Development and Characterization of a Human Reporter Cell Line for

Article pubs.acs.org/JAFC

Development and Characterization of a Human Reporter Cell Line for the Assessment of Thyroid Receptor Transcriptional Activity: A Case of Organotin Endocrine Disruptors Peter Illés,† Július Brtko,§ and Zdeněk Dvořaḱ *,† †

Department of Cell Biology and Genetics, Faculty of Science, Palacky University, Slechtitelu 11, 783 71 Olomouc, Czech Republic Laboratory of Molecular Endocrinology, Institute of Experimental Endocrinology, Slovak Academy of Sciences, Vlarska 3, 833 06 Bratislava, Slovak Republic

§

ABSTRACT: We developed and characterized the human luciferase reporter cell line PZ-TR for the assessment of thyroid receptor (TR) transcriptional activity. Triiodothyronine (T3) induced luciferase activity in a dose-dependent manner, and the sensitivity of assay allowed for the detection of nanomolar T3 concentrations. The luciferase activity was induced by a maximum of (2.42 ± 0.14)−(2.73 ± 0.23)-fold after 24 h of exposure to 10 nM T3. We did not observe a nonspecific induction of luciferase activity by other steroid hormones and VDR ligands, with the exception of partial activation by retinoic acids. Cryopreservation of PZ-TR cells did not influence their functionality, responsivity to T3, or cell morphology, even after longterm cultivation. PZ-TR cells were used to evaluate the effects of organic tin compounds on TR. We found that the tributyltin and triphenyltin derivatives induced luciferase activity and that application of organotins in combination with T3 enhanced the effect of T3. These findings indicate that organic tin compounds have potential to interfere with TR-mediated regulation of gene expression and influence the physiological activity of thyroid hormones. KEYWORDS: thyroid hormone, thyroid receptor, luciferase reporter assay, cell line, organic tin compounds

■

INTRODUCTION Thyroid hormones (THs), triiodothyronine and thyroxine (T3 and T4), regulate gene expression by binding to high-affinity thyroid hormone receptors (TRs) and play a crucial role in development, growth, and energy homeostasis. TRs are ligandactivated transcription factors that belong to a superfamily of nuclear hormone receptors. TRs regulate gene expression by direct interaction with specific thyroid hormone response elements (TREs) in the promoter regions of TR target genes. Transcriptionally active forms of TRs primarily bind to TREs as heterodimers, and preferentially interact with the retinoic X receptor (RXR). The regulation of TH-mediated gene expression plays an essential role in a wide range of physiological processes. It is known that a large number of exogenous ligands, including natural and synthetic compounds, drugs, and environmental pollutants, may disrupt THs’ mode of action and thus affect the normal function of the endocrine system.1−3 Therefore, the construction of a high-throughput and low-cost stable reporter system that allows researchers to monitor the changes in TR-regulated gene transcription would be a great benefit.4,5 Several stable6−8 and transient9,10 gene reporter systems for the assessment of TR transcriptional activity have been developed. However, none of these in vitro systems were derived from human cell lines, but were from other mammalian and amphibian cell lines. Therefore, the main aim of our study was to develop a stable luciferase gene reporter system in a human cell line with endogenous TR expression to resemble the characteristics of humans. We developed and characterized a novel human HepG2-derived PZ-TR cell line as a sensitive and high-throughput tool for monitoring TR transcriptional activity. The reliability of the © 2015 American Chemical Society

PZ-TR cell line was demonstrated by studying the potential effects of organic tin compounds on TR-mediated gene expression.11 In summary, we present here a novel and unique transgenic human gene reporter cell line, PZ-TR, which is a potent and high-throughput tool for environmental and food safety applications, as well as for the preclinical testing of drugs or other natural and synthetic compounds.

■

MATERIALS AND METHODS

Chemicals. The primers and UPL probes for qRT-PCR were purchased from Roche Diagnostic Corp. (Prague, Czech Republic). The human recombinant TR-α1 (catalog no. PR-751) and TR-β1 (catalog no. PR-722) proteins were from Jena Bioscience (Jena, Germany). The primary anti-TRα1/α2 (catalog no. sc-73213) and anti-TRα1/β1 (catalog no. sc-740) monoclonal antibodies, primary anti-RXRα polyclonal antibody (catalog no. sc-553), secondary polyclonal goat anti-mouse IgG-HRP (catalog no. sc-2005), and goat anti-rabbit IgG-HRP antibodies (catalog no. sc-2004), cholecalciferol (vitamin D3, VD3), 25-hydroxyvitamin D3 (25-OH VD3), 9-cisretinoic acid (cisRA), all-trans-retinoic acid (transRA), and Western blotting luminol reagent were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The FuGENE HD transfection reagent, TNT Quick Coupled Transcription/Translation Systems for in vitro translation of RXRα, and reporter lysis buffer were purchased from Promega (Madison, WI, USA). M-MuLV reverse transcriptase was from New England BioLabs (Ipswich, UK). DNase I was from Thermo Scientific (Waltham, MA, USA). The TRI reagent, DMSO, hygromycin B, 3,3′,5-triiodo-L-thyronine (T3), corticosterone, cortisol, betamethaReceived: Revised: Accepted: Published: 7074

March 25, 2015 July 21, 2015 July 24, 2015 July 24, 2015 DOI: 10.1021/acs.jafc.5b01519 J. Agric. Food Chem. 2015, 63, 7074−7083

