Defect-Related Luminescent Hydroxyapatite-Enhanced Osteogenic

Research Article www.acsami.org

Defect-Related Luminescent Hydroxyapatite-Enhanced Osteogenic Differentiation of Bone Mesenchymal Stem Cells Via an ATP-Induced cAMP/PKA Pathway Chao Wang,†,§,# Dandan Liu,†,§,# Cuimiao Zhang,†,§ Jiadong Sun,§ Weipei Feng,†,§ Xing-Jie Liang,‡ Shuxiang Wang,*,†,§ and Jinchao Zhang*,†,§

Downloaded via UNIV OF LOUISIANA AT LAFAYETTE on January 26, 2019 at 12:45:04 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

†

College of Chemistry and Environmental Science, Chemical Biology Key Laboratory of Hebei Province, Hebei University, Baoding 071002, People’s Republic of China § Key Laboratory of Medicinal Chemistry and Molecular Diagnosis of the Ministry of Education, Hebei University, Baoding 071002, People’s Republic of China ‡ CAS Key Laboratory for Biological Effects of Nanomaterials and Nanosafety, National Center for Nanoscience and Technology of China, Beijing 100190, People’s Republic of China ABSTRACT: Novel defect-related hydroxyapatite (DHAP), which combines the advantages of HAP and defect-related luminescence, has the potential application in tissue engineering and biomedical area, because of its excellent capability of monitoring the osteogenic differentiation and material biodegradation. Although the extracellular mechanism of DHAP minerals and PO43− functioning in osteogenic differentiation has been widely studied, the intracellular molecular mechanism through which PO43− mediates osteogenesis of bone mesenchymal stem cells (BMSCs) is not clear. We examined a previously unknown molecular mechanism through which PO43− promoted osteogenesis of BMSCs with an emphasis on adenosine−triphosphate (ATP)induced cAMP/PKA pathway. Our studies showed that DHAP could be uptaken into lysosome, in which PO43− was released from DHAP, because of the acid environment of lysosome. The released PO43− interacted with ADP to form ATP, and then degraded into adenosine, an ATP metabolite, which interacted with A2b adenosine receptor to activate the cAMP/PKA pathway, resulting in the high expression of osteogenesis-related genes, such as Runx2, BMP-2, and OCN. These findings first revealed the function of ATP-metabolism in bone physiological homeostasis, which may be developed to cure bone metabolic diseases. KEYWORDS: defect-related hydroxyapatite, osteogenic differentiation, mesenchymal stem cell, ATP metabolism, cAMP/PKA pathway materials have been reported.9 These novel defect-related inorganic materials may be applied as scaffold in tissue engineering, because of their stable fluorescent functions, noncytotoxicity, and biocompatibility. Therefore, in combining the advantages of HAP and defect-related luminescence, we designed and synthesized the HAP nanorods with defectrelated luminescent property to monitor the PO43− release and study the intracellular molecular mechanism of osteogenesis of bone mesenchymal stem cells (BMSCs) induced by DHAP. BMSCs are multipotent cells, which possess the capability to differentiate into osteocytes, adipocytes, and chondrocytes, have generated abundant potential clinical application in regenerative medicine and bone tissue engineering in recent years.10,11 HAP as a main inorganic component of bone can influence the differentiation of BMSCs directly. It has been reported that a nanofibrous hydroxyapatite/chitosan scaffold,

1. INTRODUCTION Recently, luminescent hydroxyapatite (HAP) has been widely used as a bone substitute and implant in biomedical applications, not only because of the biocompatibility and biodegradation, as well as high function of enhancing osteogenic differentiation, but also the excellent ability of luminescence, which renders it capable of monitoring the osteogenic differentiation and material biodegradation both in vitro and in vivo.1−6 For example, Liu7 et al. reported a fluorescent nanostructured HAP scaffold for convenient tracking of the scaffold biodegradability and cell internalization using confocal laser scanning microscopy. Chung8 et al. synthesized the AuNP-conjugated fluorescent HAP, which was used as a smart nanoprobe for testing phosphatase activity during the osteogenic differentiation of MC3T3-E1 cells (preosteoblast). However, these luminescent HAPs introduced organic molecules or semiconductor nanoparticles, which have seriously limitations in biomedical applications, such as toxicity, photobleaching, and quenching of fluorescence. Recently, a series of environmentally friendly and efficient defect-related © 2016 American Chemical Society

Received: January 27, 2016 Accepted: April 18, 2016 Published: April 18, 2016 11262

