Development and Validation of MRM Methods to ... - ACS Publications

Article pubs.acs.org/jpr

Development and Validation of MRM Methods to Quantify Protein Isoforms of Polyphenol Oxidase in Loquat Fruits Ascensión Martínez-Márquez,† Jaime Morante-Carriel,†,‡ Susana Sellés-Marchart,§ María José Martínez-Esteso,† José Luis Pineda-Lucas,⊥ Ignacio Luque,∥ and Roque Bru-Martínez*,† †

Plant Proteomics and Functional Genomics Group, Department of Agrochemistry and Biochemistry, Faculty of Science, University of Alicante, E-03080 Alicante, Spain ‡ Biotecnology and Molecular Biology Group, Quevedo State Technical University, Quevedo EC-120501, Ecuador § Research Technical Facility, Proteomics and Genomics Division, University of Alicante, E-03080 Alicante, Spain ∥ Institute of Plant Biochemistry and Photosynthesis, University of Seville-CSIC, Av. A. Vespucio 49, 41092-Seville, Spain ⊥ Laboratorio Químico-Microbiológico, S.A., Poligono Industrial Oeste (Cl Principal), 21 - PAR 21/1, 30169 Murcia, Spain S Supporting Information *

ABSTRACT: Multiple reaction monitoring (MRM) is emerging as a promising technique for the detection and quantification of protein biomarkers in complex biological samples. Compared to Western blotting or enzyme assays, its high sensitivity, specificity, accuracy, assay speed, and sample throughput represent a clear advantage for being the approach of choice for the analysis of proteins. MRM assays are capable of detecting and quantifying proteolytic peptides differing in mass unique to particular proteins, that is, proteotypic peptides, through which different protein isoforms can be distinguished. We have focused on polyphenol oxidase (PPO), a plant conspicuous enzyme encoded by a multigenic family in loquat (Eriobotrya japonica Lindl.) and other related species. PPO is responsible for both the protection of plants from biotic stress as a feeding deterrent for herbivore insects and the enzymatic browning of fruits and vegetables. The latter makes fruit more attractive to seed dispersal agents but is also a major cause of important economic losses in agriculture and food industry. An adequate management of PPO at plant breeding level would maximize the benefits and minimize the disadvantages of this enzyme, but it would require a precise knowledge of the biological role played by each isoform in the plant. Thus, for the functional study of the PPOs, we have cloned and overexpressed fragments of three PPO isoforms from loquat to develop MRM-based methods for the quantification of each isoform. The method was developed using an ion trap instrument and validated in a QQQ instrument. It resulted in the selection of at least two peptides for each isoform that can be monitored by at least three transitions. A combination of SDS-PAGE and MRM lead to detect two out of three monitored isoforms in different gel bands corresponding to different processing stages of PPO. The method was applied to determine the amount of the PPO2 isoform in protein extracts from fruit samples using external calibrants. KEYWORDS: multiple reaction monitoring, transitions, polyphenol oxidase, loquat fruits, isoform

1. INTRODUCTION Selected/multiple reaction monitoring (SRM/MRM) is an emerging technology in proteomics that ideally complements the discovery capabilities of shotgun strategies by its unique potential for reliable quantification of analytes of low abundance in complex mixtures.1 Therefore, MRM is a methodology that has found a broad application in protein biomarker assays in complex biological samples2 that can be achieved knowing the protein of interest. In the recent years, MRM has become the method of choice for targeted quantitative proteomics in the plant science community3 for being a highly selective, sensitive, and robust assay to monitor the presence and amount of biomolecules as proteins.4 In © 2013 American Chemical Society

contrast, other assays such as enzymatic activity and Western blotting endow shortfalls that introduce uncertainty in the assay results. Enzyme assays in crude extracts are contributed by the activity of the different isoforms, and such contribution cannot be resolved in a straightforward manner. Western blotting techniques would resolve the isoform heterogeneity in complex samples provided that highly isoform specific antibodies are developed, which would demand extensive resources and time; however, this is not always possible. MRM based assays could overcome those shortfalls by directly detecting and quantifying Received: July 3, 2013 Published: November 18, 2013 5709

dx.doi.org/10.1021/pr4006712 | J. Proteome Res. 2013, 12, 5709−5722

Journal of Proteome Research

Article

species, including apple, pear, quince, peach, and loquat, was demonstrated with an antibody raised against a purified preparations of apple PPO.16 This demonstrates the existence of genetic basis16−19 and experimental evidence15−21 supporting the occurrence of different isoforms of PPO, in the same tissue and stage of development, but also at different stages of development. The objective of this study was to develop a suitable tool based in MRM to analyze the diversity and abundance of PPOs in loquat fruit at the protein level. To that goal we have cloned and overexpressed fragments of three PPO isoforms from loquat and used them to experimentally select isoform-specific transitions. Method development was accomplished using an ion trap instrument and validated in a QqQ instrument run in MRM mode. As a result, at least two proteotypic peptides per isoform, each monitored by at least three transitions, were established. A combination of SDS-PAGE and MRM lead to the detection of two out of three monitored isoforms in different gel bands corresponding to different processing stages of PPO. Using the recombinant purified PPOs as an external calibrant the amount of the PPO2 isoform as different protein processing products was determined in a loquat protein sample.

proteolytic peptides unique to particular protein(s)/isoform(s), that is, proteotypic peptides5 at protein/isoform level, with high sensitivity, specificity, accuracy, assay speed, and sample throughput. Workflows for SRM/MRM are based in targeted proteomics in which only preselected peptides are analyzed. The MRM are assays typically run on a triple quadrupole mass spectrometer (QqQ), although this methodology may also be practiced in an ion trap instrument where, upon fragmentation of a precursor ion, MS/MS data are acquired on a partial mass range centered on a fragment ion (pseudo-SRM)1 or on the full mass range (multiple products monitoring: MpM).6 A series of transitions (precursor/fragment ion m/z pairs) in combination with the retention time of the targeted peptide can constitute an LCMRM assay.1 Previous information is required and critical to define these transitions. First, the targeted protein set has to be selected. Second, for each targeted protein, those peptides that present good MS and MS/MS signals and are proteotypic (if a specific assay is sought) have to be identified and selected. Third, for each selected peptide, those fragment ions that provide optimal signal intensity and discriminate the target peptide from other species present in the sample have to be identified.1 The selected monitoring and double selection criteria (precursor/fragment ions) provide high specificity for peptide selections since only desired transitions are recorded and other signals present in the sample are set to ignore. This setup provides high analytical reproducibility, an improved signal-to-noise, and an increased dynamic range,2 that may enable the detection of low-abundance proteins in highly complex mixtures. Typical applications of MRM assays have focused on clinical diagnosis and include detection and quantification low abundance proteins,1,7 validations of biomarker candidates, and phospho-proteomics analysis.8 Here we apply this technology in plant biochemistry and physiology to develop a tool to investigate polyphenol oxidase (PPO) isoforms in loquat fruits. PPOs are ubiquitous plant enzymes that catalyze the O-dependent oxidation of mono- and o-diphenols to o-quinones. The oxidation of phenolic substrates by PPO is responsible for the enzymatic browning of fruits and vegetables,9,10 making them more attractive to seed dispersal agents but also being a major cause of important economical losses in agriculture and food industry.9,11 Changes in both appearance and organoleptic properties,12 usually accompanied by the release of odors and negative effects on the nutritional value,13,14 cause the loss of quality and commercial value of the fruit and fruit-derived products. PPO also protects plants from biotic stress,10 thus having a benefit on agriculture. Since plant PPOs are encoded by multigenic families,15−20 an adequate management of PPO at plant breeding level would maximize the agricultural benefits and minimize the food industrial disadvantages of this enzyme; however, it would require a precise knowledge of the biological role played by each isoform in the plant. PPO encoding multigene families have been demonstrated to occur in several species, including tree plants of the Rosaceae family such as loquat (Eriobotrya japonica Lindl.).15,16 The expression of PPO genes has been shown to be regulated both developmentally and following a variety of stress conditions in a number of species:16−21 also the simultaneous expression of two or more genes in the same tissue at the same developmental stage has been described.15,18 In addition, the presence of several protein bands in the molecular weight range from 55 to 66 kDa, in fruits and leaves of various Rosaceae

