Article pubs.acs.org/JAFC
Determination of Metabolites of Diosmetin-7‑O‑glucoside by a Newly Isolated Escherichia coli from Human Gut Using UPLC-Q-TOF/ MS Min Zhao, Leyue Du, Jinhua Tao, Dawei Qian, Er-xin Shang, Shu Jiang,* Jianming Guo, Pei Liu, Shu-lan Su, and Jin-ao Duan* Jiangsu Collaborative Innovation Center of Chinese Medicinal Resources Industrialization, Nanjing University of Chinese Medicine, 138 Xianlin Road, Nanjing 210023, People’s Republic of China ABSTRACT: Different human intestinal bacteria were isolated and screened for their ability to transform diosmetin-7-Oglucoside. A Gram-negative anaerobic bacterium, strain 4, capable of metabolizing diosmetin-7-O-glucoside was newly isolated. Its 16S rRNA gene sequence displayed 99% similarity with that of Escherichia. Then strain 4 was identified as a species of the genus Escherichia and was named Escherichia sp. 4. Additionally, an ultraperformance liquid chromatography/quadrupole-time-offlight mass spectrometry (UPLC-Q-TOF/MS) technique combined with Metabolynx software method was established to screen the metabolites of diosmetin-7-O-glucoside. Comparing the retention time and MS/MS spectrum, three metabolites were detected and tentatively identified. These metabolites were acquired by four proposed metabolic pathways including dehydroxylation, deglycosylation, methylation, and acetylation. Diosmetin-7-O-glucoside was mainly bioconverted to considerable amounts of diosmetin and minor amounts of acacetin by the majority of the isolated intestinal bacteria such as Escherichia sp. 4. Subsequently, several strains could degrade acacetin to produce methylated and acetylated acacetin. The metabolites and metabolic pathways of diosmetin-7-O-glucoside by human intestinal bacterium Escherichia sp. 4 were first investigated. KEYWORDS: human intestinal bacteria, 16S rRNA, diosmetin-7-O-glucoside, UPLC-Q-TOF/MS, metabolism
■
INTRODUCTION Nature provides food materials and herbal medicines for primary healthcare, and most of treatments are totally dependent upon the drugs obtained from natural sources.1 Citrus fruits, including orange, grapefruit, tangerine, lemon, etc., account for one of the biggest yields of fruit in the world. Because of their nutritional value and delicacy, fruits are welcomed in people’s daily lives. In addition to fresh citrus fruit, most fruits are processed into juice. Vitamin C and flavonoids are bioactive compounds of lemon juice.2 The flavonoid diosmetin-7-O-glucoside, one of the main phytoconstituents found in lemon juice, is also widely distributed in many other plants, such as Flos Chrysanthemi and Galium verum.3,4 Flos Chrysanthemi (the flower of Chrysanthemum morifolium Ramat.) is widely used in China as a food and traditional Chinese medicine for many diseases.5 A large number of studies have reported its healthy benefits, such as cardiovascular and hepatoprotective effects and antioxidant, antiarrhythmic, and anticomplementary activities.6−10 G. verum, also known as lady’s bedstraw, is a herbaceous perennial plant of the family Rubiaceae, native to Europe and Asia and used in traditional medicine as an anticancer medicine.11 However, pharmacodynamic and pharmacokinetic studies of diosmetin-7-O-glucoside have not been reported until now. All foods and most herbal medicines are administered orally. Therefore, their components are inevitably brought into contact with the microflora of the alimentary tract before they are absorbed.12 There are about 100 trillion microbes in the human gastrointestinal tract.13,14 The complex microbial © 2014 American Chemical Society
ecosystem possesses a metabolic capacity that exceeds that of the liver by a factor of 100 and should be considered as a separate organ within the body.15,16 Intensive metabolism often results in low circulating levels of the original products, with the consequence that final health effects of botanicals are often related to specific active metabolites that are produced in the body rather than being related to the product’s original composition.17 As we know, flavonoids usually exist in the form of glycosides in nature. Metabolism is needed for glycosides before their absorption through the intestinal membrane.18−22 However, our understanding of the bioavailability, metabolism, and mechanisms of diosmetin-7-O-glucoside is very limited. In this work, different pure bacteria from human feces were isolated to investigate their capability of bioconverting diosmetin-7-O-glucoside. To clarify the metabolic profile of diosmetin-7-O-glucoside, an ultraperformance liquid chromatography/quadrupole time-of-flight mass spectrometry (UPLCQ-TOF/MS) with automated data analysis (MetaboLynx) method was applied. Recently, UPLC has proved to be one of the most promising developments in fast chromatographic separations. There has been substantial focus on UPLC separations with the objective of reducing analysis times while maintaining good efficiency.23−25 Received: Revised: Accepted: Published: 11441
June 6, 2014 November 9, 2014 November 9, 2014 November 10, 2014 dx.doi.org/10.1021/jf502676j | J. Agric. Food Chem. 2014, 62, 11441−11448
Journal of Agricultural and Food Chemistry
Article
Table 1. Relative Amounts (MS Response) of Diosmetin-7-O-glucoside Metabolites from Each Colony (Mean ± SD, n = 3) no.