DOI: 10.1021/acsami.6b01103 ACS Appl. Mater. Interfaces 2016, 8, 11262−11271

Research Article

ACS Applied Materials & Interfaces

(TEM) images were obtained from a FEI Tecnai G2 S-Twin transmission electron microscope with a field-emission gun operating at 200 kV. The photoluminescence (PL) spectra were performed with a spectrophotometer (Hitachi, Model F-7000). Powder X-ray diffraction (XRD) patterns were obtained on a diffractometer (Rigaku, Model D8 Avance) using Cu Kα radiation (λ = 0.15405 nm). 2.4. Inorganic Phosphate Assay. Intracellular phosphate and DHAP-released phosphate were measured using a Phosphomolybdenum Blue assay.24 Briefly, 1 mL supernatant of cells was collected into a 50 mL tube, and then 2 mL of ammonium molybdate solution and 1 mL of ascorbic acid were added as a deoxidizer and a chromogenic agent, respectively. The phosphate contents were detected using a spectrophotometer at 710 nm. All the measurements were quantified using a phosphate standard curve with a concentration rang from 1 μg/mL to 6 μg/mL. The degradation rate of DHAP was expressed by phosphate concentration. 2.5. BMSCs Isolation and Culture. BMSCs were isolated from ICR mouse (4-week-old) as our previous report.25 BMSCs were cultured in DMEM medium contained with 100 units/mL penicillin, 100 mg/mL streptomycin, and 10% fetal bovine serum (FBS) in a humidified atmosphere of 5% CO2 in air at 37 °C. The fresh medium was replaced every 3 days. 2.6. Cellular Biocompatibility. The biocompatibility of DHAP was tested by MTT assay and hemolytic assay, respectively.26 Briefly, BMSCs (5 × 105 cells/well) were seeded in 96-well plates for 5 days of incubation, then DHAP (final concentrations of 20, 40, 60, and 100 μg/mL) was added, and cells without DHAP as control. After 1, 2, and 3 d of incubation, 10 μL of MTT was added into each well and maintained at 37 °C for 4 h. The supernatant was discarded, and the formazan crystals were dissolved by DMSO (Sigma−Aldrich). The absorbance then was tested through a microplate reader (Molecular Devices, SpectraMax, USA) at 570 nm. To determine hemolysis compatibility, blood from ICR mouse was collected and washed with PBS until the supernatant became colorless. Then, 200 μL of resuspended erythrocyte were commixed with 800 μL of DHAP to the final concentration of 20, 60, 100, 200, 400, and 600 μg/mL. Erythrocyte incubated in 800 μL of H2O and 800 μL of PBS were used as positive and negative control, respectively. After 4 h of incubation at 37 °C, the mixture was centrifuged at 10 000 g for 5 min. The supernatant absorbance at 577 nm was determined by a microplate reader (Molecular Devices, SpectraMax, USA). 2.7. Confocal Laser Scanning Microscopy (CLSM). CLSM was employed to observe cellular uptake and internalization.27 Briefly, BMSCs cultured on a glass-bottom cell culture dish were treated with DHAP (100 μg/mL) for 4 h, then 100 μL of Lysotracker Red (100 nM) and Mitotracker green (100 nM) were added into the plate for 30 min of incubation. After washing three times with PBS, the uptake of DHAP was observed by CLSM (Olympus, Model IX81, Japan). 2.8. Cellular Uptake Mechanism. The uptake mechanism of DHAP in BMSCs was analyzed by a flow cytometry.28,29 Briefly, BMSCs were seeded in 6-well plates at the density of 2 × 107 cells/ well and cultured with a macropinocytosis inhibitor (wortmannin), a clathrin inhibitor (chloropromazine), and caveolae inhibitor (nystatin) for 30 min at 37 °C. Subsequently, DHAP was involved for 6 h to allow cell uptake. The cells cultured with DHAP at 4 and 37 °C acted as negative and positive controls, respectively. Cells then were collected and analyzed by a FACScalibur flow cytometer (Becton Dickinson, FACScalibur, USA). 2.9. Alkaline Phosphatase (ALP) Activity. ALP activity of BMSCs treated with DHAP was measured according to our previous work.30,31 Briefly, after 7 and 10 days of treatment with osteogenic supplementary (OS) containing 60 μg/mL and 100 μg/mL DHAP, BMSCs were subjected to repeated freezing and thawing to isolate the total protein. ALP activity then was tested by an ALP assay kit and microprotein assay kit. 2.10. Mineralized Matrix Assay. BMSCs (2 × 106 cells/well) were cultured with OS and DHAP with concentrations of 60 μg/mL and 100 μg/mL. After 18 days culture, the cells were fixed with 4% paraformaldehyde for 40 min at room temperature, followed by washing with PBS, and then strained with 0.1% Alizarin Red for 30

which possesses a similar composition and construction to natural bone, promoted the adherence, proliferation, and osteogenesis of BMSCs via integrin and BMP/Smad signaling pathway.12 Xia et al.13 demonstrated that macroprorous HAP could promote cell attachment and osteogenesis of MSCs through p38/MAPK and ERK signaling pathways in vitro, and repair the deficient skull in vivo. The hydroxyapatite plays a key role in tissue engineering, and the extracellular mechanism of HAP minerals and PO43− functioning in osteogenic differentiation has been widely studied;6 however, the intracellular molecular mechanism through which PO43− mediates the osteogenesis of BMSCs is not clear. Adenosine triphosphate (ATP) as the source of energy influences the radical cellular activities of cells, such as adhesion, proliferation, and differentiation.14−16 ATP can degrade into cyclic adenosine monophosphate (cAMP) through the binding of adenosine (an ATP dephosphorylation product) and A2b adenosine receptor, and the increased-cAMP activates the cAMP/PKA pathway, which has been proven to enhance the bone formation of BMSCs.17−22 In this study, the defect-related HAP could enter into lysosome and released PO43− into cytoplasm through fluorescent imaging in the cell. Therefore, a hypothesis was proposed that the PO43− was released from DHAP, which could interact with adenosine diphosphate (ADP) to form ATP, resulting in the activation of cAPM/PKA pathway through increased adenosine. In this study, we revealed a previously uncharted mechanism, with a focus on the phosphate metabolism, by which DHAP promotes osteogenesis of BMSCs. The results indicated that the released PO43− from DHAP plays a pivotal role in facilitating BMSCs osteogenesis by mediating phosphate content and ATP synthesis in mitochondria. The secreted ATP will be metabolized into adenosine, which binds to A2b adenosine receptors to activate the cAMP/PKA pathway, which induces the BMSCs differentiate toward osteoblast. This finding elaborated the impact of ATP metabolism in bone physiological homeostasis, which may be developed to cure metabolic bone diseases.