2. EXPERIMENTAL SECTION 2.1. Plant Material

Loquat fruits (Eriobotrya japonica Lindl.) were picked at different stages of development and ripening from trees ́ cropped in the experimental orchards of Cooperativa Agricola de Callosa d’En Sarrià, located in a semiarid zone in Alicante, Spain. Picking stages were green, optimal harvest time, and ripe, which corresponded approximately to 5, 9, and 10 weeks after fruit set. The fruits were kept at −20 °C until use. Postharvest conditions were attained by keeping at room temperature intact fresh fruits detached at optimal harvesting time for 15 days. Fruit bruising was attained by hitting intact fresh fruits detached at optimal harvesting time with a sphere of 50 g in free fall from a height of 20 cm. Each fruit was beaten in four different positions and allowed to stand for 48 h at room temperature for most of the flesh to be affected by bruising. Fruits submitted to postharvest or bruising stress were immediately processed for protein extraction. 2.2. Reagents

The reagents were purchased from Sigma-Aldrich, including protease inhibitor cocktail for general use (4-(2-aminoethyl)benzenesulfonyl fluoride (AEBSF) 2.0 mM; EDTA 1.0 mM; bestatin 130 μM; E-64 14 μM; leupeptin 1.0 μM; and aprotinin 0.3 μM). Trypsin was purchased from Promega (Madison WI). 2.3. Sample Preparation and Protein Assay

Purified recombinant PPO proteins were prepared as standards15,22 for methods development and quantitative determinations. Briefly, partial cDNA sequences of three different loquat fruit PPO isoforms encoding for 200, 377, and 347 amino acids of PPO1, PPO2, and PPO3, respectively (see Supporting Information Figure S3 amino acids sequences of PPOs loquat fruit) were amplified (PPO1-F: TACGACCAAGCCGGGTTCCC; PPO1-R: TTCCACATTCGATCAACATTCGA; PPO2-F: TATGTATTTGTATTTCTATG; PPO2-R: CCAGCGAATCCGCGTCATCGTTCA; PPO3-F: TATGTATCTGTACTTCTACGAGC; PPO3-R: TGTCGTCGTTGATGAATACGTCAA), separately subcloned into pET28b vector (Novagen, Madison, WI), and expressed in 5710



Article

Escherichia coli BL21 at 37 °C in LBKan. The expressed polypeptides had additional amino acids on the N-terminus that included 6xHis fusion tag for affinity purification. Expression of recombinant PPOs was induced with 0.5 mM IPTG at 37 °C, and cells were harvested 4 h after induction. The cells were suspended in lysis buffer (7 M urea, 2 M thiourea, 30 mM Tris pH 7.5, 4% CHAPS) and lysed by sonication for 2 min on ice. The cells lysate were removed by centrifugation at 30 000g for 20 min. Protein solubilized from the inclusion bodies fraction was applied onto His GraviTrap IMAC columns (GE Healthcare), and the recombinant Histagged PPO was purified according to the manufacturer recommendations (see Supporting Information Figure S4 for the SDS-PAGE pure recombinant PPOs). In addition, a total protein extract of wild E. coli BL21 was prepared for use as a complex protein matrix. Protein extracts from ripe loquat fruit were prepared as described by Sellés and co-workers.15,23 Briefly, 50 g of loquat flesh was homogenized in 150 mL of cold 0.1 M sodium phosphate pH 7.0 buffer containing 50 mM ascorbic acid. The homogenate was filtered through eight layers of gauze and supplemented with a cocktail of protease inhibitors (4 mL/L), then constituting the crude extract. The protein extract was prepared by the phenol/SDS method24 with some modifications. Three hundred microliters of crude extract was supplemented with 0.8 mL of Tris-saturated phenol and 0.8 mL of SDS buffer (30% sucrose, 2% SDS, 0.1 M Tris-HCl, pH 8.0, 5% 2-mercaptoethanol). The mixture was vortexed, and the phenol phase was separated by centrifugation at 15 000 rpm for 20 min at 4 °C. The upper phenol phase was recovered, and the remaining aqueous phase was re-extracted with 0.8 mL of Trissaturated phenol. Proteins were precipitated from the pooled phenol phase by addition of 5 vol cold 0.1 M ammonium acetate in methanol, incubation at −20 °C overnight, and collection by centrifugation at 15 000 rpm The dried protein precipitate was washed twice with 0.1 M ammonium acetate in methanol and twice with chilled 80% acetone. Quantitative protein precipitation was achieved by TCA/ deoxycholate method.25 Briefly, 0.75 mL of protein sample dissolved in aqueous buffer was supplemented with 8.5 μL of 2% sodium deoxycholate. The mixture was vortexed and incubated for 15 min on ice; proteins were precipitated by adding 250 μL of 24% TCA in water, 30 min incubation on ice, and centrifugation at 14 000 rpm in a benchtop centrifuge. The pellet was washed three times in chilled acetone, allowed to dry, and solubilized in an appropriate buffer. The protein concentration of samples solubilized in SDS-PAGE sample buffer was determined by RC DC protein assay (BIO-RAD) based on the modified Lowry protein assay method.26

followed by incubation for 1 h in the dark at room temperature. After quenching the excess iodacetamide with 1 μL of 0.2 M dithiothreitol, digestion was performed by addition of 250 μL of 0.1 M ABC followed by 10 μL of 0.1 μg/μL porcine trypsin (Promega, Madison WI) an incubation at 37 °C for 6 h. Tryptic peptides were dried down in a Speed-Vac benchtop centrifuge and resuspended in 5% acetonitrile and 0.5% trifluoroacetic acid. The resulting peptides were desalted with PepClean C-18 Spin Columns (Agilent Technologies) in batches of 30 μg of protein according to manufacturer recommendations. Eventually, eluted peptides were dried down in a Speed-Vac benchtop centrifuge and resuspended in 0.1% formic acid to a final concentration of 1 μg/μL. In-gel digestion was performed on SDS-PAGE bands of interest in a ProGest (Genomic Solutions, Cambridgeshire, U.K.) automatic in-gel protein digestor according to the manufacturer recommendations for colloidal CBB-stained samples using the method of Shevchenko et al.30 The gel plugs were extensively washed to remove dye and SDS impurities with 25 mM ammonium bicarbonate, in-gel reduced with 60 mM dithiothreitol, and S- alkylated with excess iodoacetamine followed by digestion with porcine trypsin (Promega, Madison WI) (1:100 wt/wt) at 37 °C for 6 h. Peptides were extracted in ammonium bicarbonate, then in 70% acetonitrile, and finally in 1% formic acid. Extracted peptides were dried down in a Speed-Vac benchtop centrifuge and resuspended in 0.1% formic acid (typically 10 μL). 2.6. Bioinformatic Tools

