Design of a temperature-responsive transcription terminator

Subscriber access provided by READING UNIV

Article

Design of a temperature-responsive transcription terminator Johanna Roßmanith, Mareen Weskamp, and Franz Narberhaus ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.7b00356 • Publication Date (Web): 30 Nov 2017 Downloaded from http://pubs.acs.org on December 2, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Synthetic Biology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31

ACS Synthetic Biology

1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Revision of ACS Synthetic Biology manuscript sb-2017-003568.R1

Design of a temperature-responsive transcription terminator

Johanna Roßmanith1, Mareen Weskamp1 and Franz Narberhaus1,*

1

Microbial Biology, Ruhr University Bochum, 44780 Bochum, Germany

* To whom correspondence should be addressed. Franz Narberhaus, Ruhr University Bochum, Microbial Biology, Universitätstrasse 150, NDEF 06/783, D-44801 Bochum, Germany.

Tel:

+49 (0)234

322

3100;

Fax:

+49 (0)234

3214620;

Email:

[email protected]

Keywords: gene expression, regulatory RNA, transcription termination, RNA thermometer, temperature, synthetic biology

ACS Paragon Plus Environment


Page 2 of 31

2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT RNA structures regulate various steps in gene expression. Transcription in bacteria is typically terminated by stable hairpin structures. Translation initiation can be modulated by metabolite-

or

temperature-sensitive

RNA

structures,

called

riboswitches

or

RNA thermometers (RNATs), respectively. RNATs control translation initiation by occlusion of the ribosome binding site at low temperatures. Increasing temperatures destabilize the RNA structure and facilitate ribosome access. In this study, we exploited temperatureresponsive RNAT structures to design regulatory elements that control transcription termination instead of translation initiation in Escherichia coli. In order to mimic the structure of factor-independent intrinsic terminators, naturally occurring RNAT hairpins were genetically engineered to be followed by a U-stretch. Functional temperature-responsive terminators (thermoterms) prevented mRNA synthesis at low temperatures but resumed transcription after a temperature upshift. The successful design of temperature-controlled terminators highlights the potential of RNA structures as versatile gene expression control elements.


Page 3 of 31


3 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

INTRODUCTION Transcription in bacteria is terminated by two different mechanisms. Rho-dependent terminators require the Rho protein for termination1-3, while intrinsic or Rho-independent terminators do not need additional protein factors. Rho is a hexameric protein with ATP-dependent RNA helicase-translocase activity that binds the RNA at cytosine-rich sequences with little secondary structure designated as rut (Rho utilization) sites.2, 4-6 After binding, ATP hydrolysis drives Rho along the RNA until it reaches the elongation complex. Rho is able to translocate the RNA polymerase (RNAP) forward on the DNA strand or pull the RNA away from the RNAP and unwind the RNA-DNA hybrid due to its helicase activity.2, 6, 7

About 80% of all termination events in Escherichia coli are due to intrinsic terminators.8

They are characterized by a GC-rich hairpin followed by a stretch of consecutive thymine (T) or uridine (U) residues at DNA or RNA level, respectively.9, 10 The transcribed poly(U) tail provides weak base-pairing by the UA RNA-DNA hybrid11, 12 and thereby induces pausing of the RNAP, thus providing sufficient time for the GC-rich hairpin to form.13-15 This terminates transcription by dissociation of the elongation complex. Transcription terminators are typically found at the 3‘end of mRNAs but they can also be located between open reading frames in bacterial operons resulting in differential regulation of the transcription unit. For instance, a weak terminator in the intergenic region of the E. coli dnaKJ operon between dnaK and dnaJ leads to an enrichment of monocistronic dnaK transcripts resulting in an about 10-fold excess of DnaK over DnaJ.16 Apart from transcriptional terminators, gene expression in bacteria is frequently regulated by various other structured mRNA segments. For instance, metabolite-binding RNAs called riboswitches are often found in bacterial 5’ untranslated regions (UTRs) upstream of genes regulating metabolic pathways.17 Further RNA-based regulators are RNA thermometers (RNATs), which sense the ambient temperature.18,

19

RNATs reside in 5’UTRs or in

intercistronic regions, where they control translation initiation by temperature-responsive RNA secondary structures. At low temperatures the Shine-Dalgarno (SD) sequence is



Page 4 of 31

4 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

sequestered in a stable hairpin by base pairing preventing translation of the mRNA. Upon a temperature upshift the RNA structure unfolds in a zipper-like manner and enables ribosome binding.20 Systems for conditional gene expression are valuable for numerous biotechnological applications. Bacterial expression systems based on protein factors like the classic Lambda and Lac repressor proteins have been established for tight and dose-dependent control of protein synthesis.21, 22 Recently, the focus has shifted from proteinaceous regulators to RNAbased regulators as tools for conditional gene expression. Apart from naturally occurring regulatory RNAs, synthetic riboregulators have been designed de novo and applied to gene regulation like single aptamers23-26, synthetic riboswitches27-32 or synthetic small RNAs.33-35 Since RNATs exhibit a simple structure and mode of action, they hold a lot of promise in synthetic biology. Inspired by nature, synthetic RNATs that control translation initiation have been engineered.36-38 RNATs can also be applied to control temperature-dependent mRNA cleavage when combined with an RNaseE cleavage site39 or in concert with a ribozyme40, and ligand-induced gene regulation when combined with a riboswitch.41 All known natural RNATs control translation initiation. In the present study, we explored the possibility whether RNATs can control transcription termination instead of translation initiation. RNATs and intrinsic terminators exhibit similar characteristics as they both consist of a hairpin that is stable enough to prevent binding of the ribosome or read-through by the RNAP, respectively. Thus, it should be possible to repurpose an RNAT hairpin to control transcription termination. We designed four temperature-responsive terminator candidates and analyzed them in a complementary set of in vivo and in vitro experiments. One of the constructs, called thermoterm, was indeed able to confer regulation of transcription via temperature-dependent unfolding of the terminator structure.