2. EXPERIMENTAL SECTION 2.1. Materials. In this work, chemicals were obtained from Beijing Chemical Corporation. Cetyltrimethylammonium bromide was purchased from Beijing Yili Fine Chemicals Co., Ltd. All the initial chemicals were used without further processing. For cell culture, trypsin and phosphate buffered saline (PBS) were obtained from Wisent (Canada), Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were obtained from Life Technologies (USA), and dimethyl sulfoxide (DMSO) was obtained from Sigma (USA). 2.2. Defect-Related HAP Nanorods Preparation. Defectrelated HAP nanorods were synthesized via a hydrothermal method.23 Typically, 0.2 g of hexadecyltrimethylammonium bromide (CTAB) and 2 mmol of Ca(NO3)2·4H2O were dissolved in 20 mL of purified water. Subsequently, ammonia solution was introduced dropwise to adjust the pH value at 4.0−6.0 to prepare solution A. Then 1.2 mmol of (NH4)2HPO4 and 2 mmol of trisodium citrate were dissolved in 15 mL of deionized water to prepare solution B. After stirring for 30 min, solution B was added to solution A with stirring for 20 min. The mixture then was poured into a stainless steel autoclave and heated to 180 °C for 24 h. After the precipitate was cooled to room tempurature, it was washed with water and ethanol, respectively, and dried at 80 °C for 12 h. 2.3. Characterizations of DHAP. Scanning electron microscopy (SEM) (Model JSM-7500F, Japan) was performed to inspect the morphology of the materials. Transmission electron microscopy 11263


Research Article

ACS Applied Materials & Interfaces Table 1. RT-qPCR Primers gene

forward primer

reverse primer

BMP-2 Runx2 OCN Col-1 ALP GAPDH

TGGCCCATTTAGAGGAGAACC TTCTCCAACCCACGAATGCAC AACATGACCAAAAACCAAAAGTG GAACAGACTCCGGCGCTA GTTGCCAAGCTGGGAAGAACAC GACTTCAACAGCAACTCCCAC

AGGCATGATAGCCCGGAGG CAGGTACGTGTGGTAGTGAGT CATTGTTTCCTGTGTCTTCTGG AGGGAGGATCAAGTCCCG CCCACCCCGCTATTCCAAAC TCCACCACCCTGTTGCTGTA

Figure 1. (A) SEM image of DHAP at 100 000×; (B) TEM image of DHAP at 100 000×; (C) XRD patterns of DHAP nanoparticle (black) and standard DHAP (red); and (D) photoluminescence excitation (purple) and emission (blue) spectra of DHAP. min at 37 °C. The mineralized nodules of DHAP-treated BMSCs were quantified through dissolution in 10% cetylpyridinium chloride. The absorbance was detected by using a microplate reader at 570 nm (Molecular Devices, SpectraMax, USA). 2.11. Quantitative Real Time Polymerase Chain Reaction (RT-qPCR). The levels of mRNA for osteogenesis-related genes (BMP-2, Runx2, OCN, and Co l-1) in 100 μg/mL DHAP-treated BMSCs were analyzed using RT-qPCR. The total RNA was isolated using TRIzol reagent (Life Technologies, USA) according to the manufacturer’s instructions. The concentration of total RNA was measured using a spectrophotometer. Then, 2.5 μg of RNA was performed to reverse transcriptase reaction in a 20 μL mixture according to the manufacturer’s instructions (TaKaRa, Japan). RTqPCR was conducted using StepOnePlus Real-Time PCR System (StepOnePlus, ABI, USA), and performed in a total volume of 25 μL containing l μL primer pair stock (7.5 μM), 4 μL cDNA, 12.5 μL MltraSYBR mixture and 7.5 μL H2O. The amplification cycles included denaturation for 30 s at 95 °C; annealing for 30 s at 61 °C (ALP, BMP-2), 60 °C (Runx2, OCN, Col-1) and 57 °C (GAPDH), respectively; and extension for 10 min at 72 °C for 40 cycles. The GAPDH, as a housekeeping gene, was used to normalize all the values using the 2−ΔΔCt method.33 The primer sequences are summarized in Table 1.

2.12. Intracellular ATP Analysis. Intracellular ATP was measured using an ATP assay kit (Nanjing Jiancheng Bioengineering Institute, China).17 Generally, BMSCs (2 × 107 cells/well) were cultured with an OS medium containing 100 μg/mL DHAP for 3 days. Cells then were harvested and the ATP levels were measured according to the manufacturer’s instructions. 2.13. High-Performance Liquid Chromatography (HPLC). Adenosine contents in BMSCs extracellular matrix after 100 μg/mL DHAP treatment was measured by HPLC (Agilent 1260, USA).32 In short, after 5 days of culture, the medium was collected and freezedried, and then the powder was dissolved in deionized water and detected on an Model Zorbax SB-C18 column (5 μm, 4.6 × 250 mm, Agilent, USA) at 260 nm. The mobile phase was 0.1 mol/L phosphate buffer (pH 7.4)−methanol (9:1). The result was calculated by comparing the retention time and peak area of the adenosine standard. 2.14. Cyclic Adenosine Monophosphate (cAMP) Analysis. DHAP-treated BMSCs were cultured at 37 °C for 5 days, and then cells were collected and multigelated to destroy the membrane. The suspension was centrifuged at 10 000 rpm for 5 min, and the supernatant were used to detected cAMP concentration by using a cAMP activity assay kit (Roche, USA). 2.15. Statistical Analysis. All data were expressed as mean ± standard deviation (SD) by repeating the experiment at least three times. The statistical differences were measured by a one-way analysis 11264


Research Article


Figure 2. Photoluminescence spectra (A) and fluorescent photographs (B) of DHAP at 377 nm excitation after immersion in acetic acid for 0, 3, 12, and 24 h, respectively; (C) phosphate release rate after immersing in acetic acid for 3, 6, 12, and 24 h.