bacterial strain
1 2 3 4 5 6
Escherichia sp. 4 Escherichia sp. 33 Escherichia sp. 34 Enterococcus sp. 30 Enterococcus sp. 41−2 Bacillus sp. 46
metabolite M1 (1.94 (1.77 (1.85 (1.91 (1.98 (1.93
± 0.21) × 104 ± 0.11) × 104 ± 0.73) × 104 ± 1.24) × 104 ± 1.67) × 104 ± 1.08) × 104
metabolite M2 (5.36 (4.58 (5.58 (6.21 (5.86 (7.40
± ± ± ± ± ±
0.72) 0.84) 1.34) 1.59) 0.51) 1.81)
× × × × × ×
103 103 103 103 103 103
metabolite M3 (7.91 (5.29 (5.63 (7.60 (4.75 (2.36
± ± ± ± ± ±
1.98) 1.20) 0.27) 1.73) 0.92) 0.49)
× × × × × ×
103 103 103 103 103 103
Figure 1. UPLC-MS chromatograms of diosmetin-7-O-glucoside and its metabolites: (a) blank sample (containing GAM only); (b) GAM with standard solution of diosmetin-7-O-glucoside sample; (c) Escherichia sp. 4 sample.
■
Karroten Genomic DNA Purification Kit (Beijing, China). Their 16S rRNA sequences were amplified with two universal primers. The Gram-negative bacteria were 16S-2F (CATGCAAGTCGARCG) and 16S-2R (GGTGTGACGGGCGGT), whereas the Gram-positive bacteria were 16S-1F (AGAGTTTGATCCTGGCTCAG) and 16S1R (AGAAAGGAGGTGATCC). The polymerase chain reaction (PCR) program used for amplification was as follows: 94 °C for 1 min, followed by 29 cycles consisting of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 2 min, and a single final extension step consisting of 72 °C for 10 min. The PCR products were purified from the agarose gel using a Karroten gel purification kit. Sequencing of the 16S rRNA fragments was performed by Majorbio (Shanghai, China). The homology search of the 16S rRNA gene sequence was performed by EzBioCloud server. The phylogenetic tree was constructed using the neighbor-joining method of the CLUSTAL W program and MEGA (ver 5.0) software.26 Sample Preparation for Analysis. The diosmetin-7-O-glucoside standard solution was prepared by dissolving accurately diosmetin-7O-glucoside in methanol to give a final concentration of 3.0 mg/mL. The 0.1 mM standard solution was inoculated into 0.9 mL of GAM broth with 0.1 mL of precultured bacteria prepared from the culture stock and then anaerobically incubated at 37 °C for 24 h. The samples were extracted three times with ethyl acetate, and the ethyl acetate layer was dried under vacuum. Before UPLC-MS analysis, the samples were dissolved with 0.3 mL of methanol and centrifuged at 12000g for 10 min, and then the supernatant was filtered through a 0.22 μm membrane. To exclude the deviation deriving from one time test, each bacterial strain was prepared to be three samples for incubation with the diosmetin-7-O-glucoside standard, and the processed sample was tested three times. UPLC-MS Analysis. The flavonoids were separated on a Waters Acquity UPLC system (Waters Corp., Milford, MA, USA) fitted with a Syncronis C 18 column (100 mm × 2.1 mm i.d., 1.7 μm; Thermo,
MATERIALS AND METHODS
Chemicals and Media. The HPLC grade acetonitrile was purchased from TEDIA Co. Inc. (Fairfield, OH, USA). The distilled water was purified by an EPED super purification system (Nanjing, China). The formic acid was obtained from Merck KGaA (Darmstadt, Germany). Other reagents were all of analytical grade. AnaeroPack rectangular jars were purchased from Mitsubishi Gas Chemical Co. Inc. (Japan). Diosmetin-7-O-glucoside, diosmetin, and acacetin standard substances (purity > 98%) were purchased from Chengdu Preferred Biotechnology Co., Ltd. (Chengdu, China). The general anaerobic medium (GAM) used in the fermentation experiment contained the following compounds per liter: 5.0 g of yeast extract, 3.0 g of glucose, 2.2 g of beef extract, 2.5 g of KH2PO4, 0.3 g of sodium thioglycolate, 13.5 g fo digestive serum powder, 10.0 g of proteose peptone, 3.0 g of soy peptone, 10.0 g of tryptone, 5.0 g of soluble starch, 1.2 g of beef liver extract powder, 3.0 g of NaCl, 0.3 g of L-cysteine hydrochloride, and about 1000 mL of distilled water. After the above were well mixed, the pH was adjusted to approximately 7.3 with NaOH aqueous solution. Then, the GAM was autoclaved at 121 °C for 20 min. Collection