Multiple alignments of protein sequences of the three targeted PPOs isoforms was performed with ClustalW231 available online at the Web site of the European Bioinformatics Institute (www.ebi.ac.uk/tools/clustalw2) using the default configuration. The theoretical performance of trypsin on each of the three PPO isoform sequences was simulated by PeptideCutter,32 available online at the Web site of ExPASy bioinformatics resources (www.expasy.org). 2.7. Liquid Chromatography-Tandem Mass Spectrometry

MS and MS/MS data were acquired in an Agilent XCT plus ion trap mass spectrometer with a ChipCube interface fed by an Agilent 1100 series nanopump HPLC system. The sample was concentrated, desalted, and resolved in the Agilent Protein ID Chip designed for one-dimensional separations. It comprises a 40 nL enrichment column and a 75 μm × 43 mm analytical column, which is packed with Zorbax C18-SB 5 μm material, and connects directly to the nanospray emitter. Peptide separation was achieved using a linear gradient of 3−32.5% acetonitrile containing 0.1% (v/v) formic acid of different lengths depending on the acquisition mode at a constant flow rate of 0.4 μL/min. For data dependent acquisition, “Auto MS(n)” mode, 30 min gradients were used and mass spectrometer settings included an ionization potential of 1.9 kV and an ICC smart target (number of ions in the trap before scan out) of 500 000 or 150 ms of accumulation, selecting the four most intense precursors with the following parameters: Threshold absolute 20 000, threshold relative 5%, and active exclusion after two spectra and release in 1 min. MS/MS analyses were performed using automated switching with a preference for doubly charged ions and a threshold of 105 counts and a 1.3 V fragmentation amplitude. MS and MS/MS spectra were acquired in the standard enhanced mode (26 000 m/z per second) and the ultrascan mode (8100 m/z per second), respectively. For MpM analyses, 70 min gradients

2.4. SDS-PAGE

SDS-PAGE was performed according to Laemmli27 in a Hoefer miniVe cell (GE Healthcare). Thirty microliters of 1 μg/μL total protein extract was boiled for 5 min and loaded per well. Proteins were resolved in a 12.5% polyacrylamide gel and visualized with colloidal CBB staining.28 2.5. Protein Tryptic Digestion

In-solution tryptic digestion was performed as described.29 One hundred micrograms of precipitated protein sample was dissolved in 25 μL of 0.1 M ammonium bicarbonate (ABC) and 25 μL of pure trifluoroethanol. Reduction was achieved with 1 μL of 0.2 M dithiothreitol followed by incubation for 1 h at 60 °C and S-alkylation with 4 μL of 0.2 M iodoacetamide 5711



Article

Figure 1. Scheme of the process developed for PPO isoform detection and quantitation by MRM in loquat fruit. The previous knowledge of the target protein sequences was partly obtained from public databases (PPO1) and from experimental evidence (cloning and sequencing of PPO1, PPO2, and PPO3 partial sequences). Proteotypic peptides were determined using bioinformatics resources, but the lack of mass spectral information required the MS/MS analysis purified recombinant standards of each PPO isoform to obtain candidate transitions. Several MpM experiments with the standards in an ion trap instrument provided experimental evidence of the suitability of a list of transitions to specifically monitor each PPO isoform. MRM experiments with standards in a QqQ instrument validated the candidate transition. The method was successfully applied to detect PPO2 and PPO3 in loquat protein samples previously separated by SDS-PAGE (mass-Western) and to quantify PPO2 in gel bands using external standards as calibrants.

were used and mass data were acquired in “MRM” mode. To that eight precursors of known m/z (748.5, 507.3, 815.0, 582.7, 999.5, 1078.2, 691.4, and 461.6) were selected for isolation using a window 1 and fragmentation using amplitude 0.4; the fragmentation products were scanned in ultrascan mode. MRM analysis were conducted on the Agilent 1260 Infinity LC coupled to the 6490 triple quadrupole LC/MS system (Agilent Jet Stream) interfaced with a electrospray source operated in the positive ion mode. Instrument settings include a spray voltage of 3.0 kV, a nebulizer (psi) of 30, and an ion source temperature of 200 °C. Collision energy (CE) for each transition was based on the results from the preliminary runs, and the cycle time for the whole set of 31 transitions was kept at 500 ms (16 ms dwell time). The sample was concentrated and desalted on a Zorbax 300SBC18 trap column (0.3 mm × 5 mm, 5 μm), and peptide separation was achieved on a Zorbax Eclipse Plus C18 analytical column (2.1 × 50 mm, 1.8 μm) using a 7 min linear gradient of 3−45% acetonitrile containing 0.1% (v/v) formic acid at a constant flow rate of 0.4 mL/min.

three PPO isoforms partial sequences in the identity mode with the MS/MS Search tool of SpectrumMill Proteomics Workbench using the following parameters: trypsin, up to 2 missed cleavages, fixed modification S-carbamidomethylation, and a mass tolerance of 2.5 Da for the precursor and 0.7 Da for product ions. Peptide hits were validated first in the peptide mode and then in the protein mode according to the score settings recommended by the manufacturer. A six figure virtual accession number was given to the recombinant PPO sequences not coincident with any protein from the Viridiplantae subset: 1468139|PPO1; 1468140|PPO2; 1468141|PPO3. 2.9. MRM Quantitation of PPO Isoforms with External Standards

The three recombinant fragments of PPO were used as a source of standard peptides. Six hundred nanograms of each polypeptide was electrophoresed by SDS-PAGE, and the gels cCBB stained. Each band was excised, in-gel digested, and desalted as described above. Peptide loss fraction was assumed to be equal for each standard and also for fruit samples processed in the same manner; thus, for further calculations a recovery of 100% was considered. For quantitative MRM experiments, a standard mix containing 1 ng/μL of each pure recombinant PPO digest was prepared so that 1 ng of a standard on column corresponded to 45, 23.8, and 25 fmol of PPO1, PPO2, and PPO3 peptides, respectively. To build calibration curves, 1, 2, 5, and 10 ng of each pure recombinant PPO digest in the mixture was injected on column. To account

2.8. MS/MS Spectrum-Based Peptide and Protein Identification

Each MS/MS spectra data set (ca. 1200 spectra/run) was processed to determine monoisotopic masses and charge states, to merge MS/MS spectra with the same precursor (Δm/z < 1.4 Da and chromatographic Δt < 15 s) and to select high quality spectra with the Extraction tool of SpectrumMill Proteomics Workbench (Agilent). The reduced data set was searched against the NCBInr Viridiplantae subset supplemented with the 5712