Figure 3. (A) Cell viability of BMSCs after DHAP treatment for 24, 48, and 72 h; (B) Relative hemolysis of BMSCs after incubation of H2O (positive), PBS (negative), and DHAP. (The triple asterisk symbol (***) denotes a value of p < 0.001 vs control.) of variance (ANOVA), followed by Newman−Keuls analysis. Results were considered statistically significant at P < 0.05.

(Joint Committee on Powder Diffraction Standards (JCPDS) No. 09-0432). The pure tetragonal phase of HAP was formed without impurity phase detection. The luminescence property was investigated by photoluminescence excitation and emission spectra (Figure 1D). The excitation spectrum consists of a broadband from 200 nm to 450 nm (centered at 337 nm). Under 337 nm excitation, the emission spectrum is composed of an intense broadband from 400 nm to 600 nm (centered at 441 nm), which exhibits a white-blue emission. 3.2. Phosphate Release and Fluorescence Decrease of DHAP. The degradation property of DHAP was evaluated through immersing DHAP into acetic acid buffer (pH 5.0); as the time prolonged, the crystal configuration of DHAP was

3. RESULTS AND DISCUSSION 3.1. Characterizations of DHAP. The particle size and typical shape of DHAP were investigated by SEM and TEM images. As shown in Figures 1A and 1B, the DHAP sample is composed of uniform nanorods with length of ∼100 nm and diameter of ∼30 nm. The particle size and typical shape of DHAP sample are similar to those of phosphorites, which exist in natural bone and can be easily uptaken by BMSCs. Figure 1C shows the XRD pattern of DHAP sample. The diffraction peaks can be well-indexed to the hexagonal phase hydroxyapatite 11265


Research Article


Figure 4. (A) Confocal laser scanning microscopy images of uptake and localization of DHAPs. (B) The uptake mechanism was investigated using the inhibitors of endocytosis subcategories: (*) p < 0.05, (**) p < 0.01, and (***) p < 0.001 vs positive).

broken, and the fluorescence intensity of DHAP also decreased, because the fluorescence of DHAP was caused by lattice defects.33 Figures 2A and 2B show that the fluorescence intensity was optimal at 0 h of immersion, and decreased gradually as the time prolonged; after 24 h of immersion, the intensity of defect-related HAP was lowest. Also, as shown in Figure 2C, the phosphate release rate after 3, 6, 12, and 24 h of immersion were ∼23%, ∼27%, ∼29%, and ∼32%, respectively. 3.3. Effect of DHAP on the Cell Viability. The cell viability and biocompatibility were measured by MTT assay and hemolytic test, respectively. As shown in Figure 3A, the DHAP performed high cell viability at concentrations of 40, 60, and 100 μg/mL for 24, 48, and 72 h incubation in a dosedependent manner. Moreover, the cell viability achieved the highest values at 48 h to ∼143% after 100 μg/mL DHAP treatment. Hemolytic rate of DHAP at the concentration of 20, 60, 100, 200, 400, and 600 μg/mL showed in Figure 3B. The DHAP appeared to be anhemolytic at all concentrations, compared to positive group. 3.4. Uptake and Internalization of DHAP in BMSCs. The uptake and internalization of DHAPs in BMSCs were evaluated by a confocal microscopy imaging. As shown in Figure 4A, the fluorescence of DHAP (bule) overlapped with lyso-tracker (red) completely, but almost no overlap with mitotracker (green). These results demonstrated that the DHAP specifically targeted lysosome, and little was located in mitochondrion. It has reported that endocytosis is an energydependent uptake way that will be hindered at low temperature (4 °C), by which various extracellular materials could enter into cells. The endocytosis includes several subcategories, such as clathrin-independent endocytosis, macropinocytosis, and caveolae-independent endocytosis.34,35 To understand the uptake mechanism, inhibitors of endocytosis (wortmannin, chloropromazine, and nystatin) were coculture with BMSCs, respectively. The results (Figure 4B) showed that the scatter intensity of the positive group increased obviously, indicating the uptake of DHAP by BMSCs. However, after the treatment of wortannin, the scatter intensity of cells decreased remarkably, in comparison to the positive group, indicating the uptake of DAHP by BMSCs through a macropinocytosis pathway. Previous studies also showed that nanoparticles were uptaken by cells through a macropinocytosis pathway were wrapped up by endocytic vesicles at an early stage and finally coalesced with lysosome.36−38 3.5. DHAP Promoted ALP Activity and Mineralization. ALP activity an osteogenic-related early maker in BMSCs.39 In the presence of osteogenic induction supplement (OS), the impact of DHAPs on ALP activity was tested by normalizing to