Page 5 of 31


5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

RESULTS AND DISCUSSION Design strategy for temperature-responsive transcription terminators Classical RNATs regulate translation by controlling access to the SD sequence via temperature-responsive RNA structures (Fig. 1a).19,

20

To design RNA thermosensors

capable of regulating transcription, we took advantage of naturally existing RNAT hairpins and altered their sequence and structure in order to mimic Rho-independent terminators. The strategy is based on the concept that transcription is terminated prematurely at low temperatures due to the RNA hairpin, which imitates a terminator structure (Fig. 1b). After a temperature upshift, unfolding of the RNA hairpin is expected to prevent formation of the terminator structure thus allowing synthesis of the full-length mRNA. To construct such temperature-responsive terminators (thermoterms), we chose three of the structurally and functionally best characterized RNATs with different ∆G values (Fig. S1) and fused them to a poly(T) tail coding for 10 subsequent uridines commonly located at the 3’end of Rho-independent terminators.9, 10 The attached poly(U) tail replaced the translational start codon in order to exclude translation initiation from the former SD sequence. Instead, translation of the engineered mRNA is initiated from a plasmid-encoded SD sequence and translational start codon. Four temperature-sensitive terminator candidates were constructed on the basis of previously well-characterized RNAT scaffolds. Two variants derived from the agsA fourU RNAT from Salmonella enterica42 (henceforth referred to as 4U), namely the entire 5’UTR (4U long) or a shorter variant comprised of only the second hairpin of the RNAT (4U), which is functional as thermosensor on its own. Furthermore, we used the temperatureresponsive hairpin of the hspA 5’UTR from Bradyrhizobium japonicum43, 44 (referred to as ROSE) and the thermosensory hairpin of the ibpA RNAT from Pseudomonas putida45 (referred to as ibpA). The added poly(U) tail at the 3’end of all these RNAT hairpins resulted in the putative thermoterm constructs 4U long Term, 4U Term, ibpA Term and ROSE Term. The strong terminator 1 of the ribosomal RNA operon (rrnB T1) from E. coli46 served as



Page 6 of 31

6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

control expected to be unresponsive to temperature (sequences and predicted structures are given in Figure S1).

The ibpA terminator is temperature-responsive and regulates transcription in vivo In order to investigate the regulatory potential of the designed terminators, reporter fusions to bgaB, coding for a heat-stable β-galactosidase, were constructed in pBAD2-bgaB47 and β-galactosidase activity was monitored at 30 °C and after a heat shock to 42 °C in E. coli (Fig. 2). The terminator 1 of the E. coli rrnB operon served as control for a functional terminator. As expected, the fusion of rrnB T1 to bgaB did not show any β-galactosidase activity neither at 30 °C nor after a shift to 42 °C. Consistent with previous reports, the RNATs 4U long, 4U, ROSE and ibpA exhibited a clear increase in reporter-gene activity after a heat shock to 42 °C when ribosome access to the bgaB mRNA is allowed by the melted RNAT structure. Of the four designed terminator constructs, only the ibpA Term-bgaB fusion conferred temperature-dependent regulation (depicted in bold letters in Fig. 2) in contrast to 4U long Term, 4U Term and ROSE Term, which showed equally high β-galactosidase activities at 30 and 42 °C suggesting that transcript formation and subsequent translation from the plasmid-provided SD sequence were undisturbed. The ibpA Term fusion inhibited β-galactosidase activity at 30 °C and promoted reporter gene activity at 42 °C as effectively as the ibpA RNAT suggesting the functionality of the ibpA Term fusion as a regulatory control element. To elucidate whether the constructed terminator candidates regulate transcription instead of translation, we determined transcript and protein levels before and after heat shock (Fig. 3). In this line of experiments, we used E. coli cells harboring translational fusions to gfp. Cultures were grown at 30 °C or heat-shocked to 42 °C prior to isolation of total RNA and protein extraction. Transcript amounts were detected with a probe directed against the gfp mRNA and protein amounts were determined with GFP antisera. Neither gfp transcript nor GFP protein were found for the rrnBT1 control due to its strong terminator function


Page 7 of 31


7 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(Fig. 3). Consistent with their function as translational control elements, gfp transcript levels of the RNATs 4U long, 4U, and ibpA were comparable at both temperatures (Fig. 3a), whereas GFP protein levels clearly increased after a shift to 42 °C (Fig. 3b). Overall low expression of the ROSE RNAT resulted in undetectable GFP protein. As anticipated from the corresponding bgaB fusions (Fig. 2), the putative transcription terminators 4U long Term, 4U Term and ROSE Term did not confer temperature-dependent regulation on mRNA or protein level (Fig. 3). However, the ibpA Term construct mediated a considerable increase of gfp transcript after heat shock and also a corresponding upregulation of GFP protein (indicated by bold letters to the right of Fig. 3a and b). To exclude that the elevated transcript amounts of the ibpA Term construct at 42°C were due to increased mRNA stability, we measured the half-lives of the ibpA RNAT and ibpA Term constructs at 30 and 42°C after addition of rifampicin (Fig. S2). The half-lives of both transcripts and at both temperatures were between 1 and 2 min, which is very typical of bacterial mRNAs. The results from the bgaB and gfp of reporter gene experiments suggest that ibpA Term controls transcription instead of translation in a temperature-dependent manner, as desired by our design strategy. The straight-forward rationale of our design was that RNAT hairpins (which control translation) can be repurposed to control transcription termination if the translation initiation region is replaced by several consecutive uridines, as in canonical factor-independent terminators. As scaffolds we used heat-labile hairpin structures of different stability. It has been suggested that a hairpin with a free energy of at least -6 kcal/mol inhibits translation efficiently.48, 49 However, several RNATs repress translation although they fold into structures with lower free energy.19,