Article

Figure 2. Multiple alignment of the cloned partial amino acid sequences of different PPO isoforms (PPO1, PPO2, and PPO3) performed with Clustal W2 using the default configuration. Red amino acids indicate the trypsin cleavage points. Underlined are peptides selected for MRM analysis after LC-MS/MS analysis.

for possible changes in system response during the analysis, the external calibration standards series was run twice, one before and another after the set of samples. Calibration curves were constructed for individual peptides using the sum of the peak areas for their set of transitions as instrument response to the injected amount of standard. The system was considered stable if the average %CV between both measurements was below 20%. As an example, the %CV between both measurements for PPO2 standard peptides ranged from 2.0 to 24.2%, with average CV% 8.6% and median CV% 4%, that accounts for a good stability of the instrument along the analysis. Individual peptide data were fitted to a linear model, A = nx + b, where A is the summed transition peak areas, x is the fmol of the peptide standard, and n and b are the slope and intercept, respectively. To determine the amount in fmol of the peptide “m” belonging to the PPOn in a digested band of a sample analyzed by MRM, the following expression was used:

PPOn /fruit FW = PPOn in band

(PCF/PLG)

where PCF is the total protein concentration in fruit, in μg/g fruit FW, and PLG is the total protein amount loaded in the gel lane, in μg.

3. RESULTS Figure 1 depicts a scheme of the main features of the process developed to detect and quantify PPO isoforms in loquat fruits by MRM. While for human, mammalian, and model organisms MRM method development has become a fast and nearly trivial task for a proteomics specialist, the lack of similar resources for most crops makes MRM method development one of the bottleneck points for application of this powerful technology in applied plant science. Below are described the detailed results of this process. 3.1. Proteotypic Peptides Selection

peptidem , n in band (fmol) = (A n − b)/(nf )

Initially, selection of specific tryptic peptides representatives of a unique protein product such as isoforms encoded by paralog genes, is essential to develop MRM methods. Such representative or proteotypic peptides can be selected in a first stage by using bioinformatic tools which involve in silico trypsin digestion and sequence comparison by multialignment. Figure 2 shows the multiple alignment of the three cloned

where f is the unit fraction of injected sample of the resuspended digest. The amount in fmol of PPOn (PPOn in band) was determined as the average of their analyzed constituting peptides. To determine the PPOn isoform amount per fruit weight in fmol/g, the following expression was used: 5713



Article

Table 1. Hit List Proteins Identified in the Samples Corresponding to PPO1, PPO2, and PPO3a spectra number

distinct peptides

distinct summed MS/MS search score

% AA coverage

total protein spectral intensity

access number NCBIb

PPO1

10 10

4 4

62.64 62.64

22 23

6.98 × 1010 6.98 × 1010

1468139 4519439

PPO2 PPO3

80 34

12 9

205.2 149.68

34 26

1.16 × 1012 4.62 × 1010

1468140 1468141

sample

protein name/species PPO1/E. japonica polyphenol oxidase/ E. japonica PPO2/E. japonica PPO3/E. japonica

a

Recombinant PPO samples tryptic digests were analyzed by LC-MS/MS and searched against the NCBInr Viridiplantae subset protein database supplemented with the three PPO isoforms partial sequences with SpectrumMill Proteomics Workbench. The top hit for each sample is shown. The sequence of the distinct peptides is shown in Supporting Information Table S2. bVirtual accession number was given to the recombinant PPO sequences not coincident with any protein from the Viridiplantae subset: 1468139|PPO1; 1468140|PPO2; 1468141|PPO3.

Table 2. Candidate Peptides of Three Isoforms of PPOs with MS/MS Assay isoform

spectral number

peptide sequence

m/z

Z

RT (min)

most intense m/z fragments

PPO1

4 3 7 15 29 4 4 6

(R)LFFGNPYR(A) (K)HQPPTLVDLDYNGTEDNVSK(E) (K)GIEFAGNETVK(F) (K)FDVYVNDDADSLAGK(D) (K)LLDLNYSGTDDDVDDATR(I) (K)TPDLFFGHEYR(A) (K)TPDLFFGHEYR(A) (R)YTYEPVSVPWLFTKPTAR(K)

507.3 748.5 582.7 815.0 999.5 461.6 691.4 1078.2

2 3 2 2 2 3 2 3

26−29 25−26 15−24 21−36 22−43 26−30 26−30 57−61

753.5/606.4/549.5/435.4 849.4/640.6/562.6/501.3 865.6/647.5/518.4/347.4 1104.7/1005.6/776.5/590.5 1266.8/1179.7/906.5/791.5 808.4/640.9/592.5/535.2 1044.6/955.6/808.5/661.4 1403.0/1217.0/820.7/673.6

PPO2

PPO3

Figure 3. MpM analysis with pure recombinants PPO isoforms mixtures. TIC and XMPIC traces for proteotypic peptides of PPO loquat isoforms. Result shown correspond to a mixture in 1:3:5 proportion by weight of purified recombinant PPO1, PPO2, and PPO3, respectively, digest. The identity of the PPO peptides was confirmed by interrogating the database with the acquired LC-MS/MS data.

5714



Article

Figure 4. MpM analysis with pure recombinants PPO isoforms mixture with E. coli. TIC and XMPIC traces for proteotypic peptide of loquat PPO isoforms. Result shown correspond to E. coli digest with mixture of the three purified recombinant PPO digest in a proportion 25%:75% PPO:E. coli (w/w) protein digest, respectively. The identity of the PPO peptides was confirmed by interrogating LC-MS/MS data in peak with asterisk (∗).

in the sample (Table 1). For the PPO1 isoform, a total of 10 spectra corresponding to 4 distinct peptides was obtained; for the PPO2 isoform, 80 spectra corresponding to 12 distinct peptides; and for PPO3 isoform, 34 spectra corresponding to 9 distinct peptides. The decision of which tryptic peptides would be used for the MRM assay was based on its proteotypic attribute and on the MS/MS analysis results. The basic requirements of selected peptides to develop a sensitive and specific MRM assay include (1) isoform-specific, that is, proteotypic, (2) frequency of spectrum observation, (3) stability of the charge state, and (4) short retention time. These pre-established conditions led to the selection of eight candidates of proteotypic peptide ions: two for PPO1, three for PPO2, and three for PPO3. Table 2 shows the candidate peptides for MRM analysis, together with the isoform each one belongs to, the number of recorded spectra, the precursor charge (z), the ratio m/z, retention time in minutes (RT (min)), and m/z ratio of the most intense ions fragments.

partial amino acid sequences of loquat PPOs, on which trypsin cleavage points have been marked in red. Peptides shorter than 8 and longer than 23 amino acid residues as well as others that do not fulfill some well established conditions4 were discarded. A list of putative candidates was created based on its uniqueness occurrence in a particular PPO isoform (see Supporting Information Table S1 for the list of putative candidate peptides of each PPO isoform). The number of candidate proteotypic peptides for LC-MS/MS assay in MRM mode were 5, 11, and 12 for PPO1, PPO2, and PPO3 respectively. Although this information is important for MRM methods development, empirical information about peptide ionization and fragmentation in the mass spectrometer instrument is needed for the selection and design of useful transitions. To that goal, each purified recombinant PPO was trypsin digested, LC-MS/MS analyzed in data dependent mode, and acquired MS/MS spectra were used to interrogate the NCBInr viridiplantae database supplemented with the three PPO isoform partial sequences using the Spectrum Mill search engine. This analysis provided essential information about peptides attributes (sequence, number of matching spectra, spectral intensity, retention times, precursor ion m/z and charge, and m/z and intensities of fragment ions) and a list of PPO proteins that can explain the occurrence of such peptides