total protein content to monitor the osteogenesis of BMSCs. Figure 5A shows that the ALP activity of BMSCs was increased markedly after 7 days of treatment of DHAP (100 μg/mL). As the time increased, the ALP activity increased significantly at all concentrations, compared to the control group, after 10 days of incubation (Figure 5B). Mineralized nodules are marked phenotypic of osteogenic differentiation and represent a final stage of osteogenic differentiation.40 In comparison to the control group, a significant increase of mineralized nodules was observed in OS, 60 μg/mL DHAP, and 100 μg/mL DHAP treatment (Figure 5C). The amounts of mineralized nodules were quantified by 10% cetylpyridinium. Compared to the control group, the results showed that the mineralized nodules were increased ∼400% after the 60 μg/mL and 100 μg/mL DHAP treatments for 18 days (Figure 5D). Based on the results of Figure 5, the osteogenic differentiation was enhanced by DHAP, when compared with the only-OS-treated group. 3.6. High Expression of Osteogenesis-Related Genes in DHAP-Treated BMSCs. To confirm the osteogenesis of BMSCs induced by DHAP, the mRNA level of osteogenic genes was examined by RT-qPCR, including Col-1, OCN, BMP-2, and Runx2. It has been reported that BMP-2 (a factor of TGF-β family) plays a key modulatory role in bone formation,41 and Runx2 also plays an important role in osteogenic linage from the pluripotent MSCs.42 In addition, Col-1 and OCN are regarded as the markers of osteogenesis of MSCs.43 Figure 5E shows that the mRNA level of BMP-2, Col1, and Runx2 was significantly increased, compared with the control group and the OS group after 5 days of treatment of 100 μg/mL DHAP, as well as the mRNA level of OCN. Besides that, the expression of osteogenic-related genes with NaN3 (an inhibitor of ATP) treatment was also tested. The blocked-ATP energy supply results in the down-regulated expression level of osteogenesis-related genes, such as ALP, Runx2, and OCN. This result indicated that the suppression of ATP inhibited osteogenic differentiation of BMSCs. Generally, the results demonstrated that DHAP promoted osteogenic differentiation of BMSCs, both on a cellular level and a molecular level. 3.7. DHAP-Released PO43− Increased the Intracellular ATP. Intracellularly, ATP as the source of energy influences the cell fates, such as adhesion, proliferation, and differentiation.14−16 Phosphate is a primary substrate for the phosphorylation of ADP by the F1F0-ATPase, and regulates the intracellular ATP production through the mitochondrial NADH activation.44 As shown in Figure 2C, the DHAP can be degraded in acetic acid buffer (pH 5.0), and after uptake by cells capsules are located in the lysosome (Figure 4B). Based on 11266


Research Article


Figure 5. (A, B) ALP activity of BMSCs incubated with DHAP for 7 and 10 days with concentrations of 60 and 100 μg/mL; (C) Alizarin Red staining of BMSCs cultured with DHAP in normal and osteogenic media for 18 days; (D) quantitative analysis of Alizarin Red staining results; (E) the mRNA expression of BMP-2, Runx2, Col-1, and OCN in BMSCs treated with DHAP for 5 days, analysis by RT-qPCR; and (F) the mRNA expression of Runx2, ALP, and OCN in BMSCs treated with DHAP for 5 days in the present of NaN3, analysis by RT-qPCR. (Legend: (**, $$, ##, ^^) p < 0.01, (***, $$$, ###, ^^^) p < 0.001 vs control.)

is equal to PO43− released from DHAP) for 3 days. These results confirmed that the increase of intracellular phosphate proved a source of ATP synthesis and promoted the product of ATP. 3.8. DHAP Promotes Osteogenesis of BMSCs through an ATP-Induced cAMP/PKA Pathway. It has demonstrated that ATP as a signaling molecule plays a vital role in the modulation of cell functions.14,15,17 To study the role of ATP on osteogenic differentiation of BMSCs, we used NaN3 (an ATP inhibitor)45 to eliminate intracellular ATP and then a dramatic decrease of ALP activity was observed in Figure 7A, indicating that inhibition of ATP suppressed the osteogenic differentiation of BMSCs. Adenosine, which is an ATP degration product, has been reported to contribute to

these results, a hypothesis was proposed that the DHAPs can be degraded in lysosome and release PO43− into cytoplasm. The abundant PO43− could react with ADP to synthesis ATP, which providing sufficient energy for osteogenic differentiation of BMSCs. Figure 6A showed that the intracellular phosphate was vastly increased when the cells were treated with 100 μg/ mL DHAP for 3 days. This finding was confirmed by the decreased-fluorescence intensity of DHAP in lysosome upon the release of PO43− from DHAP (Figures 6B and Figure 6C). Because an obvious function of PO43− is to serve as a substratum for ATP synthesis in the mitochondria, the ATP production in cells therefore was evaluated. In Figure 6D, an extremely increase of ATP was detected in cells after the treatment of 100 μg/mL DHAP and PO43− (the concentration 11267


Research Article


Figure 6. (A) Intracellular PO43− of BMSCs after cultured with DHAP for 3 days in control and osteogenic media; (B, C) Confocal laser scanning microscopy images of DHAP in BMSCs for 3, 6, 12, 24, and 48 h and quantitative analysis of fluorescence intensity; (D) ATP of BMSCs after cultured with DHAP and PO43− for 3 days in control and osteogenic media.

Figure 7. (A) ALP activity of BMSCs treated with DHAP and NaN3 for 7 days; (B) HPLC measurement of adenosine in culture medium after 3 days; (C) cAMP activity of BMSCs after treated with DHAP in control and osteogenic media; (D) ALP activity of BMSCs treated with DHAP and H-89 (10 μM). (Legend: (*) p < 0.05, (**) p < 0.01, and (***) p < 0.001 vs control.) 11268


Research Article

ACS Applied Materials & Interfaces osteogenic differentiation and bone formation.46 Adenosine exerts the effects when coupling with A2b receptor, and further activates the cAMP/PKA signaling pathway.20−22 As shown in Figure 7B, in comparison to the control and OS groups, a tremendous amount of adenosine was observed in the culture medium after 5 days of DHAP treatment. This result indicated that the adequate ATP in intracellular contributes to an increase in adenosine. It has been reported that the adenosine could couple with the A2b receptor easily and furtherly activates adenylate cyclase, which stimulates ATP to degrade into cAMP. Figure 7C indicated that the activity of cAMP was extremely increased after 5 days of DHAP treatment at a concentration of 100 μg/mL when compared to the control group and the OS group. To future confirm whether DHAP enhanced BMSC osteogenic differentiation via a cAMP/PKA pathway, we used H89 (N-[2-(p-bromocinnamylamino) ethyl]5-isoquinolinesulfonamide·2HCl hydrate), a PKA inhibitor, to coculture with BMSCs for 7 days. The results showed that after treatment with H89, the ALP activity significantly decreased, compared to the DHAP treatment group (Figure 7D). This finding suggested that attenuation of the cAMP/PKA signaling pathway inhibited the expression of ALP activity and further negatively affected the osteogenic differentiation of BMSCs. Together, this work proposed a molecular mechanism (described in Figure 8) that PO43− promoted osteogenesis of