50

Most RNATs have a complex architecture with several

stemloops, of which only the final one is responsible for translational control.42, 43, 45 This is also the case for the ibpA RNAT.45 Considering only the sequences and predicted structures of all tested constructs, 4U long Term and 4U Term were the most promising terminator candidates. Both structures



Page 8 of 31

8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

consist of a stem of 14 bp and harbor an end-standing loop with a tetranucleotide sequence. Surprisingly, both constructs were unable to confer temperature-dependent gene expression, and ibpA Term was the best performing candidate in both our reporter gene assays although it deviates from the canonical picture of an optimal E. coli transcription terminator.51-53 The most striking difference between ibpA Term and the other candidates is the calculated free energy. The value for ibpA Term is -3.8 kcal/mol, for ROSE it is -6.0 kcal/mol, and for 4U it is -9.7 kcal/mol. The average free energy observed for E. coli terminators is -10 kcal/mol. Nonetheless, terminators with rather high free energies are rare and there are more terminators distributed in the range of lower ∆G values ranging from -4 to -8 kcal/mol than in higher ∆G values.53 Typical terminators vary in stem length from 5 to 17 bp with an average length of 8 bp.51, 54, 55 The nucleotides in the terminator loop range from 3 to 12, but in about 70% of all cases consist of 4 nucleotides. The sequences GAAA and TTCG are most prominent in the loop54 and these tetranucleotides are assumed to stabilize the RNA hairpin.56, 57 A comparison of these statistical parameters with the designed ibpA thermoterm reveals similarities and differences between the ibpA hairpin and a typical intrinsic terminator. The ibpA hairpin comprises a stem of 7 bp and is therefore just below the average stem length of 8 bp. In addition, it contains an unpaired G, most likely contributing to thermolability as shown for other RNATs.44 The loop consists of 5 nucleotides and does not contain the two most frequent tetranucleotide sequences. The majority of the examined terminators in E. coli form a GC pair at the end of the loop51, as it is the case for ibpA Term. The T-stretch, following the terminator hairpin, is in average 10 thymidine residues in E. coli51 and similar to the T-stretch fused to the ibpA hairpin. Although the poly(U) tail of ibpA Term structure contains several

other

nucleotides

(UUAUGACCUUUUUUUUUU,

Fig. S3a),

it

meets

the

requirements of at least two uridines immediately downstream to the hairpin.58, 59 To address whether the performance of ibpA Term can be further improved by a continuous poly(U) tail, we deleted a stretch of six nucleotides resulting in variant ibpA Term ∆6


Page 9 of 31


9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(Fig. S3a). Northern blot analysis demonstrated that both variants, ibpA Term and ibpA Term ∆6, inhibited transcription of the gfp mRNA at 30 °C equally well and allowed elongation of the mRNA at 42 °C (Fig. S3b). Comparable results were observed at protein level by Western blot analysis (Fig. S3c) demonstrating that ibpA Term and the ∆6 variant regulate transcription equally effective.

Comparative analysis of single point mutations on RNA thermometer and transcription terminator activity In order to examine the impact of RNA hairpin stability on terminator function, stabilizing (rep) and destabilizing (derep) point mutations were introduced into the ibpA Term structure (Fig. 4a). The same mutations were introduced into the ibpA RNAT hairpin as a control. Exchange of a GU pair against a stable GC pair and deletion of G12 resulted in a perfectly paired RNA hairpin (variant U11C/∆G12) with a significantly increased free energy from -3.8 kcal/mol to -10.5 kcal/mol (Fig. 4a). To destabilize the ibpA hairpin, three different variants were designed: a stable GC pair was replaced by a weaker GA pair (variant C13A), an internal loop was introduced by replacing the GC and AU pair against GG and AA mismatches (variant C13G/U14A), and a second bulged G was inserted into the ibpA sequence (variant +G12/13). As expected for a translational regulator, transcript levels were not affected by the introduced mutations into the ibpA RNAT (Fig. 4b, left panel). On protein level, no GFP was detected for the ibpA rep variant confirming that the stabilized RNA structure strictly prevents translation initiation (Fig. 4c, left panel). All destabilized variants produced elevated GFP protein levels at heat shock temperature, and mutations C13G/U14A and +G12/13 even resulted in GFP production at 30 °C. Introduction of the stabilizing U11C/∆G12 mutation into the transcription terminator ibpA Term did not change the expression level much and retained the temperature responsiveness (Fig. 4b and c, right panels), which suggests that the RNA hairpin is sufficiently strong to block translation in case of the RNAT but not stable enough to efficiently



Page 10 of 31

10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

terminate transcription at 42 °C. The weaker structures of all three destabilized terminators were still able to control transcription termination in a temperature-dependent manner. However, variants C13G/U14A and +G12/13 were less efficient in terminating transcription as they produced considerably higher gfp transcript and GFP protein levels at 30 °C in comparison to the ibpA Term WT construct. These results suggest that the regulatory function of the ibpA Term structure cannot be completely abolished by destabilizing point mutations in the hairpin. Overall, the results reveal that the structural requirements for functional translation inhibitors and transcription terminators are different and deserve further comparative analyses.

The ibpA thermoterm is functional in different genetic contexts Most transcriptional terminators reside downstream of open reading frames in 3’UTRs, which prompted us to ask whether the regulatory potential of ibpA Term is maintained when it is transferred from the 5’end of a transcript to another genetic location. It recently turned out that the context dependence of engineered regulatory devices is limiting their application. Many regulatory modules failed when introduced into a foreign genetic location.60,

61

For

instance, a hammerhead ribozyme fused to the tetracycline aptamer was shown to effectively regulate mRNA cleavage of a gfp reporter mRNA in yeast.62 However, regulation was abolished when the same construct was used to control expression of a luciferase-reporter gene in mammalian cells. Only a few engineered regulators are sufficiently robust and can be transferred to a different genetic context. For instance, a set of theophylline-binding riboswitches was constructed and successfully tested for regulatory activity in different bacterial species including Gram-negative and Gram-positive bacteria, like