Article

Journal of Agricultural and Food Chemistry

Figure 1. Map of the pGL4.14-TRE luciferase reporter plasmid. Electrophoretic Separation of Proteins and Western Blot Analyses. The total protein extracts were prepared as previously described.12 The proteins were separated on an 8% SDS-PAGE gel using the Mini-PROTEAN Tetra System (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions, followed by transfer onto a PVDF membrane. The blots were probed with primary antibodies against TRα1/α2, TRα1/β1, and RXRα. As a positive control, human recombinant TR-α1, TR-β1, and in vitro translated RXRα proteins were used. Chemiluminescent detection was performed using horseradish peroxidase-conjugated secondary antibodies against mouse and rabbit IgG and the Western blotting luminol reagent kit. Quantitative Reverse Transcriptase PCR (qRT-PCR). The total RNA was isolated using TRI reagent, and, after treatment with DNase I, the cDNA was synthesized using M-MuLV reverse transcriptase, according to the manufacturer’s instructions. qRT-PCR was performed in a LightCycler 480 II instrument (Roche Diagnostic Corp., Prague, Czech Republic), and the levels of Spot14 and GAPDH mRNAs were determined. The gene expression levels of Spot14 were normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The measurements were performed in triplicate, and the data were processed using the delta−delta method. Reporter Plasmid. The luciferase reporter plasmid that is responsive to transcriptionally active TR pGL4.14-TRE was prepared by cloning the synthesized fragment containing two copies of tandem TREs oriented as direct repeats separated by four nucleotides (DR4) with the sequence TAAGGTCATTTAAGGTCATTTAAGGTCATTTAAGGTCAA into the multiple cloning region of the promoterless pGL4.14[luc2/Hygro] vector (catalog no. E6691) from Promega. As a control for luciferase gene expression, the basic SV40 promoter

sone, aldosterone, progesterone, testosterone, estradiol, diethylstilbestrol, tributyltin chloride (TBTC), tributyltin bromide (TBTB), tributyltin iodide (TBTI), tributyltin hydroxide (TBTOH), triphenyltin chloride (TPTC), triphenyltin hydride (TPTH), and triphenyltin hydroxide (TPTOH) were purchased from Sigma-Aldrich (Prague, Czech Republic). All other chemicals were of the highest commercially available quality. Human Cell Lines. The A-172 (ECACC no. 88062428), A549 (ECACC no. 86012804), HEK293T (ECACC no. 85120602), HeLa (ECACC no. 93021013), HepG2 (ECACC no. 85011430), HOS (ECACC no. 87070202), MCF-7 (ECACC no. 86012803), MIA-PaCa-2 (ECACC no. 85062806), OACP4C (ECACC no. 11012005), SK-HEP-1 (ECACC no. 91091816), and U2OS (ECACC no. 92022711) cell lines were cultivated in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/mL penicillin, 100 μg/mL streptomycin, 4 mM L-glutamine, 1% nonessential amino acids, and 1 mM sodium pyruvate. The A2780 (ECACC no. 93112519) and LNCaP (ECACC no. 89110211) cell lines were cultivated in RPMI-1640 medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin, 100 μg/mL streptomycin, and 4 mM L-glutamine. The G-361(ECACC no. 88030401) cell line was cultivated in McCoy’s 5A medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin, 100 μg/mL streptomycin, 4 mM L-glutamine, and 1 mM HEPES. The FTC-133 (ECACC no. 94060901) cell line was cultivated in DMEM/F-12 nutrient mixture (DMEM/F-12) supplemented with 10% fetal bovine serum, 100 U/ mL penicillin, 100 μg/mL streptomycin, 4 mM L-glutamine, and 1% nonessential amino acids. All cells were cultivated at 37 °C and 5% CO2 in a humidified incubator. 7075

DOI: 10.1021/acs.jafc.5b01519 J. Agric. Food Chem. 2015, 63, 7074−7083

Article


Figure 2. Characterization of the human cell lines suitable for stable transfection with the pGL4.14-TRE luciferase reporter plasmid. (A) Western blot of endogenous TRα and TRβ in protein lysates from 15 different human cell lines. As positive controls, commercial recombinant TRα1 and TRβ1 were used. (B) Western blot of the five selected cell lines for the detection of endogenous RXRα using in vitro translated RXRα as a positive control. (C) Quantitative real-time PCR analysis of the human Spot 14 mRNA following T3 treatment in four selected cell lines. The analyses were performed after treatment of the cells with vehicle (UT; 0.1% DMSO v/v), 0.2, 2, or 20 nM T3 for 24 h, and the data were normalized to the GAPDH mRNA levels. The data are the means ± SD of triplicate measurements from three independent experiments and are expressed as the fold induction over the DMSO-treated cells. (∗) Values are significantly different from the vehicle-treated cells (p < 0.05) as determined by Student’s t test. with a deleted 5′ enhancer region was attached upstream of the TREs, and the entire insert was cloned between the KpnI and HindIII restriction sites (Figure 1). Stable Transfection of HepG2 Cells and the Selection Process. Human hepatocarcinoma HepG2 cells were seeded into 60 mm cell culture dishes at a density of 1.5 × 106 cells in 5 mL of DMEM culture medium. After 16 h of stabilization, the cells were transfected with 2 μg of the pGL4.14-TRE reporter plasmid using the FuGENE HD transfection reagent according to the manufacturer’s standard protocol. After 48 h, the culture medium was replaced by selection medium supplemented with hygromycin B (500 μg/mL). The medium was changed every 4−5 days for a period of 8 weeks, until a polyclonal population of transfected cells was selected. The cells were subsequently transferred into 10 mm cell culture dishes at a density of 100−500 cells in 10 mL of selection medium supplemented with hygromycin B (500 μg/mL) and were cultivated for an additional 5 weeks, until small colonies appeared. Thereafter, 21 colonies were isolated and transferred into 24-well tissue culture plates to obtain monoclonal populations of cells (PZ-TR cells). The stably transfected, hygromycin B-resistant clones were tested for their responsiveness to T3. The use of GMO at the Faculty of Science, Palacky University Olomouc, was approved by the Ministry of the Environment of the Czech Republic (Ref. 91997/ENV/10). Luciferase Gene Reporter Assay. The PZ-TR cells were seeded into 24-well tissue culture plates at a density of 0.15 × 106 cells in 0.5 mL of DMEM culture medium supplemented with 10% charcoal-