3.2. Targeted MS/MS Assays of Pure Recombinant PPO Isoforms

This technique has been applied to protein analysis, wherein a proteotypic peptide is selected as a surrogate for the protein of interest and analyzed by MRM in a targeted fashion.2,33,34 Due to the limitation in the number of transitions the ion trap is able 5715



Article

Table 3. Features of MpM Assays of the Eight Selected Peptide Transitions to Quantify the Three Isoforms of PPOa dynamic range isoform

peptide sequence

m/z

PPO1

(R)LFFGNPYR(A) (K)HQPPTLVDLDYNGTEDNVSK(E) (K)GIEFAGNETVK(F) (K)FDVYVNDDADSLAGK(D) (K)LLDLNYSGTDDDVDDATR(I) (K)TPDLFFGHEYR(A) (K)TPDLFFGHEYR(A) (R)YTYEPVSVPWLFTKPTAR(K)

507.3 748.5 582.7 815.0 999.5 461.6 691.4 1078.2

PPO2

PPO3

equation y y y y y y y y

= = = = = = = =

95385x − 8 × 106 9843x + 297534 128682x + 5 × 106 147864x − 6 × 107 730133x − 4 × 108 135082x − 3 × 107 48003x + 7 × 106 20774x − 1 × 106

R2 0.9999 0.9997 0.9985 0.9972 0.9913 0.997 0.9953 1.0000

low limit (fmol)b 2.17 2.17 1.19 1.19 1.19 6.28 6.28 1.26

× × × × × × × ×

101 101 101 102 102 101 101 102

high limit (fmol)b 2.17 2.17 1.19 1.19 1.19 1.26 1.26 1.26

× × × × × × × ×

104 104 104 104 104 104 104 104

a In solution, digests of each PPO isoform standard were prepared as stock solutions of 0.5 μg/μL (equivalent to ca. 22μM PPO1, 12μM PPO2, and 13μM PPO3) and 1μL of diluted solutions of these standards were injected for LC-MpM analysis. The dilutions used were 1:1000, 1:500, 1:200, 1:100, 1:50, 1:20, 1:10, 1:5, 1:2, and 1:1. bTotal amount on column for the specified peptide.

to monitor in parallel, we decided to target the precursor m/z and scan its product ions in an approach that has been named MpM.5 In this way, the eight selected proteotypic peptides could be monitored in the same run and, in addition, their identity could be assessed by database search of the acquired MS/MS spectra. First, MpM analysis was conducted on tryptic digests of pure recombinant PPO isoforms and then on mixtures of the three isoforms in different weight proportions. The product ion chromatogram (the selected most intense) of each of the eight targeted precursor m/z provided the evidence for the presence or absence of the peptide in the sample, a quantitative information as signal intensity measured as the integrated peak area (IPA) and assay specificity (single chromatographic peaks). As shown in Supporting Information Figures S5, S6, and S7 (total ion chromatograms (TIC) and extracted multiple product ion chromatograms (XMPIC) traces of pure recombinant fragment PPOs digest, PPO1, PPO2 and PPO3, respectively), the selected proteotypic peptides were isoform specific as only one peak in the associated precursor/ product ions channel was observed and only isoform specific channels displayed the peak at the expected retention time. When the pure recombinant PPO samples were mixed, the two specific peptides for PPO1, the three for PPO2, and the three for PPO3 were seen in the expected precursor/product ions channel and retention times (Figure 3). Therefore, the assay can be used for the specific analysis of PPO isoform mixtures. Usually, samples are complex; therefore, to detect and eventually confirm the identity of PPO isoforms in a real simulated context, we performed the MpM analysis using a total protein extract of E. coli as a background proteome. The E. coli total protein digest was mixed with individual or a mixture of the three pure recombinant PPO digests, always in a proportion 25%:75% PPO:E. coli (w/w). The chromatographic traces of the individual PPO isoforms with the E. coli digest confirmed the specificity of the assay also in a complex sample (see Supporting Information Figures S8, S9, and S10 for TIC and XMPIC of pure recombinant fragment PPO1, PPO2, and PPO3, respectively, mixed with the E. coli digest); however, sensitivity was significantly reduced since IPAs decreased. In the particular case of the analysis of the mixture of the three isoforms, the sensitivity, and thus specificity, was seriously compromised, as the three proteotypic peptides of PPO2, but only one of PPO1 (m/z 507.4) and one of PPO3 (m/z 461.4) (Figure 4) were detected, and confirmed by MS/MS search. The complexity of biological samples at the protein level may hinder the detection of specific transitions.35 The high background, the dynamic range of protein concentrations

present, or the phenomena of ion suppression by competing peptides to capture protons36 configure a possible scenario for missing PPO1 peptides at precursor m/z 748.5 and PPO3 peptides at precursor m/z 691.4 and 1078.2. Another key attribute of selected precursors is the dynamic range of the linear response. Thus, the IPA of the chromatographic peaks for each MpM analysis was determined in a range of 3 logs of protein concentrations. Table 3 summarizes the results of individual quantification of pure recombinant PPO samples, including the peptide sequence, precursor m/z, fitted linear equation, and the dynamic range of specific MpM analysis. For all of them, a linear response between 2 and 3 orders of magnitude was seen, starting from low femtomole as total amount on column. 3.3. MpM and MRM Assays of PPO Isoforms in Loquat Fruit Protein Extracts

The loquat fruit protein extract are complex samples which can cause interference in the detection of specific isoform transitions,35 as seen above for mixtures of pure proteins with E. coli extracts. When the whole loquat protein digest was analyzed by MpM, none of the expected ion product peaks were detected (results not shown); therefore, a new strategy was adopted. The combination of SDS-PAGE, to decrease the complexity of the sample, and MRM assay of in-gel digested bands, a strategy known as mass-Western, 37 and GeLCMRM38 has been successfully employed to detect and quantify targeted proteins when antibody reagents are not available or fail to discern isoforms, which is very common in plant biology. As a proof of concept we resolved by SDS-PAGE a whole protein extract of ripe fruit (Figure 5, lane M) to then cut, ingel digest and do MS on bands of interest. PPO isoforms in loquat fruit and other species of Rosaceae appear in different bands in a range of 55−65 kDa and even in smaller Mw.15−21 This band multiplicity is due to post-translational processing of the preprotein for its translocation to the thylakoid lumen in two steps39,40 and to other still undisclosed processes that may lead to the proteolytic activation of the mature protein.41 Based on crossed immunoreactivity data15 three bands of interest between 59.2 and 66 kDa were cut out, in-gel digested with trypsin, and analyzed individually by MpM in an ion trap mass spectrometer, targeting the eight selected precursor m/z and recording their product ions. Results show the presence of two PPO isoforms of loquat fruit in the sample as indicated by the isoform-specific signals detected and the MS/MS search positive identifications (see Supporting Information Figures S11, S12, and S13 for the TIC and XMPIC traces of bands 5716