E. coli,

B. subtilis,

Streptococcus pyogenes

and

the

plant

pathogen

Agrobacterium tumefaciens. In every organism at least one of the five riboswitches was functional.63


Page 11 of 31


11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

To assay terminator structures in another context and to provide sufficient distance from the transcription start site, 200 base pairs of the multiple cloning site of pK18 were cloned via NheI restriction sites in front of the control terminator rrnB T1 and the thermoterm ibpA Term (Fig. 5a). E. coli cells harboring the translational gfp fusions were grown to exponential growth phase at 30 °C. Transcription was induced with 0.01% L-arabinose and half of the culture was heat-shocked to 42 °C for 30 minutes prior to RNA and protein isolation. As expected, the control terminator rrnB T1 inhibited transcription at 30 and 42 °C regardless of its position (Fig. 5b and c). Importantly, the ibpA Term retained its function as temperature-responsive transcription terminator when moved to another location suggesting that it can be applied in various genetic contexts.

The ibpA hairpin unfolds after a temperature upshift in vitro The data above suggested a heat-induced opening of the ibpA Term structure. To validate that the regulation observed in vivo is based on a temperature-dependent alteration of the RNA structure, we subjected it to structure probing experiments. In vitro transcribed RNA of the ibpA RNAT and ibpA Term were probed at 30 and 42 °C with RNases T1 and T2, which cut preferentially single-stranded guanines and single-stranded adenines, respectively, and nuclease S1, which cuts 3’ of unpaired nucleotides. The probing data were consistent with a secondary structure comprised of a short stem-loop structure as depicted in Fig. 6a. In general, the stem seems to be rather labile as nuclease S1 cuts occurred throughout the structure (Fig. 6b). Cleavage by RNase T1 confirmed melting of the ibpA hairpin with rising temperatures for both the RNAT and the thermoterm. Guanines G12, G15, G23, G24, and G26 (marked with arrows in Fig. 6a and with asterisks in Fig. 6b), which are located in the stem, became accessible for RNase T1 at 42 °C. Heat-induced cleavage of the adenine at position 25 by RNase T2 provided further evidence for an unfolding of the hairpin at 42 °C. In conclusion, we demonstrate that a translational control element can be re-engineered to function as a transcription terminator. Minor modifications at the 3’end of the ibpA RNAT



Page 12 of 31

12 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

from P. putida45 were sufficient to mimic an intrinsic terminator. To our knowledge, ibpA Term is the first temperature-controllable transcription terminator able to prematurely terminate transcription of various reporter genes at low temperatures and allowing readthroughout after a heat shock. Structure probing confirmed that this activity is due to a conformational transition from a closed to an open RNA structure. As desired by our design strategy, the mode of action of ibpA Term is comparable to that of the ibpA RNAT but the regulatory output has been shifted from the translational level to the transcriptional level. In summary, ibpA Term is the first thermosensor that directly controls transcription termination.


Page 13 of 31


13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

METHODS Bacterial growth conditions E. coli DH5α cells (supE44, ∆lacU169 (ψ80lacZ∆M15), hsdR17, recA1, gyrA96, thi1, relA1)64 were cultivated in LB medium at indicated temperatures. Media were supplemented with ampicillin (Amp, 150 µg/ml) if required. For induction of the PBAD promoter in strains carrying translational reporter-gene fusions, L-arabinose was added to a final concentration of 0.01% (w/v).

Plasmid construction Oligonucleotides and plasmids used in this study are listed in Tables S1 and S2, respectively. Recombinant DNA work was performed according to standard protocols.65 The correct nucleotide sequences of all constructs were confirmed by automated sequencing (Eurofins, Martinsried, Germany). Enzymes were obtained from Thermo Scientific (St. LeonRot, Germany). To construct translational reporter-gene fusions, the terminator of the ribosomal RNA operon (rrnB T1), the agsA (4U long) and mini agsA (4U) 5’UTRs from S. enterica, parts of the ibpA 5’UTR (ibpA) from P. putida and parts of the hspA 5’UTR (ROSE) from B. japonicum were amplified by PCR from chromosomal DNA using the corresponding primer pairs listed in Table S1. The PCR fragments were cloned via primer-derived NheI and EcoRI or XhoI restriction sites into pBO3390 resulting in translational fusions to bgaB or into pBO4391 resulting in translational fusions to gfp, respectively. In order to construct stabilized (U11C/∆G12) and destabilized variants (C13A; C13G/U14A; +G12/13), site-directed mutagenesis was performed with mutagenic primers listed in Table S1. In order to construct variants with an insertion of 200 nt upstream of the 5’UTR, 200 bp of the multiple cloning site from pK1866 were amplified with NheI restriction sites and inserted blunt end into the NheI restriction site of pBO4330 and pBO4388 resulting in pBO6001 and pBO6003, respectively. Plasmids for run-off transcription for structure probing experiments were constructed by blunt end cloning of the 5’UTRs amplified with



Page 14 of 31

14 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

primers

adding

the

T7-promoter

sequence

at

the

5’ end

(GAAATTAATACGACTCACTATAGGG) and an EcoRV site at the 3’end into SmaI site of pK1866.The sequences and structures for all constructed RNATs and thermoterms are provided in figure S1.

β-galactosidase activity assay E. coli DH5α cells carrying plasmids with translational fusions to bgaB were grown overnight in 5 ml LB at 30 °C. 25 ml LB medium with ampicillin were pre-warmed to 30 °C and inoculated with the overnight culture to an optical density (OD600) of 0.05. When cells reached OD600 of 0.5 transcription from PBAD promoter was induced with 0.01% L-arabinose and 10 ml of the culture were transferred to pre-warmed flasks at 42 °C. 30 minutes after heat shock samples were taken and used for β-galactosidase measurements as described previously.67

RNA preparation Total RNA of cultured bacteria was isolated using the RNA-preparation method described in reference68 with minor modifications. 0.5 ml stop buffer (100 mM Tris-HCL, pH8, 200 mM β-mercaptoethanol, 5 mM EDTA) was added to 2 ml bacterial culture. Cells were harvested and washed with 1 ml washing buffer (10 mM Tris-HCL, pH8, 100 mM NaCl, 1 mM EDTA). The following steps of the RNA preparation were performed as described. After the precipitation RNA concentrations were measured with a NanoDrop spectrophotometer ND-1000 (peqlab, Erlangen, Germany).