and Incubation of Fecal Samples. Fresh human feces (4.0 g) were weighed and suspended in a centrifuge tube covered with 20 mL of sterile physiological saline and then homogenized adequately by a vortex-mixer. The mixture was centrifuged at 2000g for 10 min, and the suspension was used as the bacterial mixture. The bacterial mixture was diluted serially in sterile water, and each of the dilutions was spread on the GAM agar plates, which were incubated under anaerobic condition in anaerobic jars for 48 h at 37 °C. Each bacterium picked up from the GAM agar plate was inoculated into 1.0 mL of GAM broth and anaerobically incubated at 37 °C for 24 h. 16S rRNA Gene Sequencing and Phylogenetic Analysis. The bacterial genomic DNA was extracted from the isolates using a 11442
dx.doi.org/10.1021/jf502676j | J. Agric. Food Chem. 2014, 62, 11441−11448
Journal of Agricultural and Food Chemistry
Article
Table 2. Diosmetin-7-O-glucoside and Its Metabolites Identified in Different Human Intestinal Bacterial Samples Using UPLCMS/MS
a
peak
tRa(min)
exptl mass (m/z)
formula
M0 M1 M2 M3
5.06 8.10 9.53 10.90
462.1162 300.0634 284.0685 340.0947
C22H22O11 C16H12O6 C16H12O5 C19H16O6
MS2 fragment ions 461, 299, 283, 339,
299, 284, 268, 283,
284, 256, 240, 268,
255, 151 151 151 240, 151
mass change
formula change
0 −162.0528 −178.0504 −122.0215
null -Glc -Glc − OH -Glc − OH + CH3 + C2H2O
tR, retention time.
USA) by gradient elution using acetonitrile (solvent A) and 0.1% formic acid in distilled water (solvent B). The gradient profile was as follows: 0−7.5 min, from 10 to 30% solvent A; 10 min, 70% solvent A; 11 min, 95% solvent A; held for 1 min. The gradient was recycled back to 10% in 1 min for the next run. The injection volume was 5 μL. The temperature of the column oven was set to 35 °C. Mass spectrometry was carried out using a Waters Acquity Synapt mass spectrometer (Waters Corp., Manchester, UK) connected to the UPLC system via an electrospray ionization (ESI) interface. Ionization took place in the negative ion mode. The conditions for the MS analysis were designed as follows: capillary voltage, 3.0 kV; cone gas flow rate, 50 L/h; source temperature, 120 °C; desolvation gas flow rate, 60 L/h at a temperature of 350 °C. All data in the centroid mode were acquired by using MasslynxNT4.1 software (Waters Corp., Milford, MA, USA).
product ion at m/z 151 was formed from the aglycone at m/z 299 by the retro-Diels−Alder (RDA) cleavage (Figure 3a). Metabolite M1 was detected as deprotonated molecular ion [M − H]− at m/z 299 with the retention time at 8.10 min, which was 162 Da lower than that of M0 diosmetin-7-Oglucoside. It gave signals at m/z 299, 284, 256, and 151. In the MS/MS spectrum of M1 are displayed similar product ions as M0 diosmetin-7-O-glucoside (Figure 2b). According to the MS/MS spectrum and the fragmentation regularity with standard diosmetin (Figure 3b), M1 was identified as the aglycone of diosmetin-7-O-glucoside, diosmetin. The fragment ion of M2 (retention time, 9.53 min) was at m/z 283 [M − H]−. As illustrated in Figures 2c and 3c, the m/z 283 lost CH3 to give m/z 268. The m/z 268 was further fragmented to be m/z 240 by the loss of CO. The m/z 151 was obtained from m/z 283 by RDA cleavage. Becausee M1 was 16 Da higher than M2, M2 was tentatively identified as dehydroxylated aglycone. Additionally, M2 was confirmed on the basis of its retention time and MS/MS spectrum compared with the standard of acacetin. Therefore, we concluded M2 was acacetin. The characteristic fragment ion of M3 (Figure 2d) was at m/ z 339 [M − H]−, which was 56 Da higher than that of M2, indicating the chemical structure of M3 could be the methylated and acetylated product of M2. According to the fragmentation pathway (Figure 3d), M3 lost CH2 and C2H2O to form m/z 283. Then, m/z 268 and 240 were obtained from m/z 283 by the loss of CH3 and C2H3O, respectively. The m/z 151 was also obtained by RDA cleavage from m/z 283. Thus, M3 was identified as the methylated and acetylated acacetin.