Article

analysis conducted in an ion trap serve as a first approximation for the optimization of MRM methods. The detection of two isoforms in loquat fruits showed the utility, sensitivity, and efficiency of the MRM method designed for study PPO isoforms, at least for PPO2 and PPO3. Furthermore, the results obtained here agree with those of Sellés-Marchart et al.15 who identified the two PPO isoforms in ripe loquat fruit in a data dependent analysis. 3.4. Quantitation of PPO Isoforms with External Standards

The optimized transitions for each specific PPO peptide constitute a robust assay that can be used to quantify the targeted isoforms in complex samples by MRM analysis. For quantitative MRM, experiments a mixture of equal proportions by weight of pure recombinant PPO1, PPO2, and PPO3 fragments digest containing the target standard peptides in the range of 1 log was injected on column as external calibration standards (see section 2.9 and Supporting Information, Report.Calibrant.PPOs). The summed IPA for transitions of each peptide of SDS-PAGE band samples was converted into femtomole using the corresponding calibration curve and the described calculations to refer that amount to mass of fruit fresh weight. Figure 5 shows the SDS-PAGE separation of total protein extracts from loquat fruits in three different developmental stages and two stress conditions. The bands of interest indicated in the gel were processed as above for MRM quantitation with the external calibration. The peptides whose peak area were below that of the lowest concentration of the standard were discarded for quantitation; therefore, only peptides of PPO2 in the bands 59.2, 62, and 66 kDa were considered accurately measured with the calibration curve. Table 5 shows the measured abundance of several molecular weight forms of PPO2 according to the SDS-PAGE migration. In all the fruit conditions analyzed, the PPO2 form with a molecular weight of 59.2 kDa was the most abundant with 1.4− 2.8 fold the average abundance of the 62 kDa form and 4.5−17 fold that of the 66 kDa form. When the abundance in a particular band is compared between fruit conditions, significant differences were observed in an ANOVA test (p < 0.05). The 66 kDa form was less abundant at harvest point, while the 62 and 59.2 kDa forms showed an accumulation pattern from green to maturation. On the other hand, taking the harvest point as the reference, the stress imposed by postharvest life or mechanical damage and bruising led to a strong decrease in the abundance of every PPO2Mw form.

Figure 5. SDS-PAGE electrophoresis of loquat fruit protein extracts. Total protein was extracted as described in the text from fruits in different stages of development (G, green; H, harvest; M, maturation) and stress (P-H, postharvest; B, bruised), and 30 μg total protein was loaded per lane. The three bands of interest between 59.2 and 66 kDa are indicated.

59.2, 62, and 66 kDa, respectively). PPO3 isoform was detected in the band of 66 kDa through two precursor peptides m/z: 461.6 and 691.4. PPO2 was detected in each band analyzed in the range of 59.2−66 kDa. PPO1 was not detected, and thus, we concluded this isoform was not present in the sample or not in sufficient amount as to be detected with our method. Next, the method developed by MpM approach was utilized to carry out confirmatory MRM, taking full advantage of the enhanced sensitivity of the Agilent 6490 triple quadrupole LC/MS system. A mixture of the purified recombinant PPO1, PPO2, and PPO3 was used to confirm the selection of optimal MRM transitions predicted in previous MpM analysis, to optimize the collision energy and to make up calibration curves for quantitation. The most intense transitions for the corresponding PPO1, PPO2 and PPO3 isoform precursors are listed in Table 4. The optimal MRM transitions were monitored in the three SDS-PAGE bands of 59.2, 62, and 66 kDa, of loquat fruit whole protein extract. The results confirmed the presence of PPO2 and PPO3 isoforms and did not provide experimental evidence on the presence of PPO1. Given the higher sensitivity and the strong signals obtained for the other isoforms, the presence of PPO1 in ripe loquat fruit at significant amounts can be discarded. PPO3 was only observed in the 66 kDa band (Figure 6A) by the TPDLFFGHEYR peptide (transitions 461.6/808.4; 461.6/640.9; 461.6/592.5; 461.6/535.2). PPO2 was observed in the different bands in the range 59.2−66 kDa by the peptides GIEFAGNETVK (transitions 582/865.6; 582/ 647.5; 582/518.4; 582/347.4), FDVYVNDDADSLAGK (815/ 1104.7; 815/1005.6; 815/776.5; 815/590.5), and LLDLNYSGTDDDVDDATR (999.5/1266.8; 999.5/1179.7; 999.5/906.5; 999.5/791.5), with the most intense signal being detected in the 59.2 kDa band (Figure 6B−D). These results are in agreement with MpM analyses in the ion trap. Therefore,

4. DISCUSSION In a targeted proteomics assay, only peptides of interest are selected and the mass spectrometer is set to ignore all other peptides in the sample. This setup provides high analytical reproducibility, a better signal-to-noise ratio, and increased dynamic range.1 To the best of our knowledge, this is the first work aimed at the development of targeted analysis of a plant PPO using MRM assays. The application of MRM to plant proteins, and especially to those encoded by gene families like PPO, is of special relevance because the alternative application of targeted assays based in antibodies is highly underdeveloped at commercial level as compared to humans and rodents. The ease and speed in MRM method development based on either protein standards, as in this work, existing identifications based on LC-MS/MS discovery experiments,4 or bioinformatics resources42 suggest that this is going to be a strategy of choice for many studies on plant proteins in the near future. The 5717



Article

Table 4. Transitions for MRM Assays for PPO1, PPO2, and PPO3 Proteotypic Peptides isoform

RT (min)

precursor ion (m/z)

product ion (m/z)

CAV

fragmentor voltage

collision energy

PPO1

3.9

(R)LFFGNPYR(A)

507.3

3.85

(K)HQPPTLVDLDYNGTEDNVSK(E)

748.5

1.98

(K)GIEFAGNETVK(F)

582.7

3.67

(K)FDVYVNDDADSLAGK(D)

815

3.79

(K)LLDLNYSGTDDDVDDATR(I)

999.5

4.07

(K)TPDLFFGHEYR(A)

461.6

4.07

(K)TPDLFFGHEYR(A)

691.4

4.07

(R)YTYEPVSVPWLFTKPTAR(K)

753.5 606.6 549.5 435.4 849.4 640.6 562.6 501.3 865.6 647.5 518.4 347.4 1104.7 1005.6 776.5 590.5 1266.8 1179.7 906.5 791.5 808.4 640.9 592.5 535.2 1044.6 955.6 808.5 661.4 1217.0 820.7 673.6

1 1 2 2 1 1 1 2 2 1 2 1 1 1 1 2 2 1 0 1 1 2 1 1 2 1 1 0 0 0 0

380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380 380

15 20 15 15 25 15 25 15 20 15 10 30 30 25 30 30 35 35 45 50 20 10 10 15 25 30 30 30 45 45 45