Northern blot analysis Northern blot analysis was performed as described previously.47 For detection of gfp transcript a 286 bp fragment was amplified from pBO4391. RNA probes were derived from


Page 15 of 31


15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

in vitro transcription with digoxigenin (DIG) labeled nucleotides (Roche, Mannheim, Germany).

Preparation of protein extracts and Western blot analysis E. coli cells harboring the pBAD2-gfp plasmids were grown overnight in 5 ml LB medium at 30° C. 25 ml LB medium with ampicillin were pre-warmed to 30 °C and inoculated with the overnight culture to OD600 of 0.05. After growth to OD600 of 0.5 transcription was induced with 0.01% L-arabinose and cells were heat-shocked at 42 °C. After 30 minutes 1 ml of the culture was harvested (1 min, 13.000 rpm). Pellets were resuspended in TE buffer (10 mM Tris, pH 8, 1 mM EDTA; 100 µl TE buffer per optical density OD600 of 0.5) and mixed with protein-sample buffer (final concentrations of 2% SDS (w/v), 0.1% (w/v) bromophenol blue, 10% glycerol (v/v), 1% β-mercaptoethanol, 50 mM Tris/HCl, pH 6.8). After incubation for 5 min at 95 °C, samples were centrifuged and separated via SDS-PAGE. Western transfer was performed by tank blotting onto a nitrocellulose membrane (HybondTM-C Extra, GE Healthcare, Munich, Germany). GFP antibody (ABIN129570, antibodies-online GmbH, Aachen) was used in an 1:10,000 dilution and secondary antibody goat anti rabbit-HRP conjugate (Bio-Rad, Munich, Germany) in 1:3,000 dilution. Luminescence signals were detected using Luminata Forte Western HRP (Merck, Darmstadt, Germany) substrate and the ChemiImager Ready (Alpha Innotec, San Leandro, USA).

Enzymatic RNA structure probing RNAs for structure probing experiments were synthesized in vitro by run-off transcription with T7 RNA polymerase from EcoRV linearized plasmids (listed in supplementary Table S2). The in vitro transcribed RNA was purified and dephosphorylated with CIP (Calf intestinal phosphatase, Thermo Scientific, Waltham, USA). The RNA was labelled at the 5’end as described.69 Partial digestions with ribonuclease T1 (0.00125 U) (Thermo Scientific, Waltham, USA), T2 (0.025 U) (MoBiTec, Göttingen, Germany) and nuclease S1 (0.1 U)



Page 16 of 31

16 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(Thermo Scientific, Waltham, USA) were performed according to reference42 at indicated temperatures. For digestion with RNases T1 and T2, 5x TN buffer (100 mM Tris acetate, pH 7, 500 mM NaCl) was used. Digestion with nuclease S1 was performed using the supplied 5x reaction buffer. An alkaline hydrolysis ladder was prepared as described in.69


Page 17 of 31


17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

SUPPORTING INFORMATION Supporting information available: Supplementary Figure S1, S2 and S3; Supplementary Tables 1 and 2

ABBREVIATIONS OD: optical density RNAP: RNA polymerase RNAT: RNA thermometer SD: Shine-Dalgarno sequence UTR: untranslated region WT: wild type

ACKNOWLEDGEMENT We thank Ursula Aschke-Sonnenborn for excellent technical assistance, Erin Murphy (Ohio University) for advice, and Lisa-Marie Bittner, Linna Danne and Jessica Borgmann for critical reading of the manuscript.

FUNDING This work was supported by a grant from the German Research Foundation (NA 240/10-1) to F.N. and by a fellowship from the Studienstiftung des Deutschen Volkes to J.R.



Page 18 of 31

18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

CONFLICT OF INTEREST DISCLOSURE The authors declare no competing financial interest.

AUTHOR CONTRIBUTIONS J.R. designed and performed experiments, analysed data and wrote the manuscript. M.W. performed experiments. F.N. designed experiments, analysed data and wrote the manuscript.


Page 19 of 31


19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

REFERENCES 1. 2. 3.

4.

5.

6.

7. 8.

9. 10. 11. 12.

13. 14. 15.

16.

17. 18. 19. 20. 21. 22.

23. 24.