■
RESULTS Characterization of the Human Intestinal Bacteria. On the basis of the colony morphology, micromorphology, and comparative 16S rRNA gene sequence analysis, 67 Escherichia, 16 Enterococcus, and 16 Bacillus strains were identified. Due to the stronger bioconversion ability (Table 1), Gram-negative strain 4 was picked as a representative example for analysis. The PCR amplified 16S rRNA of strain 4 was 1298 bp, and its nucleotide sequence has been registered in GenBank under accession no. KC819112. After comparison of the 16S rRNA gene sequence with the CLUSTAL W program, the phylogenetic affiliation of strain 4 was determined. The phylogenetic tree also showed that the isolated strain 4 was in the same cluster with Escherichia species. It is closely related to Escherichia coli O157 EC4115 CP001164 with 99.15% similarity. Thus, we identified it as one species of the genus Escherichia and named it Escherichia sp. 4. Metabolic Profile of Diosmetin-7-O-glucoside by the Different Human Intestinal Bacteria. According to the retention behaviors, changes of molecular weights and MS/MS fragment patterns, the prototype, and its metabolites could be tentatively identified. Compared with blank sample (Figure 1 and Table 2), parent compound diosmetin-7-O-glucoside (M0) and its three metabolites were detected in different human intestinal bacterial samples. Three metabolites were likely to be diosmetin-7-O-glucoside aglycone diosmetin (M1), acacetin (M2), and methylated and acetylated acacetin (M3). Considerable amounts of M1 and minor amounts of M2 were produced by the majority of the isolated intestinal bacterial strains such as Escherichia sp. 4. A small amount of M3 existed in the minority of the bacterial samples. Identification of the Diosmetin-7-O-glucoside Metabolites. The retention time of diosmetin-7-O-glucoside (M0) was at 5.06 min, and its fragment ion was at m/z 461 (Figure 2a). The precursor ion [M − H]− m/z 461 afforded the diosmetin product ion at m/z 299 by loss of the glucuronide group. Then, the m/z 299 lost CH3 to be m/z 284. The m/z 255 was generated from m/z 284 by elimination of CO. The
■
DISCUSSION The commercially available UPLC has proved to be one of the most promising recent developments in fast chromatographic separations. There has been substantial focus on UPLC separations with the objective of reducing analysis times while maintaining good efficiency. Additionally, the UPLC-QTOF/MS plays a crucial role in the study of drug metabolism because it can not only provide accurate masses of ions but also give valuable structural information from the MS/MS spectra.24,25 According to the retention behaviors, changes of molecular weights, and MS/MS fragment patterns, the prototype and its metabolites can be tentatively identified.27,28 Compared with the HPLC-MS technology, UPLC-MS significantly improves the repeatability and reliability of quantitative analysis as well as the accuracy of qualitative analysis. On the basis of our experimental results, the metabolic pathways of diosmetin-7-O-glucoside by the isolated Enterococci, Escherichia, and Bacillus strains in vitro were proposed as shown in Figure 4. Diosmetin-7-O-glucoside in the human intestine might initially be involved in deglycosylation of the flavonoid glycoside by intestinal bacteria with β-D-glucosidase, 11443
dx.doi.org/10.1021/jf502676j | J. Agric. Food Chem. 2014, 62, 11441−11448
Journal of Agricultural and Food Chemistry
Article
Figure 2. UPLC-MS/MS spectra: (a) M0 (m/z 461); (b) M1 (m/z 299); (c) M2 (m/z 283); (d) M3 (m/z 339).
and it was almost totally bioconverted to diosmetin, which thereafter could be further biocoverted to acacetin (M2). However, only a few intestinal bacteria such as Escherichia sp. 4 could produce methylated and acetylated acacetin (M3). An
early study indicated that diosmetin could be reduced to its flavanone analogue hesperetin through reduction of the 2,3 double bond of the C-ring by intestinal bacterial enzymes.29 However, the course of polyphenol degradation depended on 11444
dx.doi.org/10.1021/jf502676j | J. Agric. Food Chem. 2014, 62, 11441−11448
Journal of Agricultural and Food Chemistry
Article
Figure 3. Proposed fragmentation pathways of M0−M3.
the type of bacteria in the gut,30 and hydrogenation might not be a general feature of the intestinal microflora even though the bacteria were from the same strain. For example, quercetin
could be hydrogenated to taxifolin by a Clostridium orbiscindens strain.31 Escherichia coli HGH21 could bioconvert the isoflavone daidzin to daidzein and further metabolize the 11445
dx.doi.org/10.1021/jf502676j | J. Agric. Food Chem. 2014, 62, 11441−11448
Journal of Agricultural and Food Chemistry
Article
Figure 4. Proposed metabolic pathways of diosmetin-7-O-glucoside by the human intestinal bacteria.
