulfate·6H2O, 0.2% CaCO3, pH 7.0) per 2.8 L Fernbach flask with no baffles at 2.5% (v/v). The fermentation was incubated at 25 °C with shaking at 200 rpm for 72 h. At the end of fermentation, the cells were separated from the broth by centrifugation, HP20 resin (5% w/v) was added to the supernatant, and the mixture was stirred for 60 min. The HP20 was collected by centrifugation or filtration and extracted with ethyl acetate. The crude extract was subsequently purified by repeated chromatography. Detailed purification procedures, spectroscopic data, and semisyntheses can be found in the Supporting Information.

Table 3. IC50 values (nM) for 4−17 in Tumor Cell Proliferation Assays compound

H1975

positive control (paclitaxel) 4 5 6 7 8 9 10 11 12 14 15 16 17

7.94 3.6 320 30 950 NT NT NT NT NT NT NT 2.4 0.28

a

BT474

MDA-MBDYT2

7.53

8.36

6.08

7.17

2.0 59 NTa NT 3.67 0.641 >100 >100 1.86 >100 0.78 6.0 0.64

4.8 145 NT NT 3.72 1.85 >100 >100 3.82 NT 0.88 2.5 0.19

9.1 161 NT NT 4.16 NT NT >100 3.07 >100 1.25 NT 0.29

3.4 142 NT NT 1.56 1.35 >100 NT NT >100 NT 1.7 0.11

N87

MDAMB-468

NT, not tested.

preparation of analogues with improved biological and pharmaceutical properties. Further work on the semisynthesis of such analogues is currently under way, and will be revealed in our upcoming reports.

■

EXPERIMENTAL SECTION

General Experimental Procedures. All NMR spectra were recorded on a Bruker AVIII spectrometer operating at 399.72 MHz for 1 H and 100.51 MHz for 13C at 27 °C with a 5 mm BBFO probe equipped with a Z-axis gradient. Each sample was dissolved in DMSOd6 and placed in a 5 mm NMR tube. Chemical shifts are reported in ppm and were referenced to the deuterated solvent using the digital lock. High-resolution ESIMS analyses were performed on a Waters Acquity UPLC/Synapt G2 QTOF mass spectrometer, using an ACQUITY UPLC BEH C18, 2.1 mm × 150 mm, 1.7 μm column (40 °C; DAD 210 to 500 nm; MS (+) range 50−2000 Da). LC-MS data were obtained on a system consisting of an HPLC pump, HP1100 DAD (1315A) detector, column oven from Agilent Technologies (Wilmington, DE, USA); autosampler and MS detector from Waters Corporation (Milford, MA, USA); and ELS detector from Varian Medical Devices (Palo Alto, CA, USA), using a Phenomenex GeminiNX, 4.6 mm × 50 mm, C18, 3 μm, 110A column (60 °C; DAD 200− 450 nm scan; MS ESI(±), 100−1200 m/z scan). Preliminary reversephase purification was performed using a Sephadex LH20 column with methanol as an eluent. Analytical HPLC was performed on an Agilent 1100 or 1200 series instrument (diode array detector) using a YMC ODS-A, 4.6 × 150 mm, 5 μm column. Semipreparative HPLC was performed on an Agilent 1200 series instrument (diode array detector) using a Phenomenex Luna 5 μm C18, 250 × 10 mm column or a 1869