stripped fetal bovine serum instead of normal fetal bovine serum. After 16 h of stabilization, the cells were treated with the compounds under investigation or vehicle (0.1% DMSO or ethanol v/v) as described in the figure captions for the indicated period of time. After the treatments, the cells were lysed in reporter lysis buffer and the luciferase activity was measured using a Tecan Infinite M200 reader (Tecan, Männedorf, Switzerland). Data and Statistical Analyses. The results represent two or three independent experiments (indicated in the figure captions). The data correspond to the means ± standard deviation (SD) of triplicate measurements. Standard error of the mean (SEM) was used in the analysis of variance. Statistical significance was tested by Student’s t test or one-way analysis of variance (ANOVA) followed by Tukey’s test. Differences were considered significant at p < 0.05. The dose− response curve fits and EC50 values were determined using GraphPad Prism 5 software (GraphPad Software, San Diego, CA, USA).

■

RESULTS Selection of Human Cell Lines. Fifteen human cell lines were examined for the presence of endogenously expressed TRs. The Trα1 and TRβ1 isoforms were detected in the total protein extracts by Western blot analyses using primary antibodies against TRα1/α2 and TRα1/β1 and a secondary polyclonal goat anti-mouse IgG−HRP antibody. We preselected A2780, FTC-133, G-361, HEK293, and HepG2 cells, 7076


Article


Figure 3. Response of stably transfected clones to T3. Cells seeded into 24-well plates were stabilized for 16 h and treated with vehicle (UT; 0.1% DMSO v/v) or 10 nM T3. After 24 h (A) and 48 h (B), the cells were lysed and the luciferase activity was measured. The data correspond to the means ± SD of triplicate measurements from two independent experiments and are expressed as the relative luciferase units (RLU). The fold induction for T3 over the DMSO-treated cells is indicated above the UT-T3 pair in the bar graph.

which were identified as the cell lines with the highest levels of endogenously expressed TRs (Figure 2A). Consequently, we confirmed the presence of the main TR heterodimer partner RXRα in all five lines using a primary antibody against RXRα and a goat anti-rabbit IgG−HRP antibody (Figure 2B). Because the presence of TRs in cells does not solely provide the functionality of the mechanism responsible for TR-dependent regulation of gene expression, qRT-PCR studies were performed in preselected cell lines. The changes in levels of the human Spot 14 mRNA were measured after treatment of the cells with 0.2, 2, and 20 nM T3. We found that among the five preselected lines, the most prominent induction of Spot 14 mRNA expression was in the FTC-133 and HEK293 cells, and the level of expression was T3 dose-dependent (Figure 2C). T3-induced Spot 14 mRNA expression was observed also in HepG2 cells, but its intensity was lower (Figure 2C). According to these results, we designated the FTC-133, HEK293, and HepG2 cell lines to be suitable candidates that met the criteria for successful transfection with prepared reporter plasmid. Transfection and Selection of Clones. Before stable transfection, the susceptibility of the selected cell lines to

transfection with the pGL4.14-TRE reporter plasmid was tested. The results of the luciferase reporter assays from the transient transfections showed that luciferase activity was induced only in the transiently transfected HepG2 cells following the 10 nM T3 treatment, but not in the FTC-133 or HEK293 cells (data not shown). Therefore, the HepG2 human hepatocellular carcinoma cells were used to construct the stably transfected reporter cell line for the assessment of thyroid receptor transcriptional activity. After transfecting the HepG2 cells with the pGL4.14-TRE reporter plasmid and cultivating them under the selection pressure of hygromycin B, we obtained 21 hygromycin B-resistant, stably transfected clones. All isolated clones were tested for their responsivity to T3. We found that after 24 and 48 h of treatment with 10 nM T3, luciferase activity was significantly induced in only three clones, ranging from 2.5- to 3.5-fold induction (Figure 3). However, the relative luciferase units (RLU) in clones 9 and 18 were too low for their practical use in the experiments; thus, clone 4 (termed PZ-TR) was selected as the most reliable candidate and was further characterized. 7077


Article

Journal of Agricultural and Food Chemistry Characterization of PZ-TR Cell Line. In the first step, we characterized the dose-dependent response of the PZ-TR cell line to T3. PZ-TR cells were treated with increasing concentrations of T3 (0.1−1000 nM), which yielded typical sigmoid logarithmic dose−response curves (Figure 4).

Figure 5. Effect of cryopreservation on functionality of the PZ-TR cell line. Fresh cells and frozen−thawed cells were grown on 24-well plates, stabilized for 16 h, and treated with vehicle (UT; 0.1% DMSO v/v) or 10 nM T3. After the treatments, the cells were lysed and the luciferase activity was measured. The data correspond to the means ± SD of triplicate measurements from two independent experiments and are expressed as relative luciferase units (RLU). The fold induction for T3 over the DMSO-treated cells was calculated, and the value is indicated above the UT-T3 pair in the bar graph.