isoflavone daidzein to dihydrodaidzein.32 However, Escherichia coli JCM5491 did not convert daidzin to daidzein.33 Therefore, it was speculated that the release of diosmetin improved diosmetin-7-O-glucoside bioavailability for absorption by colonic mucosa and/or further biotransformation to hesperetin by other human intestinal microorganisms. The removal of hydroxyl groups from aromatic rings and the acetylation of phenolic compounds might be exceptional metabolic activities. However, the conversion of phenolic compounds has been widely described in recent years.34,35 The human intestinal bacteria, classified as resident and transient flora, comprise a diversity of bacterial species and have excellent enzymatic systems contributing to their enormous catalytic and hydrolytic potential.36 The factors influencing the flavonoids absorption in the gastrointestinal tract include deglycosylation before absorption, conjugation in the small intestine through glucuronidation, sulpfation or methylation, etc., and metabolism and degradation in the colon to smaller phenolic molecules by intestinal bacteria. The forms in which they circulate in vivo will influence their polarity and, thus, their localization and bioactivities.37 Diosmetin commonly occurs in citrus species and olive leaves, shows significant antibacterial activity against drug-resistant Staphylococcus aureus,38,39 and has the potential to suppress stem cell factor-/ultraviolet B-induced melanogenesis. Thus, it can be developed as an antipigmentation agent.40 Diosmetin exhibits anticancer activity. It can inhibit tumor growth and protect tumor-induced apoptosis of the thymus41 and shows significant cytotoxicities against colon cancer cell Colo205.42 Additionally, diosmetin slightly inhibits superoxide anion generation or elastase release by human neutrophils, indicating moderate anti-inflammatory activity.43 It can induce osteoblastic differentiation and is a promising agent for treating osteoporosis.44 Diosmetin is one of the main active ingredients of some medications.45 The metabolite acacetin can exert anti-inflammatory, anticancer, and antihypertension activities.46,47 Deglycosylation is an important step in the absorption and metabolism of glycosides.48−53 The absorption rate of aglycones is higher than that of their corresponding glycosides due to their higher lipophilicities and smaller molecular sizes.54−56 Hence, the human intestinal bacteria
play an important role in the pharmacological effects of diosmetin-7-O-glucoside in vivo. As we know, the polarity of a compound might significantly affect its bioavailability. The polarity of flavonoid aglycones highly depends on the substitution of the three rings in their chemical structures. Flavonoids with methoxy groups on ring A or B are relatively nonpolar, which can protect them from extensive bacterial degradation.57 The methoxy group is beneficial for the absorption if the dissolution is satisfactory.58 Because the other intestinal bacteria might be also able to demeth(ox)ylate phenolic compunds, we speculated that the clinical effects of diosmetin-7-O-glucoside mainly resulted from diosmetin, which displayed stronger bioactivities and higher absorption rate than those of the parent compound in vivo. Although the metabolism results from our work might not fully reflect the interaction between human intestinal bacteria and medicines, it still could provide a good reference to study and understand the mechanism of the interaction.
■
AUTHOR INFORMATION
Corresponding Authors
*(S.J.) Phone/fax:+86 25 85811516. E-mail: jiangshu2000@ 163.com. *(J.D.) Phone/fax: +86 25 85811116. E-mail:
[email protected]. cn. Funding
This work was financially supported by the National Basic Research Program of China (973 Program) (2011CB505300, 2011CB505303), the Nature Science Foundation of China (81072996, 81102743), Jiangsu Collaborative Innovation Center of Chinese Medicinal Resources Industrialization (ZDXM-1-10), and Construction Project for Jiangsu Key Laboratory for High Technology of TCM Formulae Research (BM2010576). Notes
The authors declare no competing financial interest. 11446
dx.doi.org/10.1021/jf502676j | J. Agric. Food Chem. 2014, 62, 11441−11448
Journal of Agricultural and Food Chemistry
■