lysosome, in which the crystal lattice of DHAP was broken and released PO43−, because of the low pH value. The releasedPO43− interacted with ADP to form ATP, and then degraded into adenosine, an ATP metabolite, which interacted with A2b adenosine receptor to activate the cAMP/PKA pathway, resulting in the high mRNA level of osteogenic differentiation-related genes, such as Runx2, BMP-2, and OCN. This finding elaborated the impact of ATP metabolism in bone physiological homeostasis, which may be developed to cure metabolic bone diseases.

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected] (S. Wang). *E-mail: [email protected] (J. Zhang). Author Contributions #

These authors contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS

■

REFERENCES

This work was supported by the Natural Science Foundation (Project Nos. 31470961, 21271059, 21471044, 51302062, 21301046), Key Basic Research Special Foundation of Science Technology Ministry of Hebei Province (No. 14961302D), Hebei Province “Hundred Talents Program” (No. BR2-202), Hebei Province “Three Three Three Talents Program” (No. A201401002), Science and Technology Research Project of Higher Education Institutions in Hebei Province (No. QN2015230), Distinguished Young Scholars Fund of Hebei University (No. 2015JQ04), and Natural Science Foundation of Hebei Province (No. B2015201097).

(1) Huang, Y.; Zhou, G.; Zheng, L. S.; Liu, H. F.; Niu, X. F.; Fan, Y. B. Micro-/Nano-sized Hydroxyapatite Directs Differentiation of Rat Bone Marrow Derived Mesenchymal Stem Cells Towards an Osteoblast Lineage. Nanoscale 2012, 4, 2484−2490. (2) Yang, H.; Zeng, H. J.; Hao, L. J.; Zhao, N. R.; Du, C.; Liao, H.; Wang, Y. J. Effects of Hydroxyapatite Microparticle Morphology on Bone Mesenchymal Stem Cell Behavior. J. Mater. Chem. B 2014, 2, 4703−4710. (3) Hutmacher, D. W.; Schantz, J. T.; Lam, C. X. F.; Tan, K. C.; Lim, T. C. State of the Art and Future Directions of Scaffold-based Bone Engineering from a Biomaterials Perspective. J. Tissue Eng. Regener. Med. 2007, 1, 245−260. (4) Escudero, A.; Calvo, M. E.; Rivera-Fernández, S. R.; de la Fuente, J. M.; Ocaña, M. Microwave-assisted Synthesis of Biocompatible Europium-doped Calcium Hydroxyapatite and Fluoroapatite Luminescent Nanospindles Functionalized with Poly(Acrylic Acid). Langmuir 2013, 29, 1985−1994. (5) Kwon, B. J.; Kim, J. S.; Kim, Y. H.; Lee, M. H.; Baek, H. S.; Lee, D. H.; Kim, H. L.; Seo, H. J.; Lee, M. H.; Kwon, S. Y.; Koo, M. A.; Park, J. C. Biological Advantages of Porous Hydroxyapatite Scaffold Made by Solid Freeform Fabrication for Bone Tissue Regeneration. Artif. Organs 2013, 37, 663−670. (6) Zhou, H.; Lee, J. Nanoscale Hydroxyapatite Particles for Bone Tissue Engineering. Acta Biomater. 2011, 7, 2769−2781. (7) Wang, G.; Zheng, L.; Zhao, H.; Miao, J. Y.; Sun, C. H.; Liu, H.; Huang, Z.; Yu, X. Q.; Wang, J. Y.; Tao, X. T. Construction of a Fluorescent Nanostructured Chitosan-Hydroxyapatite Scaffold by Nanocrystallon Induced Biomimetic Mineralization and Its Cell Biocompatibility. ACS Appl. Mater. Interfaces 2011, 3, 1692−1701.

Figure 8. Schematic model of the DHAP contribution to the osteogenic differentiation of BMSCs.

BMSCs with an emphasis on ATP-induced cAMP/PKA pathways. The PO43− released from DHAP acts as a substratum for ATP synthesis in mitochondria, and then ATP was secreted and metabolized into adenosine, followed by activation of the cAMP/PKA pathway through the binding with A2b adenosine receptor. The activated-cAMP/PKA pathway promoted the mRNA level of osteogenic differentiation-related genes, such as BMP-2, Runx2, OCN, and Col-1, indicating the differentiation of BMSCs toward osteoblasts.