Figure 4. Dose−response of the PZ-TR cell line to T3. Cells seeded into 24-well plates were stabilized for 16 h and treated with vehicle (0.1% DMSO v/v) or T3 (0.1−1000 nM) for 24 and 48 h. After the treatments, the cells were lysed and the luciferase activity was measured. The data represent the means ± SD of triplicate measurements from three independent experiments and are expressed as the fold induction of T3 over the DMSO-treated cells.

Table 1. Maintenance of Luciferase Inducibility by 10 nM T3

Prolonged exposure of the cells to T3 (48 h) resulted in a higher maximum induction of luciferase activity (3.25-fold) compared to cells treated for 24 h (2.73-fold). The T3-induced luciferase activity started to reach its maximum at concentrations of 10−50 nM, and the calculated EC50 values corresponded to 1.91 ± 0.30 nM for the 24 h treatment and 0.97 ± 0.16 nM for the 48 h treatment. As a second parameter, the PZ-TR cell line was cryopreserved to test the effects of this treatment of cellular functionality. The cells were frozen in fetal bovine serum and the cryoprotectant DMSO using a standard procedure and were stored for 1 week in liquid nitrogen. The thawed cells were treated with 10 nM T3 for 24 h, and the luciferase activity was measured. We found that after the freeze−thaw cycle, the RLU values in the cryopreserved cells decreased slightly, but the luciferase activity was induced to the same level as in the fresh cells (Figure 5). The maintenance of luciferase inducibility is another important feature of the newly prepared reporter cell line that is required for its practical use. Therefore, we studied the ability of PZ-TR cell line to respond to T3 over a long period. The cells were treated with 10 nM T3 for 24 h every third passage, and the luciferase activity was measured. The induction of luciferase activity was stable for 54 days (corresponding to 12 passages), and there was no substantial decrease in the T3induced luciferase activity in both the absolute RLU values and the fold induction (Table 1). Finally, we compared the morphology of the stably transfected PZ-TR cells and parental HepG2 cells. We did not observe any significant differences in the morphology of the PZ-TR and HepG2 cells, even after maintaining the cells in culture for 10 passages (Figure 6).

passage no.

days in culture

0 3 6 9 12

4 16 29 41 54

RLU ± SD

fold

± ± ± ± ±

2.46 2.57 2.73 2.42 2.45

12415 9205 11344 8944 8954

1109 68 954 520 276

Responsiveness of the PZ-TR Cell Line to Diverse Hormonal Treatments. Thyroid receptors belong to the subfamily of nuclear receptors, and their activity is regulated by thyroid hormone ligand binding. Therefore, it was necessary to demonstrate the ability of PZ-TR cells to be specifically induced by TH and exclude the possibility of luciferase activity induction by other hormones. The PZ-TR cells were treated with steroid hormones and ligands for nuclear receptors in concentrations ranging from 0.1 to 10 μM for 24 h. We did not observe any substantial changes in the luciferase activity after the application of corticosteroids (corticosterone, cortisol, betamethasone, and aldosterone), sex steroid hormones (progesterone, testosterone, estradiol, and diethylstilbestrol), and VDR ligands (25-hydroxyvitamin D3 and vitamin D3) (Figure 7). The application of 9-cis-retinoic acid (cisRA) induced a significant increase of luciferase activity in the PZ-TR cells. The luciferase activity was dose-dependently induced and ranged from 1.61-fold at 1 μM to 2.27-fold at 10 μM (Figure 7). These values corresponded to 56% (1 μM) and 83% (10 μM) of the level of induction obtained after treatment with 10 nM T3. These findings were in accord with our expectation that cisRA, a ligand of RXR (the main heterodimer partner of TR), might partially induce luciferase activity in the PZ-TR cells. Surprisingly, increased luciferase activity was detected also after treatment with all-trans-retinoic acid (transRA). The luciferase activity was again dose-dependently induced, but the intensity was lower than that of cisRA, ranging from 1.26-fold at 1 μM to 1.82-fold at 10 μM (Figure 7). These values corresponded to 7078


Article


Figure 6. Morphology of the HepG2 and PZ-TR cell lines. Phase contrast micrographs of the parental HepG2 cells at the eighth passage (A) and the PZ-TR reporter cells at the 10th passage (B).

Figure 7. Response of the PZ-TR cell line to hormones. Cells seeded into 24-well plates were stabilized for 16 h and treated with vehicle (UT; 0.1% DMSO v/v) or the different hormones for 24 h. After the treatments, the cells were lysed and the luciferase activity was measured. The data represent the means ± SEM of triplicate measurements from three independent experiments and are expressed as the fold induction of the hormonetreated cells over the DMSO-treated cells. (∗) Values are significantly different from the vehicle-treated cells (p < 0.05) as determined by ANOVA followed by Tukey’s test.