dx.doi.org/10.1021/np500342m | J. Nat. Prod. 2014, 77, 1864−1870

Journal of Natural Products

Article

Cytotoxicity Assay. Human tumor cell lines H1975, N87, BT474, and MDA-MB-468 were purchased from the American Type Culture Collection (ATCC). MDA-MB-361-DYT2 cells were generously provided by Dr. D. Yang (Georgetown University, Washington, DC). Cells were seeded in 96-well clear-bottom plates, then treated the following day with compounds at 3-fold serial dilutions at 10 concentrations in duplicate. Cells were incubated for 4 days in a humidified 37 °C/5% CO2 incubator. The plates were harvested with either CellTiter 96 AQueous One MTS solution or CellTiter-Glo luminescent cell viability assay (Promega, Madison, WI, USA) and read on a Victor plate reader (PerkinElmer, Waltham, MA, USA). IC50 values were calculated using a four-parameter logistic model with XLfit (IDBS, Bridgewater, NJ, USA). Log D7.4 Determination.31 Test compound (10 mM DMSO stock, 2 μL) was added to a deep 96-well plate containing 298 μL of 50% 1-octanol and 50% phosphate buffer (pH 7.4) presaturated with one another. The assay was performed in duplicate with a typical coefficient of variation of ∼20%. The plate was sealed and vigorously mixed on a plate shaker for 15 min at room temperature. The plate was then subjected to centrifugation at 2500 rpm (1006g) for 10 min to separate the phases. Aliquots from the 1-octanol phase and the buffer phase were removed from the wells, diluted accordingly, and analyzed with LC-MS/MS.

■

(8) Nakajima, H.; Takase, S.; Terano, H.; Tanaka, H. J. Antibiot. 1997, 50, 96−99. (9) Nakajima, H.; Hori, Y.; Terano, H.; Okuhara, M.; Manda, T.; Matsumoto, S.; Shimomura, K. J. Antibiot. 1996, 49, 1204−1211. (10) Kaida, D.; Motoyoshi, H.; Tashiro, E.; Nojima, T.; Hagiwara, M.; Ishigami, K.; Watanabe, H.; Kitahara, T.; Yoshida, T.; Nakajima, H.; Tani, T.; Horinouchi, S.; Yoshida, M. Nat. Chem. Biol. 2007, 3, 576−583. (11) Gao, Y.; Vogt, A.; Forsyth, C. J.; Koide, K. ChemBioChem 2013, 14, 49−52. (12) Thompson, C. F.; Jamison, T. F.; Jacobsen, E. N. J. Am. Chem. Soc. 2001, 123, 9974−9983. (13) Motoyoshi, H.; Horigome, M.; Watanabe, H.; Kitahara, T. Tetrahedron 2006, 62, 1378−1389. (14) Ghosh, A. K.; Chen, Z.-H. Org. Lett. 2013, 15, 5088−5091. (15) Albert, B. J.; Sivaramakrishnan, A.; Naka, T.; Czaicki, N. L.; Koide, K. J. Am. Chem. Soc. 2007, 129, 2648−2659. (16) Motoyoshi, H.; Horigome, M.; Ishigami, K.; Yoshida, T.; Horinouchi, S.; Yoshida, M.; Watanabe, H.; Kitahara, T. Biosci. Biotechnol. Biochem. 2004, 68, 2178−2182. (17) Osman, S.; Albert, B. J.; Wang, Y.; Li, M.; Czaicki, N. L.; Koide, K. Chem.Eur. J. 2011, 17, 895−904. (18) Cordova-Kreylos, A.; Fernandez, L. E.; Koivunen, M.; Yang, A.; Flor-Weiler, L.; Marrone, P. G. Appl. Environ. Microbiol. 2013, 79, 7669−7678. (19) Asolkar, R. N.; Cordova-Kreylos, A.; Himmel, P.; Marrone, P. G. In Pest Management with Natural Products; Beck, J. J.; Coats, J. R.; Duke, S. O.; Koivunen, M. E., Eds.; ACS Symposium Series; American Chemical Society: Washington DC, 2013; Chapter 3, pp 17−30. (20) Liu, X.; Biswas, S.; Berg, M. G.; Antapli, C. M.; Xie, F.; Wang, Q.; Tang, M.-C.; Tang, G.-L.; Zhang, L.; Dreyfuss, G.; Cheng, Y.-Q. J. Nat. Prod. 2013, 76, 685−693. (21) Liu, X.; Biswas, S.; Tang, G.-L.; Cheng, Y.-Q. J. Antibiot. 2013, 66, 555−558. (22) Internal chemical and metabolic stability data (not included in this paper) are consistent with the data reported in ref 20. (23) Terrett, N. Med. Chem. Commun. 2013, 4, 474−475. (24) Hay, T.; Jones, R.; Beaumont, K.; Kemp, M. Drug Metab. Dispos. 2009, 37, 1864−1870. (25) Reysenbach, A. L.; Wickham, G. S.; Pace, N. R. Appl. Environ. Microbiol. 1994, 60, 2113−2119. (26) Edwards, U.; Rogall, T.; Blöcker, H.; Emde, M.; Böttger, E. C. Nucleic Acids Res. 1989, 17, 7843−7853. (27) Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W. J. Mol. Biol. 1990, 215, 403−410. (28) Thompson, J. D.; Gibson, T. J.; Plewniak, F.; Jeanmougin, F.; Higgins, D. G. Nucleic Acids Res. 1997, 25, 4876−4882. (29) Van De Peer, Y.; De Wachter, R. Comput. Appl. Biosci. 1994, 10, 569−570. (30) Jukes, T. H.; Cantor, C. R. In Mammalian Protein Metabolism; Munro, H. N., Ed.; Academic Press: New York, 1969; pp 21−123. (31) Li, R.; Bi, Y.-A.; Lai, Y.; Sugano, K.; Steyn, S. J.; Trapa, P. E.; Di, L. AAPS J. 2014, 16, 802−809.