4. CONCLUSION In summary, we revealed a molecular mechanism by which defect-related HAP-released PO43− promoted osteogenesis of BMSCs with an emphasis on ATP-induced cAMP/PKA pathway. In this study, DHAP nanorods were taken up by BMSCs through macropinocytosis pathway and localized in 11269


Research Article

ACS Applied Materials & Interfaces (8) Lim, E.-K.; Keem, J. O.; Yun, H.-s.; Jung, J.; Chung, B. H. Smart Nanoprobes for the Detection of Alkaline Phosphatase Activity during Osteoblast Differentiation. Chem. Commun. 2015, 51, 3270−3272. (9) Zhang, C. M.; Lin, J. Defect-related Luminescent Materials: Synthesis, Emission Properties and Applications. Chem. Soc. Rev. 2012, 41, 7938−7961. (10) Pittenger, M. F.; Mackay, A. M.; Beck, S. C.; Jaiswal, R. K.; Douglas, R.; Mosca, J. D.; Moorman, M. A.; Simonetti, D. W.; Craig, S.; Marshak, D. R. Multilineage Potential of Adult Human Mesenchymal Stem Cells. Science 1999, 284, 143−147. (11) Liu, D. D.; Yi, C. Q.; Fong, C. C.; Jin, Q. H.; Wang, Z. K.; Yu, W. K.; Sun, D.; Zhao, J. L.; Yang, M. S. Activation of Multiple Signaling Pathways during the Differentiation of Mesenchymal Stem Cells Cultured in a Silicon Nanowire Microenvironment. Nanomedicine 2014, 10, 1153−1163. (12) Liu, H. H.; Peng, H. J.; Wu, Y.; Zhang, C.; Cai, Y. Z.; Xu, G. W.; Li, Q.; Chen, X.; Ji, J. F.; Zhang, Y. Z.; OuYang, H. W. The Promotion of Bone Regeneration by Nanofibrous Hydroxyapatite/Chitosan Scaffolds by Effects on Integrin-BMP/Smad Signaling Pathway in BMSCs. Biomaterials 2013, 34, 4404−4417. (13) Xia, L. G.; Lin, K. L.; Jiang, X. Q.; Xu, Y. J.; Zhang, M. L.; Chang, J.; Zhang, Z. Y. Enhanced Osteogenesis through Nanostructured Surface Design of Macroporous Hydroxyapatite Bioceramic Scaffolds via Activation of ERK and P38 MAPK Signaling Pathways. J. Mater. Chem. B 2013, 1, 5403−5416. (14) Abbracchio, M. P.; Saffrey, M. J.; Hopker, V.; Burnstock, G. Modulation of Astroglial Cell Proliferation by Analogues of Adenosine and ATP in Primary Cultures of Rat Striatum. Neuroscience 1994, 59, 67−76. (15) Wilden, P. A.; Agazie, Y. M.; Kaufman, R.; Halenda, S. P. ATPstimulated Smooth Muscle Cell Proliferation Requires Independent ERK and PI3K Signaling Pathways. Am. J. Physiol. 1998, 275, H1209− H1215. (16) Buravkova, L.; Rylova, Y.; Andreeva, E.; Kulikov, A.; Pogodina, M.; Zhivotovsky, B.; Gogvadze, V. Low ATP Level is Sufficient to Maintain the Uncommitted State of Multipotent Mesenchymal Stem Cells. Biochim. Biophys. Acta, Gen. Subj. 2013, 1830, 4418−4425. (17) Shih, Y. R. V.; Hwang, Y.; Phadke, A.; Kang, H.; Hwang, N. S.; Caro, E. J.; Nguyen, S.; Siu, M.; Theodorakis, E. A.; Gianneschi, N. C.; Vecchio, K. S.; Chien, S.; Lee, O. K.; Varghese, S. Calcium Phosphatebearing Matrices Induce Osteogenic Differentiation of Stem Cells through Adenosine Signaling. Proc. Natl. Acad. Sci. U. S. A. 2014, 111, 990−995. (18) Kang, H.; Shih, Y. R. V.; Varghese, S. Biomineralized Matrices Dominate Soluble Cues to Direct Osteogenic Differentiation of Human Mesenchymal Stem Cells through Adenosine Signaling. Biomacromolecules 2015, 16, 1050−1061. (19) Kang, H.; Shih, Y. R. V.; Hwang, Y.; Wen, C.; Rao, V.; Seo, T.; Varghese, S. Mineralized Gelatin Methacrylate-based Matrices Induce Osteogenic Differentiation of Human Induced Pluripotent Stem Cells. Acta Biomater. 2014, 10, 4961−4970. (20) Mediero, A.; Cronstein, B. N. Adenosine and Bone Metabolism. Trends Endocrinol. Metab. 2013, 24, 290−300. (21) Calker, D. V.; Müller, M.; Hamprecht, B. Adenosine Regulates via Two Different Types of Receptors, the Accumulation of Cyclic AMP in Cultured Brain Cells. J. Neurochem. 1979, 33, 999−1005. (22) Verzijl, D.; IJzerman, A. P. Functional Selectivity of Adenosine Receptor Ligands. Purinergic Signalling 2011, 7, 171−192. (23) Zhang, C.; Yang, J.; Quan, Z.; Yang, P.; Li, C.; Hou, Z.; Lin, J. Hydroxyapatite Nano-and Microcrystals with Multiform Morphologies: Controllable Synthesis and Luminescence Properties. Cryst. Growth Des. 2009, 9, 2725−2733. (24) Aspila, K.; Agemian, H.; Chau, A. A Semi-automated Method for the Determination of Inorganic, Organic and Total Phosphate in Sediments. Analyst 1976, 101, 187−197. (25) Zhang, J. C.; Sun, J.; Gu, G. Q.; Hao, X. H.; Liu, D. D.; Li, Y. P.; Qin, X. Y.; Wang, S. X. Effects of La3+ on Osteogenic and Adipogenic Differentiation of Primary Mouse Bone Marrow Stromal Cells. J. Rare Earths 2012, 30, 90−93.