Article
mulberroside A, the main polyhydroxylated stilbene in mulberry (Morus alba L.), and its bacterial metabolite oxyresveratrol in traditional oral use. J. Agric. Food Chem. 2012, 60, 2299−2308. (22) Ruan, J. Q.; Leong, W. I.; Yan, R.; Wang, Y. T. Characterization of metabolism and in vitro permeability study of notoginsenoside R1 from Radix notoginseng. J. Agric. Food Chem. 2010, 58, 5770−5776. (23) Guo, J. M.; Xue, C. F.; Shang, E. X.; Duan, J. A.; Tang, Y. P.; Qian, D. W. Identification of hyperoside metabolites in rat using ultra performance liquid chromatography/quadrupole-time-of-flight mass spectrometry. J. Chromatogr., B 2011, 879, 1987−1992. (24) Han, H.; Yang, L.; Xu, Y.; Ding, Y.; Annie Bligh, S. W.; Zhang, T.; Wang, Z. T. Identification of metabolites of geniposide in rat urine using ultra-performance liquid chromatography time-of-flight tandem mass spectrometry. Rapid Commun. Mass Spectrom. 2011, 25, 3339− 3350. (25) Shen, J. Z.; Yang, C. Y.; Wu, C. M.; Feng, P. S.; Wang, Z. H.; Li, Y.; Li, Y. S.; Zhang, S. X. Identification of the major metabolites of quinocetone in swine urine using ultra-performance liquid chromatography/electrospray ionization quadrupole time-of-flight tandem mass spectrometry. Rapid Commun. Mass Spectrom. 2010, 24, 375−383. (26) Yokoyama, S.; Niwa, T.; Osawa, T.; Suzuki, T. Characterization of an O-desmethylangolensin-producing bacterium isolated from human feces. Arch. Microbiol. 2010, 192, 15−22. (27) Bourdon, F.; Lecoeur, M.; Verones, V.; Vaccher, C.; Lebegue, N.; Dine, T.; Kambia, N.; Goossens, J. F. In vitro pharmacokinetic profile of a benzopyridooxathiazepine derivative using rat microsomes and hepatocytes: identification of phases I and II metabolites. J. Pharm. Biomed. Anal. 2013, 80, 69−78. (28) Brozinski, J. M.; Lahti, M.; Oikari, A.; Kronberg, L. Identification and dose dependency of ibuprofen biliary metabolites in rainbow trout. Chemosphere 2013, 93, 1789−1795. (29) Spanakis, M.; Kasmas, S.; Niopas, I. Simultaneous determination of the flavonoid aglycones diosmetin and hesperetin in human plasma and urine by a validated GC/MS method: in vivo metabolic reduction of diosmetin to hesperetin. Biomed. Chromatogr. 2009, 23, 124−131. (30) Bolca, S.; Van de Wiele, T.; Possemiers, S. Gut metabotypes govern health effects of dietary polyphenols. Curr. Opin. Biotechnol. 2013, 24, 220−225. (31) Schoefer, L.; Mohan, R.; Schwiertz, A.; Braune, A.; Blaut, M. Anaerobic degradation of flavonoids by Clostridium orbiscindens. Appl. Environ. Microbiol. 2003, 69, 5849−5854. (32) Hur, H. G.; Lay, J. O.; Beger, R. D.; Freeman, J. P.; Rafii, F. Isolation of human intestinal bacteria metabolizing the natural isoflavone glycosides daidzin and genistin. Arch. Microbiol. 2000, 174, 422−428. (33) Ryota, T.; Seiichi, S.; Mitsuru, K.; Toshihiro, N.; Junei, K. Microbial metabolism of soy isoflavones by human intestinal bacterial strains. J. Nat. Med. 2008, 62, 456−460. (34) Xue, C.; Jiang, S.; Guo, J.; Qian, D.; Duan, J. A.; Shang, E. Screening for in vitro metabolites of Abelmoschus manihot extract in intestinal bacteria by ultra-performance liquid chromatography/ quadrupole time-of-flight mass spectrometry. J. Chromatogr., B 2011, 879, 3901−3908. (35) Lu, L.; Qian, D.; Yang, J.; Jiang, S.; Guo, J.; Shang, E. X.; Duan, J. A. Identification of isoquercitrin metabolites produced by human intestinal bacteria using UPLC-Q-TOF/MS. Biomed. Chromatogr. 2013, 27, 509−514. (36) Lee, J. E. S.; Sung, J.; Kol, G. Analysis of human and animal fecal microbiota for microbial source tracking. ISME J. 2011, 5, 362−365. (37) Clavel, T.; Henderson, G.; Alpert, C. A.; Philippe, C.; RigottierGois, L.; Dore, J.; Blaut, M. Intestinal bacterial communities that produce active estrogen-like compounds enterodiol and enterolactone in humans. Appl. Environ. Microbiol. 2005, 71, 6077−6085. (38) Wang, S. Y.; Sun, Z. L.; Liu, T.; Gibbons, S.; Zhang, W. J.; Qing, M. Flavonoids from Sophora moorcrof tiana and their synergistic antibacterial effects on MRSA. Phytother. Res. 2013, DOI: 10.1002/ ptr.5098. (39) Chan, B. C.; Ip, M.; Gong, H.; Lui, S. L.; See, R. H.; Jolivalt, C.; Fung, K. P.; Leung, P. C.; Reiner, N. E.; Lau, C. B. Synergistic effects
REFERENCES