Ciampi, M. S. (2006) Rho-dependent terminators and transcription termination. Microbiology 152, 2515-2528. Epshtein, V., Dutta, D., Wade, J., and Nudler, E. (2010) An allosteric mechanism of Rhodependent transcription termination. Nature 463, 245-249. Richardson, L. V., and Richardson, J. P. (1996) Rho-dependent termination of transcription is governed primarily by the upstream Rho utilization (rut) sequences of a terminator. J Biol Chem 271, 21597-21603. Hart, C. M., and Roberts, J. W. (1991) Rho-dependent transcription termination. Characterization of the requirement for cytidine in the nascent transcript. J Biol Chem 266, 24140-24148. McSwiggen, J. A., Bear, D. G., and von Hippel, P. H. (1988) Interactions of Escherichia coli transcription termination factor rho with RNA. I. Binding stoichiometries and free energies. J Mol Biol 199, 609-622. Grylak-Mielnicka, A., Bidnenko, V., Bardowski, J., and Bidnenko, E. (2016) Transcription termination factor Rho: a hub linking diverse physiological processes in bacteria. Microbiology 162, 433-447. Mooney, R. A., Davis, S. E., Peters, J. M., Rowland, J. L., Ansari, A. Z., and Landick, R. (2009) Regulator trafficking on bacterial transcription units in vivo. Mol Cell 33, 97-108. Peters, J. M., Mooney, R. A., Kuan, P. F., Rowland, J. L., Keles, S., and Landick, R. (2009) Rho directs widespread termination of intragenic and stable RNA transcription. Proc Natl Acad Sci U S A 106, 15406-15411. Ray-Soni, A., Bellecourt, M. J., and Landick, R. (2016) Mechanisms of bacterial transcription termination: all good things must end. Annu Rev Biochem. Wilson, K. S., and von Hippel, P. H. (1995) Transcription termination at intrinsic terminators: the role of the RNA hairpin. Proc Natl Acad Sci U S A 92, 8793-8797. Huang, Y., Weng, X., and Russu, I. M. (2010) Structural energetics of the adenine tract from an intrinsic transcription terminator. J Mol Biol 397, 677-688. Martin, F. H., and Tinoco, I., Jr. (1980) DNA-RNA hybrid duplexes containing oligo(dA:rU) sequences are exceptionally unstable and may facilitate termination of transcription. Nucleic Acids Res 8, 2295-2299. Gusarov, I., and Nudler, E. (1999) The mechanism of intrinsic transcription termination. Mol Cell 3, 495-504. Macdonald, L. E., Zhou, Y., and McAllister, W. T. (1993) Termination and slippage by bacteriophage T7 RNA polymerase. J Mol Biol 232, 1030-1047. Shundrovsky, A., Santangelo, T. J., Roberts, J. W., and Wang, M. D. (2004) A singlemolecule technique to study sequence-dependent transcription pausing. Biophys J 87, 39453953. Bardwell, J. C., Tilly, K., Craig, E., King, J., Zylicz, M., and Georgopoulos, C. (1986) The nucleotide sequence of the Escherichia coli K12 dnaJ+ gene. A gene that encodes a heat shock protein. J Biol Chem 261, 1782-1785. Peselis, A., and Serganov, A. (2014) Themes and variations in riboswitch structure and function. Biochim Biophys Acta 1839, 908-918. Righetti, F., and Narberhaus, F. (2014) How to find RNA thermometers. Front Cell Infect Microbiol 4, 132. Krajewski, S. S., and Narberhaus, F. (2014) Temperature-driven differential gene expression by RNA thermosensors. Biochim Biophys Acta. 1839, 978-988. Kortmann, J., and Narberhaus, F. (2012) Bacterial RNA thermometers: molecular zippers and switches. Nat Rev Microbiol. 10, 255-265. Ptashne, M. (2005) Regulation of transcription: from lambda to eukaryotes. Trends Biochem Sci 30, 275-279. Wilson, C. J., Zhan, H., Swint-Kruse, L., and Matthews, K. S. (2007) The lactose repressor system: paradigms for regulation, allosteric behavior and protein folding. Cell Mol Life Sci 64, 3-16. Berens, C., Thain, A., and Schroeder, R. (2001) A tetracycline-binding RNA aptamer. Bioorg Med Chem 9, 2549-2556. Jenison, R. D., Gill, S. C., Pardi, A., and Polisky, B. (1994) High-resolution molecular discrimination by RNA. Science 263, 1425-1429.



Page 20 of 31

20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

25.

26. 27.

28.

29.

30.

31.

32. 33. 34. 35.

36. 37. 38. 39. 40.

41. 42. 43.

44. 45. 46.

47.

Weigand, J. E., Sanchez, M., Gunnesch, E. B., Zeiher, S., Schroeder, R., and Suess, B. (2008) Screening for engineered neomycin riboswitches that control translation initiation. RNA 14, 89-97. Harvey, I., Garneau, P., and Pelletier, J. (2002) Inhibition of translation by RNA-small molecule interactions. RNA 8, 452-463. Rudolph, M. M., Vockenhuber, M. P., and Suess, B. (2013) Synthetic riboswitches for the conditional control of gene expression in Streptomyces coelicolor. Microbiology 159, 14161422. Rudolph, M. M., Vockenhuber, M. P., and Suess, B. (2015) Conditional control of gene expression by synthetic riboswitches in Streptomyces coelicolor. Methods Enzymol 550, 283299. Suess, B., Fink, B., Berens, C., Stentz, R., and Hillen, W. (2004) A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Res 32, 1610-1614. Wachsmuth, M., Findeiss, S., Weissheimer, N., Stadler, P. F., and Mörl, M. (2013) De novo design of a synthetic riboswitch that regulates transcription termination. Nucleic Acids Res 41, 2541-2551. Xiao, H., Edwards, T. E., and Ferré-D'Amaré, A. R. (2008) Structural basis for specific, highaffinity tetracycline binding by an in vitro evolved aptamer and artificial riboswitch. Chem Biol 15, 1125-1137. Beisel, C. L., and Smolke, C. D. (2009) Design principles for riboswitch function. PLoS Comput Biol 5, e1000363. Chappell, J., Takahashi, M. K., and Lucks, J. B. (2015) Creating small transcription activating RNAs. Nat Chem Biol 11, 214-220. Jin, Y., Wu, J., Li, Y., Cai, Z., and Huang, J. D. (2013) Modification of the RpoS network with a synthetic small RNA. Nucleic Acids Res 41, 8332-8340. Meyer, S., Chappell, J., Sankar, S., Chew, R., and Lucks, J. B. (2016) Improving fold activation of small transcription activating RNAs (STARs) with rational RNA engineering strategies. Biotechnol Bioeng 113, 216-225. Neupert, J., Karcher, D., and Bock, R. (2008) Design of simple synthetic RNA thermometers for temperature-controlled gene expression in Escherichia coli. Nucleic Acids Res 36, e124. Waldminghaus, T., Kortmann, J., Gesing, S., and Narberhaus, F. (2008) Generation of synthetic RNA-based thermosensors. Biol Chem 389, 1319-1326. Sen, S., Apurva, D., Satija, R., Siegal, D., and Murray, R. M. (2017) Design of a Toolbox of RNA Thermometers. ACS Synth Biol 6, 1461-1470. Hoynes-O'Connor, A., Hinman, K., Kirchner, L., and Moon, T. S. (2015) De novo design of heat-repressible RNA thermosensors in E. coli. Nucleic Acids Res 43, 6166-6179. Saragliadis, A., Krajewski, S. S., Rehm, C., Narberhaus, F., and Hartig, J. S. (2013) Thermozymes: Synthetic RNA thermometers based on ribozyme activity. RNA Biol 10, 10101016. Roßmanith, J., and Narberhaus, F. (2016) Exploring the modular nature of riboswitches and RNA thermometers. Nucleic Acids Res 44, 5410-5423. Waldminghaus, T., Heidrich, N., Brantl, S., and Narberhaus, F. (2007) FourU: a novel type of RNA thermometer in Salmonella. Mol Microbiol. 65, 413-424. Nocker, A., Hausherr, T., Balsiger, S., Krstulovic, N. P., Hennecke, H., and Narberhaus, F. (2001) A mRNA-based thermosensor controls expression of rhizobial heat shock genes. Nucleic Acids Res. 29, 4800-4807. Chowdhury, S., Maris, C., Allain, F. H., and Narberhaus, F. (2006) Molecular basis for temperature sensing by an RNA thermometer. EMBO J. 25, 2487-2497. Krajewski, S. S., Nagel, M., and Narberhaus, F. (2013) Short ROSE-like RNA thermometers control IbpA synthesis in Pseudomonas species. PLoS One 8, e65168. Uptain, S. M., and Chamberlin, M. J. (1997) Escherichia coli RNA polymerase terminates transcription efficiently at rho-independent terminators on single-stranded DNA templates. Proc Natl Acad Sci U S A 94, 13548-13553. Klinkert, B., Cimdins, A., Gaubig, L. C., Roßmanith, J., Aschke-Sonnenborn, U., and Narberhaus, F. (2012) Thermogenetic tools to monitor temperature-dependent gene expression in bacteria. J Biotechnol. 160, 55-63.