ASSOCIATED CONTENT

S Supporting Information *

Detailed isolation procedures, MS, 1H, 13C NMR data, and semisynthesis methods are available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Tel: 860-715-5013. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors gratefully acknowledge L. Whitney and M-H. Lam for performing cytotoxicity evaluation; J. Stroh, K. Tabei, and X. Feng for high-resolution MS data; A. Butler, K. A. Farley, and D. P. Anderson for NMR support; R. Bigelis, D. Roll, J. Lucas, and K. Yu for contributions to the early stage of this project; L-P. Chang, A. S. Eustaquio, and G. L. Steele for optimization of fermentation conditions; M. Wagenaar for analytical support; C. Subramanyam, R. Dushin, E. I. Graziani, A. Maderna, Li Di, and many others for fruitful discussions and generous help.

■

REFERENCES

(1) van Alphen, R. J.; Wiemer, E. A. C.; Burger, H.; Eskens, F. A. L. M. Br. J. Cancer 2009, 100, 228−232. (2) Rymond, B. Nat. Chem. Biol. 2007, 3, 533−535. (3) Grosso, A. R.; Martins, S.; Carmo-Fonseca, M. EMBO Rep. 2008, 9, 1087−1093. (4) Mizui, Y.; Sakai, T.; Iwata, M.; Uenaka, T.; Okamoto, K.; Shimizu, H.; Yamori, T.; Yoshimatsu, K.; Asada, M. J. Antibiot. 2004, 57, 188−196. (5) Kotake, Y.; Sagane, K.; Owa, T.; Mimori-Kiyosue, Y.; Shimizu, H.; Uesugi, M.; Ishihama, Y.; Iwata, M.; Mizui, Y. Nat. Chem. Biol. 2007, 3, 570−575. (6) Eskens, F. A. L. M.; Ramos, F. J.; Burger, H.; O’Brien, J. P.; Piera, A.; de Jonge, M. A. J.; Mizui, Y.; Wiemer, E. A. C.; Carreras, M. J.; Baselga, J.; Tabernero, J. Clin. Cancer Res. 2013, 19, 6296−6304. (7) Nakajima, H.; Sato, B.; Fujita, T.; Takase, S.; Terano, H.; Okuhara, M. J. Antibiot. 1996, 49, 1196−1203. 1870

dx.doi.org/10.1021/np500342m | J. Nat. Prod. 2014, 77, 1864−1870