PPO2

PPO3

sequence peptide

1078.2

PPO, there are two main sources of Mw variability. One is genetic, since PPOs are encoded by multigene families, also in the case of loquat.15,16 Predicted polypeptides can range from 64 to 71 kDa, for the different paralogs. Another source of Mw variability is post-translational processing of the polypeptide.39,40 The preprotein contains N-terminal signal sequences for translocation to the chloroplast in a two-step process, thus producing an intermediate and a final mature polypeptide whose Mw ranges from 55 to 62 kDa depending on the paralog. In addition, lighter forms have been described as a result of further proteolytic processing of the mature protein which in vitro leads to enzymatic activation with serine proteases such as trypsin41 and proteinase K.43 Consequently, several bands in the range 52−66 kDa were analyzed. The finding of products from two paralogs, PPO2 and PPO3, and products from PPO2 in several bands can be readily explained considering the above. The results obtained using an MpM acquisition mode in an ion trap mass spectrometer demonstrates the capability of this instrument in the development of transitions for MRM assays. Although for human, mammalian, and model organisms sequence and mass spectral information is abundant and available for the fast development of MRM assays,44 for nonmodel underrepresented crops such as loquat the application of MpM can be critical. In fact, the experimentally determined transitions were successfully used to set the acquisition program of a triple quadrupole instrument for MRM analysis of both pure recombinant PPO digests and gel band digests. In this way, the targeted MS method for analysis

degree of specificity that can be achieved with MRM can be significantly better than that of antibodies. Instead, sensitivity of antibodies has not been surpassed at the moment by MRM, although improvement in instrumentation will likely resolve these current cons of MRM. During the establishment and design of an MRM method, it is recommended to use several specific, that is, proteotypic, peptides from each protein.4 In this way, the confidence in the detection increases and the coherence in the quantification can be assessed. We selected at least two unique peptides for each isoform, one of which (TPDLFFGHEYR) presented two ionic forms. Since this is not a desirable attribute for a target peptide,4 we included both precursors in the MRM method so to record all the signal from the proteotypic peptide. The complexity of biological samples at the protein level may hinder the detection of specific transitions.35 The high background, the dynamic range of protein concentrations present, or the phenomena of ionic suppression by competing peptides to capture protons36 can be major reasons to explain the decrease or disappearance in PPO peptide signals in complex samples such as mixtures of pure PPO samples with the E. coli digest or protein extract digests from loquat fruit. Sample simplification is then needed to achieve peptide signal detection. A successful strategy to carry out MRM assays on complex samples uses SDS-PAGE to reduce sample complexity followed by the analysis of the in-gel digested bands of interest.37,38 Such strategy can be very useful to analyze low abundance proteins and protein variants with different Mw. In the case of plant 5718



Article

Figure 6. Selected examples of MRM analysis of PPOs in SDS-PAGE band digests of loquat fruit crude protein extract. Left: chromatographic traces for the most intense SRM transition for the corresponding PPO peptide. Center: normalized chromatographic traces of the monitored transitions for each peptide. Right: composite MS/MS spectrum of the recorded transitions, indicating the precursor ion m/z with a diamond. (A) Detection of the PPO3 peptide (K)TPDLFFGHEYR(A) in the 66 kDa band; (B−D) detection of the PPO2 peptides (K)GIEFAGNETVK(F), (K)FDVYVNDDADSLAGK(D), and (K)LLDLNYSGTDDDVDDATR(I) in the 59.2 kDa band.

standards of AQUA45 peptides could be used. The significant increase in cost analysis would be balanced by an also significant improvement in analytical precision.46 Nevertheless, if the internal standard peptides would be of broad application to large sets of samples or to PPO of different species, their use could become cost-effective. The application of MRM to quantify PPO isoforms in samples from loquat fruits confirmed the presence of the PPO2 and PPO3. Only the PPO2 isoform could be quantified in fruits at different developmental stages and under different stress conditions using the external calibration curves constructed. To quantify the lower abundance PPO3 isoform in loquat fruits, an improvement in the system sensitivity would be necessary that could be achieved by using nanoflow liquid chromatography, although the analysis length will also be increased several fold. The results obtained here and those reported in data dependent MS/MS analysis15 and in enzyme purification and characterization studies23 demonstrate that PPO2 is the most abundant isoform in loquat fruits, thus being the main candidate to cause

of loquat PPO was validated. Further, the use of pure recombinant PPO digests as standard external calibrants allowed for the quantitation of PPO in different bands. The use of external calibrant for quantitation might be compromised for several reasons. System response from injection-to-injection will decrease the precision as compared to internal standard calibrants; however, we assessed that on average the %CV between measurements of the standards before and after samples was acceptable (8.6% in the case of PPO2 peptides). Processing of the protein samples, separated to that of the external standard, lead to protein losses that cannot be accounted, but whenever samples and standards are processed in the same way, them all will be affected by the same measurement error and thus a quantitative comparison between them will be possible. In the case of whole protein extracts, as seen in synthetic samples of recombinant PPO and E. coli matrix, ionic suppression can occur that leads to signal quenching. In such cases, calibration curves might be made up in a complex background of E. coli or, alternatively, internal 5719



Article

mass-Western strategy provides a solution for application of MpM and MRM methods for both qualitative and quantitative purposes, respectively. PPO3 was found in the heavier band and PPO2 in all, thus providing evidence of a post-translational processing of PPO2. MRM assays of external standards in a triple quadrupole spectrometer provides linearity in the assayed range between 25 and 250 fmol of target peptides, but the lower limit was clearly not reached for many transitions. Such a range was appropriate for quantitation of PPO2 in three SDSPAGE bands. The complete sequence of these three PPO genes has been recently determined and overexpressed in our laboratory (unpublished results) and will serve to develop new transitions for proteotypic PPO peptides. Further, there exists a high similarity between plant PPO orthologs; therefore, some of the current and the newly developed transition might be used horizontally to analyze PPO isoforms in phylogenetic families, such as Rosaceae which includes crops like apple, peach, apricot, pear, and so forth in addition to loquat.

Table 5. Quantification of PPO2 from Crude Protein Extracts of Loquat Fruit after Separation by SDS-PAGEa PPO2Mw form 66 kDa

62 kDa

59.2 kDa

stages/stress

total fmol in the band

fmol/g fruit

G H M P-H B G H M P-H B G H M P-H B

232.2 ± 21.7 n.q. 148.0 ± 6.3 n.q. n.q. 369.7 ± 82.2 352.4 ± 15.9 542.7 ± 44.8 268.7 ± 25.9 171.3 ± 14.4 1036.5 ± 152.1 784.2 ± 30.0 768.6 ± 72.1 815.8 ± 42.0 360.8 ± 27.1

2814 ± 263a n.q. 3103 ± 132a n.q. n.q. 4478 ± 997a 6485 ± 294b 11383 ± 940c 3562 ± 344a 2838 ± 239a 12553 ± 1845b,c 14431 ± 553c,d 16120 ± 1510d 10817 ± 557b 5977 ± 449a

■

a

Protein samples were prepared from fruits in different stages of development (G, green; H, harvest; M, maturation) and stress (P-H, postharvest; B, bruised) and separated by SDS-PAGE. As shown in Figure 5, three gel bands of interest per lane were processed individually for MRM analysis as described in the text, and PPO2 amount in each band was determined using the pure recombinant PPO peptides as an external calibration standard. Results are the average of the peptides of two protein extracts. The means of each PPO2Mw form were compared between samples by a one-way ANOVA with a significance of 95% using Tukey’s HSD test. n.q.: the peptides were detected, but their peak areas were lower than that of the lowest standard and therefore were not considered for quantification.