Page 21 of 31


21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

48.

49. 50.

51. 52.

53.

54.

55.

56. 57. 58. 59. 60.

61. 62. 63.

64. 65. 66. 67. 68.

de Smit, M. H., and van Duin, J. (1990) Secondary structure of the ribosome binding site determines translational efficiency: A quantitative analysis. Proc Natl Acad Sci U S A 87, 7668-7672. de Smit, M. H., and van Duin, J. (1994) Translational initiation on structured messengers. Another role for the Shine-Dalgarno interaction. J Mol Biol 235, 173-184. Kortmann, J., Sczodrok, S., Rinnenthal, J., Schwalbe, H., and Narberhaus, F. (2011) Translation on demand by a simple RNA-based thermosensor. Nucleic Acids Res. 39, 28552868. de Hoon, M. J., Makita, Y., Nakai, K., and Miyano, S. (2005) Prediction of transcriptional terminators in Bacillus subtilis and related species. PLoS Comput Biol 1, e25. Gama-Castro, S., Salgado, H., Peralta-Gil, M., Santos-Zavaleta, A., Muñiz-Rascado, L., Solano-Lira, H., Jimenez-Jacinto, V., Weiss, V., García-Sotelo, J. S., López-Fuentes, A., Porrón-Sotelo, L., Alquicira-Hernández, S., Medina-Rivera, A., Martínez-Flores, I., AlquiciraHernández, K., Martínez-Adame, R., Bonavides-Martínez, C., Miranda-Ríos, J., Huerta, A. M., Mendoza-Vargas, A., Collado-Torres, L., Taboada, B., Vega-Alvarado, L., Olvera, M., Olvera, L., Grande, R., Morett, E., and Collado-Vides, J. (2011) RegulonDB version 7.0: transcriptional regulation of Escherichia coli K-12 integrated within genetic sensory response units (Gensor Units). Nucleic Acids Res 39, D98-105. Lesnik, E. A., Sampath, R., Levene, H. B., Henderson, T. J., McNeil, J. A., and Ecker, D. J. (2001) Prediction of rho-independent transcriptional terminators in Escherichia coli. Nucleic Acids Res 29, 3583-3594. Chen, Y. J., Liu, P., Nielsen, A. A., Brophy, J. A., Clancy, K., Peterson, T., and Voigt, C. A. (2013) Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nat Methods 10, 659-664. Cambray, G., Guimaraes, J. C., Mutalik, V. K., Lam, C., Mai, Q. A., Thimmaiah, T., Carothers, J. M., Arkin, A. P., and Endy, D. (2013) Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Res 41, 5139-5148. Antao, V. P., Lai, S. Y., and Tinoco, I., Jr. (1991) A thermodynamic study of unusually stable RNA and DNA hairpins. Nucleic Acids Res 19, 5901-5905. Antao, V. P., and Tinoco, I., Jr. (1992) Thermodynamic parameters for loop formation in RNA and DNA hairpin tetraloops. Nucleic Acids Res 20, 819-824. Epshtein, V., Cardinale, C. J., Ruckenstein, A. E., Borukhov, S., and Nudler, E. (2007) An allosteric path to transcription termination. Mol Cell 28, 991-1001. Larson, M. H., Greenleaf, W. J., Landick, R., and Block, S. M. (2008) Applied force reveals mechanistic and energetic details of transcription termination. Cell 132, 971-982. Berens, C., Groher, F., and Suess, B. (2015) RNA aptamers as genetic control devices: the potential of riboswitches as synthetic elements for regulating gene expression. Biotechnol J 10, 246-257. Etzel, M., and Mörl, M. (2017) Synthetic Riboswitches: From Plug and Pray toward Plug and Play. Biochemistry 56, 1181-1198. Wittmann, A., and Suess, B. (2011) Selection of tetracycline inducible self-cleaving ribozymes as synthetic devices for gene regulation in yeast. Mol Biosyst 7, 2419-2427. Topp, S., Reynoso, C. M., Seeliger, J. C., Goldlust, I. S., Desai, S. K., Murat, D., Shen, A., Puri, A. W., Komeili, A., Bertozzi, C. R., Scott, J. R., and Gallivan, J. P. (2010) Synthetic riboswitches that induce gene expression in diverse bacterial species. Appl Environ Microbiol 76, 7881-7884. Hanahan, D. (1983) Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166, 557-580. Sambrook, J., and Russell, D. W., (Ed.) (2001) Molecular cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press. Pridmore, R. D. (1987) New and versatile cloning vectors with kanamycin-resistance marker. Gene 56, 309-312. Gaubig, L. C., Waldminghaus, T., and Narberhaus, F. (2011) Multiple layers of control govern expression of the Escherichia coli ibpAB heat-shock operon. Microbiology. 157, 66-76. Huntzinger, E., Possedko, M., Winter, F., Moine, H., Ehresmann, C., and Romby, P. (2005) Probing RNA structures with enzymes and chemicals in vitro and in vivo. Handbook of RNA Biochemistry., Hartmann R.K., Bindereif A., Schön A., and Westhof E. (eds). pp.151-171.