46% (1 μM) and 67% (10 μM) of the levels of induction obtained after treatment with 10 nM T3. Responsivity of the PZ-TR Cell Line to Retinoic Acids. To explain the luciferase activity that was induced in the PZ-TR cell line after RA application, we studied the effect of RAs in more detail. PZ-TR cells were treated with cisRA and transRA in concentrations of 0.1, 1, and 10 μM, alone and in combination with 10 nM T3. After 24 h of treatment, both cisRA and transRA induced a significant increase in luciferase activity in the PZ-TR cells at 1 and 10 μM (Figure 8), similar to previous experiments (see Responsiveness of the PZ-TR Cell Line to Diverse Hormonal Treatments.). The luciferase activity was dose-dependently induced, with the highest intensities of 2.27-fold at 10 μM cisRA and 2.03-fold at 10 μM transRA. These values corresponded to 93% (10 μM cisRA) and 83% (10 μM transRA) of the level of induction obtained after treatment with 10 nM T3. The luciferase activity was induced 2.45-fold in the PZ-TR control cells treated with 10 nM T3 (Figure 8). In cells treated for 24 h with combinations of RAs and 10 nM T3, we observed a slight inhibition of luciferase activity by 0.1 μM cisRA and 0.1 μM transRA compared to the control cells treated with 10 nM T3 (Figure 8). However, the differences

were statistically significant only in the case of cisRA. The 2.11fold (0.1 μM cisRA + 10 nM T3) and 2.35-fold inductions (0.1 μM transRA + 10 nM T3) corresponded to 86 and 96% of the level of induction obtained after treatment with 10 nM T3, respectively. In contrast, 10 μM cisRA and 10 μM transRA enhanced the effect of 10 nM T3, with 3.15-fold (10 μM cisRA + 10 nM T3) and 2.79-fold (10 μM transRA + 10 nM T3) inductions, representing 129 and 114% of the level of induction of the control cells treated with 10 nM T3, respectively (Figure 8). Application of 1 μM cisRA and 1 μM transRA in combination with 10 nM T3 did not significantly affect the induction of luciferase activity compared to the 10 nM T3treated PZ-TR cells (Figure 8). To determine whether RAs are able to trigger the expression of TR-inducible genes or if this phenomenon is specific only for the induction of luciferase activity in the novel PZ-TR cell line, qRT-PCR studies were performed to monitor the changes in the expression of human Spot 14 gene. The levels of the Spot 14 mRNA were measured 24 h after treatment of the cells with 0.1, 1, and 10 μM T3. We found that both cisRA and transRA induced the expression of the Spot 14 gene in the PZ-TR cells (Figure 9). Whereas significant increases of the mRNA levels were observed only in the cisRA-treated cells at the 1 and 10 7079


Article


(TH-regulated gene) can be activated by both cisRA and transRA. Effect of Organic Tin Compounds on the Transcriptional Activity of TR. We studied the effect of two groups of organic tin compounds on the transcriptional activity of TR using the novel PZ-TR reporter cell line. The first group was represented by the tributyltin derivatives TBTC, TBTB, TBTI, and TBTOH. PZ-TR cells were treated with the studied compounds at concentrations of 1, 10, and 100 nM (higher concentrations had a strong cytotoxic effect, data not shown) for 24 h. After application of all four tested tributyltin derivatives, we observed a significant increase of luciferase activity at the 10 and 100 nM concentrations (Figure 10A). The luciferase activity was dose-dependently induced and ranged from 1.60- to 1.90-fold for TBTC, from 1.29- to 1.30fold for TBTB, from 1.33- to 1.48-fold for TBTI, and from 1.37- to 1.53-fold for TBTOH. These values corresponded to 36−54% (TBTC), 17−18% (TBTB), 20−29% (TBTI), and 22−32% (TBTOH) of the level of induction attained after treatment with 10 nM T3. In parallel experiments, we studied the possible effects of the tributyltin derivatives on the transcriptional activity of TR in the presence of T3, the natural ligand of TR. PZ-TR cells were treated with the examined compounds at concentrations of 1, 10, and 100 nM in combination with 10 nM T3 for 24 h. After the treatments, we observed only slight and statistically insignificant changes in luciferase activity compared to the control cells treated with 10 nM T3, in which the luciferase activity was induced by approximately 2.68-fold (Figure 10B). The luciferase activity was induced from 2.58- to 2.84-fold for TBTC, from 2.82- to 2.91-fold for TBTB, from 2.87- to 2.91fold for TBTI, and from 2.98- to 3.07-fold for TBTOH, and these inductions corresponded to 94−110% (TBTC), 108− 114% (TBTB), 111−114% (TBTI), and 118−123% (TBTOH) of the level of induction attained after treatment with 10 nM T3 alone. The second group of examined compounds contained three triphenyltin derivatives, TPTC, TPTH, and TPTOH. The PZTR cells were similarly treated with the studied compounds in concentrations of 1, 10, and 100 nM (higher concentrations had a strong cytotoxic effect, data not shown) for 24 h. We observed an increase in luciferase activity after application of all three tested compounds (Figure 10C). The luciferase activity was dose-dependently induced and reached highest statistically significant values at the 100 nM concentration. The luciferase activity was induced 1.57-fold for TPTC, 1.68-fold for TPTH, and 1.70-fold for TPTOH. These values corresponded to 33% (TPTC), 39% (TPTH), and 40% (TPTOH) of the level of induction attained after treatment with 10 nM T3. In parallel experiments, the PZ-TR cells were treated with the tested compounds in concentrations of 1, 10, and 100 nM in combination with 10 nM T3 for 24 h. After the treatments, we observed an increase of luciferase activity compared to the control cells treated with 10 nM T3, in which the luciferase activity was induced by approximately 2.74-fold (Figure 10D). The differences were more prominent than in the cells treated with the tributyltin derivatives. The luciferase activity was significantly induced by 3.26−3.36-fold for TPTC, 3.29−3.54fold for TPTH, and 3.40−3.47-fold for TPTOH, and these values corresponded to 130−136% (TPTC), 132−146% (TPTH), and 138−142% (TPTOH) of the level of induction attained after treatment with 10 nM T3 only.