(1) Patel, K.; Gadewar, M.; Tahilyani, V.; Patel, D. K. A review on pharmacological and analytical aspects of diosmetin: a concise report. Chin. J. Integr. Med. 2013, 19, 792−800. (2) Gonzalez-Molina, E.; Moreno, D. A.; Garcia-Viguera, C. Genotype and harvest time influence the phytochemical quality of Fino lemon juice (Citrus limon (L.) Burm. F.) for industrial use. J. Agric. Food Chem. 2008, 56, 1669−1675. (3) Lin, L. Z.; Chen, P.; Harnly, J. M. New phenolic components and chromatographic profiles of green and fermented teas. J. Agric. Food Chem. 2008, 56, 8130−8140. (4) Cai, S. L.; Wu, Z.; Wu, J.; Wang, Q.; Shan, Y. Synthesis and biological activities of natural flavonoid diosmetin and its derivatives. Chin. J. Org. Chem. 2012, 32, 560−566. (5) Chen, Z. J.; Kong, S. S.; Song, F. F.; Li, L. P.; Jiang, H. D. Pharmacokinetic study of luteolin, apigenin, chrysoeriol and diosmetin after oral administration of Flos Chrysanthemi extract in rats. Fitoterapia 2012, 83, 1616−1622. (6) Jiang, H. D.; Cai, J.; Xu, J. H.; Zhou, X. M.; Xia, Q. Endotheliumdependent and direct relaxation induced by ethyl acetate extract from Flos Chrysanthemi in rat thoracic aorta. J. Ethnopharmacol. 2005, 101, 221−226. (7) Rusu, M. A.; Tamas, M.; Puica, C.; Roman, I.; Sabadas, M. The hepatoprotective action of ten herbal extracts in CCl4 intoxicated liver. Phytother. Res. 2005, 19, 744−749. (8) Bor, J. Y.; Chen, H. Y.; Yen, G. C. Evaluation of antioxidant activity and inhibitory effect on nitric oxide production of some common vegetables. J. Agric. Food Chem. 2006, 54, 1680−1686. (9) Lii, C. K.; Lei, Y. P.; Yao, H. T.; Hsieh, Y. S.; Tsai, C. W.; Liu, K. L.; Chen, H. W. Chrysanthemum morifolium Ramat. reduces the oxidized LDL-induced expression of intercellular adhesion molecule-1 and E-selectin in human umbilical vein endothelial cells. J. Ethnopharmacol. 2010, 128, 213−220. (10) Zhang, T.; Chen, D. Anticomplementary principles of a Chinese multiherb remedy for the treatment and prevention of SARS. J. Ethnopharmacol. 2008, 117, 351−361. (11) Schmidt, M.; Scholz, C. J.; Gavril, G. L.; Otto, C.; Polednik, C.; Roller, J.; Hagen, R. Effect of Galium verum aqueous extract on growth, motility and gene expression in drug-sensitive and -resistant laryngeal carcinoma cell lines. Int. J. Oncol. 2014, 44, 745−760. (12) Kim, D. H. Herbal medicines are activated by intestinal microflora. Nat. Prod Sci. 2002, 8, 35−43. (13) Ley, R. E.; Hamady, M.; Lozupone, C.; Turnbaugh, P. J.; Ramey, R. R.; Bircher, J. S. Evolution of mammals and their gut microbes. Science 2008, 320, 1647−1651. (14) Ley, R. E.; Peterson, D. A.; Gordon, J. I. Ecological and evolutionary forces shaping microbial diversity in the human intestine. Cell 2006, 124, 837−848. (15) Xu, J.; Gordon, J. I. Honor thy symbionts. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 10452−10459. (16) O’Hara, A. M.; Shanahan, F. The gut flora as a forgotten organ. EMBO Rep. 2006, 7, 688−693. (17) Possemiers, S.; Bolca, S.; Verstraete, W.; Heyerick, A. The intestinal microbiome: a separate organ inside the body with the metabolic potential to influence the bioactivity of botanicals. Fitoterapia 2010, 82, 53−66. (18) Serra, H.; Mendes, T.; Bronze, M. R.; Simplicio, A. L. Prediction of intestinal absorption and metabolism of pharmacologically active flavones and flavanones. Bioorg. Med. Chem. 2008, 16, 4009−4018. (19) Wan, J. Y.; Liu, P.; Wang, H. Y.; Qi, L. W.; Wang, C. Z.; Li, P.; Yuan, C. S. Biotransformation and metabolic profile of American ginseng saponins with human intestinal microflora by liquid chromatography quadrupole time-of-flight mass spectrometry. J. Chromatogr., A 2013, 1286, 83−92. (20) Chen, K. I.; Erh, M. H.; Su, N. W.; Liu, W. H.; Chou, C. C.; Cheng, K. C. Soyfoods and soybean products: from traditional use to modern applications. Appl. Microbiol. Biotechnol. 2012, 96, 9−22. (21) Mei, M.; Ruan, J. Q.; Wu, W. J.; Zhou, R. N.; Lei, J. P.; Zhao, H. Y.; Yan, R.; Wang, Y. T. In vitro pharmacokinetic characterization of 11447
dx.doi.org/10.1021/jf502676j | J. Agric. Food Chem. 2014, 62, 11441−11448
Journal of Agricultural and Food Chemistry
Article
(58) Lin, Y. T.; Hsiu, S. L.; Hou, Y. C.; Chen, H. Y.; Chao, P. D. L. Degradation of flavonoid aglycones by rabbit, rat and human fecal flora. Biol. Pharm. Bull. 2003, 26, 747−751.