(26) Liu, D. D.; Yi, C. Q.; Zhang, D. W.; Zhang, J. C.; Yang, M. S. Inhibition of Proliferation and Differentiation of Mesenchymal Stem Cells by Carboxylated Carbon Nanotubes. ACS Nano 2010, 4, 2185− 2195. (27) Ge, K.; Zhang, C.; Jia, G.; Ren, H.; Wang, J.; Tan, A.; Liang, X. J.; Zang, A.; Zhang, J. Defect-related Luminescent Mesoporous Silica Nanoparticles Employed for Novel Detectable Nanocarrier. ACS Appl. Mater. Interfaces 2015, 7, 10905−10914. (28) Khalil, I. A.; Kogure, K.; Akita, H.; Harashima, H. Uptake Pathways and Subsequent Intracellular Trafficking in Nonviral Gene Delivery. Pharmacol. Rev. 2006, 58, 32−45. (29) Zhang, Q.; Ge, K.; Duan, J. L.; Chen, S. Z.; Zhang, R.; Zhang, C. M.; Wang, S. X.; Zhang, J. C. Cerium Oxide Nanoparticles Protect Primary Mouse Bone Marrow Stromal Cells from Apoptosis Induced by Oxidative Stress. J. Nanopart. Res. 2014, 16, 2697. (30) Zhang, J. C.; Li, Y. P.; Sun, J.; Liu, C. L.; Zhang, D. W. Synergistic or Antagonistic Effect of MTE plus TF or Icariin from Epimedium Koreanum on the Proliferation and Differentiation of Primary Osteoblasts In Vitro. Biol. Trace Elem. Res. 2011, 143, 1746− 1757. (31) Yang, K. N.; Cao, W.; Hao, X. H.; Xue, X.; Zhao, J.; Liu, J.; Zhao, Y.; Meng, J.; Sun, B.; Zhang, J. C.; Liang, X. J. Metallofullerene Nanoparticles Promote Osteogenic Differentiation of Bone Marrow Stromal Cells through BMP Signaling Pathway. Nanoscale 2013, 5, 1205−1212. (32) Saldanha-Araujo, F.; Ferreira, F. I.; Palma, P. V.; Araujo, A. G.; Queiroz, R. H.; Covas, D. T.; Zago, M. A.; Panepucci, R. A. Mesenchymal Stromal Cells Up-regulate CD39 and Increase Adenosine Production to Suppress Activated T-lymphocytes. Stem Cell Res. 2011, 7, 66−74. (33) Pifferi, A.; Taroni, P.; Torricelli, A.; Valentini, G.; Mutti, P.; Ghislotti, G.; Zanghieri, L. Nanosecond Time-resolved Emission Spectroscopy from Silicon Implanted and Annealed SiO2 Layers. Appl. Phys. Lett. 1997, 70, 348−350. (34) Marsh, M.; McMahon, H. The Structural Era of Endocytosis. Science 1999, 285, 215−220. (35) Mukherjee, S.; Ghosh, R. N.; Maxfield, F. R. Endocytosis. Physiol. Rev. 1997, 77, 759−803. (36) Suzuki, H.; Toyooka, T.; Ibuki, Y. Simple and Easy Method to Evaluate Uptake Potential of Nanoparticles in Mammalian Cells Using a Flow Cytometric Light Scatter Analysis. Environ. Sci. Technol. 2007, 41, 3018−3024. (37) Meier, O.; Greber, U. F. Adenovirus Endocytosis. J. Gene Med. 2004, 6, S152−S163. (38) Kam, N. W. S.; Dai, H. Carbon Nanotubes as Intracellular Protein Transporters: Generality and Biological Functionality. J. Am. Chem. Soc. 2005, 127, 6021−6026. (39) Zhang, D.; Yi, C.; Zhang, J.; Chen, Y.; Yao, X.; Yang, M. The Effects of Carbon Nanotubes on the Proliferation and Differentiation of Primary Osteoblasts. Nanotechnology 2007, 18, 475102. (40) Gori, F.; Divieti, P.; Demay, M. B. Cloning and Characterization of a Novel WD-40 Repeat Protein that Dramatically Accelerates Osteoblastic Differentiation. J. Biol. Chem. 2001, 276, 46515−46522. (41) Liu, D. D.; Zhang, J. C.; Zhang, Q.; Wang, S. X.; Yang, M. S. TGF-β/BMP Signaling Pathway Is Involved in Cerium-Promoted Osteogenic Differentiation of Mesenchymal Stem Cells. J. Cell. Biochem. 2013, 114, 1105−1114. (42) Komori, T. Requisite Roles of Runx2 and Cbfb in Skeletal Development. J. Bone Miner. Metab. 2003, 21, 193−197. (43) Lee, J. H.; Shin, Y. C.; Jin, O. S.; Kang, S. H.; Hwang, Y. S.; Park, J. C.; Hong, S.; Han, D. W. Reduced Graphene Oxide-coated Hydroxyapatite Composites Stimulate Spontaneous Osteogenic Differentiation of Human Mesenchymal Stem Cells. Nanoscale 2015, 7, 11642−11651. (44) Bose, S.; French, S.; Evans, F. J.; Joubert, F.; Balaban, R. S. Metabolic Network Control of Oxidative Phosphorylation: Multiple Roles of Inorganic Phosphate. J. Biol. Chem. 2003, 278, 39155−39165. (45) Kam, N. W. S.; Liu, Z.; Dai, H. Carbon Nanotubes as Intracellular Transporters for Proteins and DNA: an Investigation of 11270


Research Article

ACS Applied Materials & Interfaces the Uptake Mechanism and Pathway. Angew. Chem. 2006, 118, 591− 595. (46) Carroll, S. H.; Wigner, N. A.; Kulkarni, N.; Johnston-Cox, H.; Gerstenfeld, L. C.; Ravid, K. A2B Adenosine Receptor Promotes Mesenchymal Stem Cell Differentiation to Osteoblasts and Bone Formation In Vivo. J. Biol. Chem. 2012, 287, 15718−15727.

11271


Defect-Related Luminescent Hydroxyapatite-Enhanced Osteogenic

Recommend Documents