Figure 8. Response of the PZ-TR cell line to retinoic acids. Cells seeded into 24-well plates were stabilized for 16 h and treated for 24 h with vehicle (UT; 0.1% DMSO v/v), 9-cis-retinoic acid, or all-transretinoic acid, alone and in combination with 10 nM T3. The cells were lysed, and the luciferase activity was measured. The data represent the means ± SEM of triplicate measurements from three independent experiments and are expressed as the fold induction over the DMSOtreated cells. (∗) Values are significantly different from the vehicletreated cells (p < 0.05) as determined by ANOVA followed by Tukey’s test. (∗∗) Values are significantly different from the 10 nM T3-treated cells (p < 0.05) as determined by ANOVA followed by Tukey’s test.

Figure 9. Quantitative real-time PCR analysis of the human Spot 14 mRNA levels following retinoic acid treatment in the PZ-TR cell line. Cells were treated with vehicle (UT; 0.1% DMSO v/v), 9-cis-retinoic acid, or all-trans-retinoic acid for 24 h. The measurements were normalized to the GAPDH mRNA levels. The data are the means ± SD of triplicate measurements from three independent experiments and are expressed as the fold induction over the DMSO-treated cells. (∗) Values are significantly different from the vehicle-treated cells (p < 0.05) as determined by Student’s t test.

μM concentrations (2.46- and 1.69-fold, respectively), transRA induced a significant increase of the mRNA levels at all tested concentrations. The transRA-induced expression of the Spot 14 mRNA was dose-dependent, with 2.18-fold (0.1 mM), 2.44-fold (1 mM), and 2.46-fold (10 mM) inductions. Although the increased mRNA levels reached a maximum of 62−63% (1 μM cisRA, 1 μM transRA, and 10 μM transRA) of the mRNA level detected after treatment of the PZ-TR cells with 10 nM T3, we provide clear evidence that the expression of human Spot 14 7080


Article


Figure 10. Effects of organic tin compounds on the transcriptional activity of TR in the PZ-TR reporter cell line. Cells seeded into 24-well plates were stabilized for 16 h and treated with vehicle (UT; 0.1% DMSO or ethanol v/v), tributyltin derivatives (TBTC, TBTB, TBTI, TBTOH) (A), or triphenyltin derivatives (TPTC, TPTH, TPTOH) (C), alone and in combination with 10 nM T3 (B, D). After 24 h, the cells were lysed and the luciferase activity was measured. The data represent the means ± SEM of triplicate measurements from three independent experiments and are expressed as the fold induction over the vehicle-treated cells. (∗) Values are significantly different from the vehicle-treated cells (p < 0.05) as determined by ANOVA followed by Tukey’s test. (∗∗) Values are significantly different from the 10 nM T3-treated cells (p < 0.05) as determined by ANOVA followed by Tukey’s test.

■

DISCUSSION

transfection. There are many paper describing the development of gene reporter systems derived from yeast,15,18,19 amphibian,6 mammalian,7−10,20,21 or human14,21−23 cell lines for screening endocrine disruptors. Because gene reporter systems play such a crucial role, the presence of a functional receptor and the high variability and natural characteristics of the parental cell lines used for construction of such systems often result in the necessity of additional cotransfections. In particular, the introduction of an expression plasmid encoding the receptor of interest is required in yeast-derived reporter systems.15,17,19 However, cotransfection with the appropriate receptor construct is also essential in animal9,20,21 and human16,22,23 cell line-derived gene reporter systems when the parental cells lack adequate endogenous expression of the receptor. These manipulations may lead to changes in the stoichiometric ratio between the introduced receptor protein, which is usually overexpressed, and other transcriptional regulators, and does not reflect the natural situation. Although the construction of a stable gene reporter cell line is time- and material-consuming process, the prospective long-

It is known that a large group of natural and synthetic compounds, generally termed endocrine disruptors, can interfere with the endocrine system and disrupt the homeostasis of the processes that regulate hormones in humans. Several in vitro models have been developed to screen for substances that may potentially disrupt the hormone system.13 Among them, reporter gene-based assays have been widely used as reliable tools to detect various biologically active compounds in many environmental and biological applications. The construction of reporter gene systems is based on transient or stable transfection of cells with a reporter plasmid that contains a domain that binds a hormonal receptor (response element) and a reporter gene located downstream. Different genes, such as those coding for proteins such as luciferase,14 galactosidase,15 chloramphenicol acetyl transferase,16 and green fluorescent protein,17 are usually used as reporter genes because their activities can easily be measured. There is also a large diversity in the selection of cells or cell lines used for 7081