of diosmetin with erythromycin against ABC transporter overexpressed methicillin-resistant Staphylococcus aureus (MRSA) RN4220/pUL5054 and inhibition of MRSA pyruvate kinase. Phytomedicine 2013, 20, 611−614. (40) Lee, S. J.; Jung, T. H.; Kim, H.; Jeong, D.; Choi, G.; Park, W. K.; Kong, J. Y.; Jin, M. H.; Cho, H. Inhibition of c-Kit signaling by diosmetin isolated from Chrysanthemum morifolium. Arch. Pharm. Res. 2014, 37, 175−185. (41) Zhao, R.; Chen, Z.; Jia, G.; Li, J.; Cai, Y.; Shao, X. Protective effects of diosmetin extracted from Galium verum L. on the thymus of U14-bearing mice. Can. J. Physiol. Pharmacol. 2011, 89, 665−673. (42) Xie, Y. Y.; Yuan, D.; Yang, J. Y.; Wang, L. H.; Wu, C. F. Cytotoxic activity of flavonoids from the flowers of Chrysanthemum morifolium on human colon cancer Colo205 cells. J. Asian Nat. Prod. Res. 2009, 11, 771−778. (43) Lin, A. S.; Lin, C. R.; Du, Y. C.; Lubken, T.; Chiang, M. Y.; Chen, I. H.; Wu, C. C.; Hwang, T. L.; Chen, S. L.; Yen, M. H.; Chang, F. R.; Wu, Y. C. Acasiane A and B and farnesirane A and B, diterpene derivatives from the roots of Acacia farnesiana. Planta Med. 2009, 75, 256−261. (44) Hsu, Y. L.; Kuo, P. L. Diosmetin induces human osteoblastic differentiation through the protein kinase C/p38 and extracellular signal-regulated kinase 1/2 pathway. J. Bone Miner. Res. 2008, 23, 949− 960. (45) Poor, M.; Veres, B.; Jakus, P. B.; Antus, C.; Montsko, G.; Zrinyi, Z.; Vladimir-Knezevic, S.; Petrik, J.; Koszegi, T. Flavonoid diosmetin increases ATP levels in kidney cells and relieves ATP depleting effect of ochratoxin A. J. Photochem. Photobiol. B 2014, 132, 1−9. (46) Kim, C.; Kim, M. C.; Kim, S. M.; Nam, D.; Choi, S. H.; Kim, S. H.; Ahn, K. S.; Lee, E. H.; Jung, S. H.; Ahn, K. S. Chrysanthemum indicum L. extract induces apoptosis through suppression of constitutive STAT3 activation in human prostate cancer DU145 cells. Phytother. Res. 2013, 27, 30−38. (47) Senejoux, F.; Demougeot, C.; Kerram, P.; Aisa, H. A.; Berthelot, A.; Bevalot, F.; Girard-Thernier, C. Bioassay-guided isolation of vasorelaxant compounds from Ziziphora clinopodioides Lam. (Lamiaceae). Fitoterapia 2012, 83, 377−382. (48) Nemeth, K.; Plumb, G. W.; Berrin, J. G.; Juge, N.; Jacob, R.; Naim, H. Y.; Williamson, G.; Swallow, D. M.; Kroon, P. A. Deglycosylation by small intestinal epithelial cell β-glucosidases is a critical step in the absorption and metabolism of dietary flavonoid glycosides in humans. Eur. J. Nutr. 2003, 42, 29−42. (49) Tarko, T.; Duda-Chodak, A.; Zajac, N. Digestion and absorption of phenolic compounds assessed by in vitro simulation methods. A review. Rocz. Panstw. Zakl. Hig. 2013, 64, 79−84. (50) Chen, Z.; Zheng, S.; Li, L.; Jiang, H. Metabolism of flavonoids in human: a comprehensive review. Curr. Drug Metab. 2014, 15, 48−61. (51) Makarova, N. M. Bioavailability and metabolism of flavonoids. Eksp. Klin. Farmakol. 2011, 74, 33−40. (52) Walle, T. Absorption and metabolism of flavonoids. Free Radical Biol. Med. 2004, 36, 829−837. (53) Walle, T.; Browning, A. M.; Steed, L. L.; Reed, S. G.; Walle, U. K. Flavonoid glucosides are hydrolyzed and thus activated in the oral cavity in humans. J. Nutr. 2005, 135, 48−52. (54) Izumi, T.; Piskula, M. K.; Osawa, S.; Obata, A.; Tobe, K.; Saito, M.; Kataoka, S.; Kubota, Y.; Kikuchi, M. Soy isoflavone aglycones are absorbed faster and in higher amounts than their glucosides in humans. J. Nutr. 2000, 130, 1695−1699. (55) Wiczkowski, W.; Romaszko, J.; Bucinski, A.; Szawara-Nowak, D.; Honke, J.; Zielinski, H.; Piskula, M. K. Quercetin from shallots (Alliumcepa L. var. aggregatum) is more bioavailable than its glucosides. J. Nutr. 2008, 138, 885−888. (56) Xue, C. F.; Guo, J. M.; Qian, D. W.; Duan, J. A.; Shu, Y. Absorption of flavonoids from Abelmoschus manihot extract by in situ intestinal perfusion. Acta Pharm. Sinica 2011, 46, 454−459. (57) Wen, X.; Walle, T. Methylated flavonoids have greatly improved intestinal absorption and metabolic stability. Drug Metab. Dispos. 2006, 34, 1786−1792. 11448
dx.doi.org/10.1021/jf502676j | J. Agric. Food Chem. 2014, 62, 11441−11448