Page 22 of 31

22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

69.

70. 71.

Brantl, S., and Wagner, E. G. (1994) Antisense RNA-mediated transcriptional attenuation occurs faster than stable antisense/target RNA pairing: an in vitro study of plasmid pIP501. EMBO J. 13, 3599-3607. Zuker, M. (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31, 3406-3415. Darty, K., Denise, A., and Ponty, Y. (2009) VARNA: Interactive drawing and editing of the RNA secondary structure. Bioinformatics 25, 1974-1975.

FIGURES LEGENDS Figure 1. Mode of action of RNATs and temperature-responsive transcription terminators. (a) At low temperatures RNATs form a stable hairpin, which masks the SD sequence by base pairing blocking ribosome binding. An upshift in temperature promotes unfolding of the hairpin, liberating the SD sequence and allowing translation initiation. (b) A poly(U) tail is attached to the hairpin of an RNAT. At low temperature the hairpin forms a secondary structure followed by uridine residues imitating a classical intrinsic terminator. Transcription is terminated prematurely before the open reading frame is transcribed. An increase in temperature leads to melting of the RNA hairpin, thereby preventing the formation of the terminator structure, which leads to elongation of the full-length mRNA. SD: Shine-Dalgarno sequence, AUG: translational start codon, ORF: open reading frame, 30S: 30S ribosomal subunit, 50S: 50S ribosomal subunit, ∆T: temperature shift, RNAP: RNA polymerase.

Figure 2. The ibpA terminator is functional in E. coli. Cells were grown at 30 °C (white bars) to OD600 0.5, induced with 0.01% L-arabinose and heat-shocked for 30 minutes at 42 °C (black bars) before β-galactosidase activity (Miller Units [MU]) was measured. The experiment was performed in duplicate with three replicates each. Mean standard deviation is indicated.

Figure 3. The ibpA terminator confers temperature-dependent transcriptional control. (a) Comparative Northern and (b) Western analyses of gfp mRNA and protein levels. E. coli


Page 23 of 31


23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

cells were grown at 30 °C or heat-shocked at 42 °C prior to RNA or protein isolation. For detection of mRNA levels, a probe directed against the gfp mRNA (~730 nt) was used. GFP (27 kDa) was detected with a GFP antibody.

Figure 4. Effect of stabilizing and destabilizing mutations in the ibpA hairpin. (a) Stabilizing and destabilizing mutations were introduced into the ibpA or ibpA Term hairpin via site-directed mutagenesis. Secondary structures were predicted with mfold70 and pictured with VARNA71 (only the hairpin is depicted). Free energy values were calculated with mfold70 and are stated below the structures. (b) Northern analyses of gfp mRNA levels and (c) Western analyses of GFP levels. E. coli cells were grown at 30 °C or heat-shocked at 42 °C prior to RNA or protein isolation. For detection of mRNA levels, a probe directed against the gfp mRNA (~730 nt) was used. GFP (27 kDa) was detected with a GFP antibody.

Figure 5. The ibpA thermoterm is functional in different genetic locations. (a) A sequence of 200 additional bases was inserted upstream of ibpA Term to simulate its location at the end of a gene. (b) Northern analyses of gfp mRNA levels and (c) Western analyses of GFP levels. E. coli cells were grown at 30 °C or heat-shocked at 42 °C prior to RNA or protein isolation. For detection of mRNA levels, a probe directed against the gfp mRNA (~730 nt) was used. GFP (27 kDa) was detected with a GFP antibody.

Figure 6. The ibpA RNAT and thermoterm unfold with increasing temperatures in vitro. (a) Secondary structure of the ibpA RNAT and the ibpA thermoterm. SD sequence and AUG start codon of the ibpA RNAT are labelled in red. The attached poly(U) tail of ibpA Term is marked in blue. Cleavage sites introduced by RNase T1 or T2 are indicated by arrows. (b) Partial digestion of radioactively labelled RNA was performed with RNase T1 (0.00125 U),



Page 24 of 31

24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

RNase T2 (0.025 U) and nuclease S1 (0. U) at 30 °C and 42 °C. Lane C: RNA treated with water instead of RNase served as control, LOH: alkaline ladder.


Page 25 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1 82x81mm (300 x 300 DPI)


ACS Synthetic Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



Page 26 of 31

Page 27 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60





Figure 4 105x131mm (300 x 300 DPI)


Page 28 of 31

Page 29 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5 92x174mm (300 x 300 DPI)



Figure 6 203x234mm (300 x 300 DPI)


Page 30 of 31

Page 31 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Graphical Abstract 31x11mm (300 x 300 DPI)


Design of a temperature-responsive transcription terminator

Recommend Documents