Article

Journal of Agricultural and Food Chemistry Funding

term advantages of this type of system are indisputable. Stable gene reporter systems are characterized by highly sensitive assays, good reproducibility of the results, homogeneity of the data, and no need for additional normalization, which permits high-throughput and low-cost experimentation. Large-scale stable reporter cell lines have been constructed for the detection of potential hormonal disruptors using mainly corticosteroids and sex steroid hormones. In an effort to expand the field of research of endocrine disruptors to the thyroid axis, several stable luciferase reporter systems have been developed over the past decade. The thyroid hormoneresponsive gene reporter cell line XL58-TRE-Luc was constructed by introducing LV-TRE-Luc, a self-inactivating lentivirus vector containing the luciferase reporter gene downstream of the Xenopus laevis TRE, into Xenopus laevis XL58 cells.6 XL58-TRE-Luc was used by the authors to study the effects of chlorinated derivatives of bisphenol A on the TR transcriptional activity, revealing their possible influence on TRregulated gene expression. Soon after, Jugan and co-workers developed a new stable reporter cell line, PC-DR-LUC, which allowed them to measure the effects of putative thyroiddisrupting chemicals on the modulation of TRα1 transcriptional activity.7 The reporter cell line was derived from rat PC12 cells expressing TRα1 of avian origin by transfecting the cells with a pGL3-DR4 reporter plasmid carrying four TRE half-sites separated by four nucleotides located upstream of the luciferase gene. Using the PC-DR-LUC cell line, the authors determined the influence of several halogenated phenolic and phenol compounds on the transcriptional activity of TRα1. Later, the PC-DR-LUC cell line was successfully used to evaluate the thyroid-disrupting potential of water from wastewater treatment plants, rivers, and drinking water supplies.24 Recently, a novel reporter cell line, GH3-TRE.Luc, has been developed to detect TR disruptors.8 The rat GH3 cell line constitutively expressing both isoforms of TR was stably transfected with the pGL4CP-SV40-2xtaDR4 construct containing two TREs upstream of the firefly luciferase gene. The authors used the GH3-TRE reporter cell line to test hydroxylated polybrominated diphenyl ethers, hydroxylated polychlorinated biphenyls, and halogenated derivatives of bisphenol A as chemicals with potential thyroid-disrupting effects. Because TH-mediated signaling in amphibian and rodent cells can be substantially different from signaling in human cells,25 it is of great interest to establish a reporter cell line to assess the thyroid receptor transcriptional activity based on the human system. We developed and described a new stably transfected gene reporter cell line, PZ-TR. The PZ-TR cell line presented here is an exclusively human system derived from HepG2 human hepatocellular carcinoma cells, which endogenously expresses both isoforms of TR (Figure 2). The stable transfection with a reporter gene driven by TRE from the human gene needs no additional cotransfections with a TR expression vector, guarantees the preservation of the stoichiometric ratio between the TR receptor and other transcriptional regulators, and reflects natural situations. These characteristics demonstrate significant advancements for the PZ-TR cell line compared to as yet developed cell lines.

■

This work was supported by the European Social Fund and the Ministry of Education, Youth and Sports of the Czech Republic, Project CZ.1.07/2.3.00/30.0004 (POST-UP), CEMAN grants, a grant from the Slovak Research and Development Agency, APVV-0160-11, and a grant from the Czech Scientific Agency, GACR 303/12/G163. Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED 25-OH VD3, 25-hydroxyvitamin D3; cisRA, 9-cis-retinoic acid; DR4, direct repeat separated by four nucleotides; RA, retinoic acid; RXR, retinoic X receptor; T3, 3,3′,5-triiodo-L-thyronine; T4, L-thyroxine; TBTB, tributyltin bromide; TBTC, tributyltin chloride; TBTI, tributyltin iodide; TBTOH, tributyltin hydroxide; TH, thyroid hormone; TPTC, triphenyltin chloride; TPTH, triphenyltin hydride; TPTOH, triphenyltin hydroxide; TR, thyroid receptor; transRA, all-trans-retinoic acid; TRE, thyroid hormone response element; VD3, vitamin D3; VDR, vitamin D3 receptor

■

REFERENCES

(1) Zoeller, R. T. Environmental chemicals as thyroid hormone analogues: new studies indicate that thyroid hormone receptors are targets of industrial chemicals? Mol. Cell. Endocrinol. 2005, 242, 10−15. (2) Boas, M.; Feldt-Rasmussen, U.; Skakkebaek, N. E.; Main, K. M. Environmental chemicals and thyroid function. Eur. J. Endocrinol. 2006, 154, 599−611. (3) Murk, A. J.; Rijntjes, E.; Blaauboer, B. J.; Clewell, R.; Crofton, K. M.; Dingemans, M. M. L.; Furlow, J. D.; Kavlock, R.; Köhrle, J.; Opitz, R.; Traas, T.; Visser, T. J.; Xia, M.; Gutleb, A. C. Mechanism-based testing strategy using in vitro approaches for identification of thyroid hormone disrupting chemicals. Toxicol. In Vitro 2013, 27, 1320−1346. (4) Wauters, J.; Vanden Bussche, J.; Bizec, B. L.; Kiebooms, J. A.; Dervilly-Pinel, G.; Prevost, S.; Wozniak, B.; Sterk, S. S.; Grønningen, D.; Kennedy, D. G.; Russell, S.; Delahaut, P.; Vanhaecke, L. Toward a new European threshold to discriminate illegally administered from naturally occurring thiouracil in livestock. J. Agric. Food Chem. 2015, 63, 1339−1346. (5) Wang, C. H.; Lin, J. H.; Lu, T. J.; Chiang, A. N.; Chiou, S. T.; Chen, Y. A.; Pan, M. H.; Hsieh, S. C. Establishment of reporter platforms capable of detecting NF-κB mediated immuno-modulatory activity. J. Agric. Food Chem. 2013, 61, 12582−12587. (6) Sugiyama, S.; Miyoshi, H.; Yamauchi, K. Characteristics of a thyroid hormone responsive reporter gene transduced into a Xenopus laevis cell line using lentivirus vector. Gen. Comp. Endocrinol. 2005, 144, 270−279. (7) Jugan, M. L.; Lévy-Bimbot, M.; Pomérance, M.; TamisierKarolak, S.; Blondeau, J. P.; Lévi, Y. A new bioluminescent cellular assay to measure the transcriptional effects of chemicals that modulate the α-1 thyroid hormone receptor. Toxicol. In Vitro 2007, 21, 1197− 1205. (8) Freitas, J.; Cano, P.; Craig-Veit, C.; Goodson, M. L.; Furlow, J. D.; Murk, A. J. Detection of thyroid hormone receptor disruptors by a novel stable in vitro reporter gene assay. Toxicol. In Vitro 2011, 25, 257−266. (9) Schriks, M.; Roessig, J. M.; Murka, A. J.; Furlow, J. D. Thyroid hormone receptor isoform selectivity of thyroid hormone disrupting compounds quantified with an in vitro reporter gene assay. Environ. Toxicol. Pharmacol. 2007, 23, 302−307. (10) Sun, H.; Shen, O.-X.; Wang, X.-R.; Zhou, L.; Zhen, S.-Q; Chen, X.-D. Anti-thyroid hormone activity of bisphenol A, tetrabromobisphenol A and tetrachlorobisphenol A in an improved reporter gene assay. Toxicol. In Vitro 2009, 23, 950−954.

AUTHOR INFORMATION

Corresponding Author

*(Z.D.) E-mail: [email protected]. 7082


Article

Journal of Agricultural and Food Chemistry (11) Ferreira, M.; Blanco, L.; Garrido, A.; Vieites, J. M.; Cabado, A. G. In vitro approaches to evaluate toxicity induced by organotin compounds tributyltin (TBT), dibutyltin (DBT), and monobutyltin (MBT) in neuroblastoma cells. J. Agric. Food Chem. 2013, 61, 4195− 4203. (12) Novotna, A.; Srovnalova, A.; Svecarova, M.; Korhonova, M.; Bartonkova, I.; Dvorak, Z. Differential effects of omeprazole and lansoprazole enantiomers on aryl hydrocarbon receptor in human hepatocytes and cell lines. PLoS One 2014, 9, e98711. (13) Charles, G. D. In vitro models in endocrine disruptor screening. ILAR J. 2004, 45, 494−501. (14) Novotna, A.; Pavek, P.; Dvorak, Z. Construction and characterization of a reporter gene cell line for assessment of human glucocorticoid receptor activation. Eur. J. Pharm. Sci. 2012, 47, 842− 847. (15) Gaido, K. W.; Leonard, L. S.; Lovell, S.; Gould, J. C.; Babaï, D.; Portier, C. J.; McDonnell, D. P. Evaluation of chemicals with endocrine modulating aktivity in a yeast-based steroid hormone receptor gene transcription assay. Toxicol. Appl. Pharmacol. 1997, 143, 205−212. (16) Tully, D. B.; Cox, V. T.; Mumtaz, M. M.; Davis, V. L.; Chapin, R. E. Six high-priority organochlorine pesticides, either singly or in combination, are nonestrogenic in transfected HeLa cells. Reprod. Toxicol. 2000, 14, 95−102. (17) Bovee, T. F. H.; Helsdingen, R. J. R.; Koks, P. D.; Kuiper, H. A.; Hoogenboom, R. L. A. P.; Keijer, J. Development of a rapid yeast estrogen bioassay, based on the expression of green fluorescent protein. Gene 2004, 325, 187−200. (18) O’Connor, J. C.; Davis, L. G.; Frame, S. R.; Cook, J. C. Evaluation of a tier I screening battery for detecting endocrine-active compounds (EACs) using the positive controls testosterone, coumestrol, progesterone, and RU486. Toxicol. Sci. 2000, 54, 338− 354. (19) Sugawara, T.; Nakajima, A.; Nomura, E. Development of a simple screening system for endocrine disruptors. Med. Sci. Monit. 2002, 8, BR431−438. (20) Vinggaard, A. M.; Joergensen, E. C.; Larsen, A. C. Rapid and sensitive reporter gene assays for detection of antiandrogenic and estrogenic effects of environmental chemicals. Toxicol. Appl. Pharmacol. 1999, 155, 150−160. (21) Hartig, P. C.; Bobseine, K. L.; Britt, B. H.; Cardon, M. C.; Lambright, C. R.; Wilson, V. S.; Gray, L. E., Jr. Development of two androgen receptor assays using adenoviral transduction of MMTV-luc reporter and/or hAR for endocrine screening. Toxicol. Sci. 2002, 66, 82−90. (22) Charles, G. D.; Bartels, M. J.; Freshour, N. L.; Zacharewski, T. R.; Gollapudi, B. B.; Carney, E. W. Activity of benzo[a]pyrene and its hydroxylated metabolites in an ER-α reporter gene assay. Toxicol. Sci. 2000, 55, 320−326. (23) Térouanne, B.; Tahiri, B.; Georget, V.; Belon, C.; Poujol, N.; Avances, C.; Orio, F., Jr.; Balaguer, P.; Sultan, C. A stable prostatic bioluminescent cell line to investigate androgen and antiandrogen effects. Mol. Cell. Endocrinol. 2000, 160, 39−49. (24) Jugan, M. L.; Oziol, L.; Bimbot, M.; Huteau, V.; TamisierKarolak, S.; Blondeau, J. P.; Lévi, Y. In vitro assessment of thyroid and estrogenic endocrine disruptors in wastewater treatment plants, rivers and drinking water supplies in the greater Paris area (France). Sci. Total Environ. 2009, 407, 3579−3587. (25) Darras, V. M.; Houbrechts, A. M.; Van Herck, S. L. J. Intracellular thyroid hormone metabolism as a local regulator of nuclear thyroid hormone receptor-mediated impact on vertebrate development. Biochim. Biophys. Acta, Gene Regul. Mech. 2015, 1849, 130−141.

7083


Development and Characterization of a Human Reporter Cell Line for

Recommend Documents