ASSOCIATED CONTENT

S Supporting Information *

Additional figures and tables, and quantitative analysis sample report. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Phone: (34) 965903400. Fax: (34) 965903880. Notes

The authors declare no competing financial interest.

■

the enzymatic browning that occurs extensively in the fruit flesh during ripening, prolonged self-life, and mechanical damage.22 Since full-length orthologs of PPO2 have been sequenced (direct submissions) in closely related species of economic importance such as apple, plum, pear, apricot, and so forth, comparative studies using the methodology developed in this work will contribute to test this hypothesis. The low abundance of PPO3 isoform suggests a specific localization in minority fruit tissues such as the skin, where some PPO genes have been found expressed in other species.21 Under the hypothesis that the PPO2Mw forms are different processing products of the polypeptide encoded by the PPO2 gene, the abundance pattern of the 66 kDa polypeptide suggest that its expression is developmentally controlled, stronger in young and in ripe fruits, but is not inducible by the stress imposed by postharvest life or bruising. These stress conditions do not seem to significantly alter the SDS-PAGE profile of the affected fruits, and thus, the accelerated decrease in the abundance in all the bands may obey to specific mechanisms of degradation.

ACKNOWLEDGMENTS We thank Mrs. Mariá Teresa Vilella Antón for her technical ́ support and the Cooperativa Agricola Callosa D́ En Sarria for supplying freshly cut loquat fruits. A.M.-M. holds a research grant from Conselleria d’Educacio, Cultura I Sport de la Generalitat Valenciana (FPA/2013/A/074), and J.M.-C. a postdoctoral grant from SENESCYT-ECUADOR (006-IECESMG5-GPLR-2012). S. S.-M. acknowledges financial support from Proteored-ISCIII. This work has been supported by grants from the Spanish Ministry of Foreign Affairs and Cooperation (A/8823/07) and (B/107931/08); University of Alicante (VIGROB-105), the Spanish Ministry of Science and Innovation (BIO2011-29856-C02-02) and European funds for Regional development (FEDER).

■

REFERENCES

(1) Lange, V.; Picotti, P.; Domon, B.; Acbersold, R. Selected reaction monitoring for quantitative proteomics: a tutorial. Mol. Syst. Biol. 2008, 4, 222. (2) Anderson, L.; Hunter, C. L. Quantitative Mass Spectrometric Multiple Reaction Monitoring Assays for Major Plasma Proteins. Mol. Cell. Proteomics 2006, 5, 583−588. (3) Fun, J.; Mohareb, F.; Jones, A. M. E.; Bessant, C. MRMaid: the SRM assay design tool for Arabidopsis and other species. Front. Plant Sci. 2012, 3, 164. (4) James, A.; Jorgensen, C. Basic design of MRM assays for peptide quantification. Methods Mol. Biol. 2010, 658, 167−185. (5) Mallick, P.; Schirle, M.; Chen, S. S.; Flory, M. R.; Lee, H.; Martin, D.; Ranish, J.; Raught, B.; Schmitt, R.; Werner, T.; Kuster, B.; Aebersold, R. Computational prediction of proteotypic peptides for quantitative proteomics. Nat. Biotechnol. 2007, 25, 125−131.

5. CONCLUSION In this study, we describe the development and validation of MRM methods to detect protein products of three PPO paralog genes from loquat. Routine protein identification workflow by data dependent analysis provided proteotypic peptides, and the criteria applied for peptide selection provided eight candidate PPO isoform-specific peptides and a number of transitions. MpM analysis of purified PPOs samples in ion trap spectrometer demonstrates that the selected transitions are isoform specific and display linearity in several logs. High sample complexity hinders the application of the assay but a 5720



Article

(6) Baek, J. H.; Kim, H.; Shin, B.; Yu, M. H. Multiple products monitoring as a robust approach for peptide quantification. J. Proteome Res. 2009, 8, 3625−3632. (7) Kuhn, E.; Wu, J.; Karl, J.; Liao, H.; Zolg, W.; Guild, B. Quantification of C-reactive protein in the serum of patients with rheumatoid arthritis using multiple reaction monitoring mass spectrometry and 13C-labeled peptide standards. Proteomics 2004, 4, 1175−1186. (8) Mayya, V.; Rezual, K.; Wu, L.; Fong, M. B.; Han, D. K. Absolute quantification of multisite phosphorylation by selective reaction monitoring mass spectrometry: determination of inhibitory phosphorylation status of cyclin-dependent kinases. Mol. Cell. Proteomics 2006, 5, 1146−1157. (9) Vamos-Vigyazo, L. Polyphenol oxidase and peroxidase in fruits and vegetables. CRC Crit. Rev. Food Sci. 1981, 15, 49−127. (10) Walker, J. R. L.; Ferrar, P. H. Diphenol oxidases, enzymecataysed browing and plant disease resistance. Biotechnol. Genet. Rev. 1998, 15, 457−498. (11) Mayer, A. M.; Harel, E. Polyphenol oxidases in plants. Phytochemistry 1979, 18, 193−215. (12) Mayer, A. M. Polyphenol oxidases in plants-recent progress. Phytochemistry 1987, 26, 11−20. (13) Amiot, M.; Tacchini, M.; Aubert, S.; Nicolas, J. Phenolic composition and browning susceptibility of various apple cultivars at maturity. J. Food Sci. 1992, 57, 958−962. (14) Chen, L.; Berenbaum, M.; Zangerl, A.; Engeseth, N. Honeys from different floral sources as inhibitors of enzymatic browning in fruit and vegetable homogenates. J. Agric. Food Chem. 2000, 48, 4997− 5000. (15) Sellés-Marchart, S.; Luque, I.; Casado-Vela, J.; Martínez-Esteso, M. J.; Bru-Martínez, R. Proteomics of multigenic families from species underrepresented in databases: the case of loquat (Eriobotrya japonica Lindl.) polyphenol oxidases. J. Proteome Res. 2008, 7, 4095−4106. (16) Haruta, M.; Murata, M.; Kadokura, H.; Homma, S. Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees. Phytochemistry 1999, 50, 1021−1025. (17) Thygesen, P. W.; Dry, I. B.; Robinson, S. P. Polyphenol oxidase in potato. Plant Physiol. 1995, 109, 525−531. (18) Wang, J.; Constabel, C. P. Polyphenol oxidase overexpression in transgenic Populus enhances resistance to herbivory by forest tent caterpillar (Malacosoma disstria). Planta 2004, 220, 87−96. (19) Gooding, S. P.; Bird, C.; Robinson, P. S. Molecular cloning and characterisation of banana fruit polyphenol oxidase. Planta 2001, 213, 748−757. (20) Kim, J. Y.; Seo, Y. S.; Kim, J. E.; Sung, S. K.; Song, K. J.; An, G.; Kim, W. T. Two polyphenol oxidases are differentially expressed during vegetative and reproductive development and in response to wounding in the Fuji apple. Plant Sci. 2001, 161, 1145−1152. (21) Boss, P. K.; Gardner, R. C.; Janssen, B. J.; Ross, G. S. An apple polyphenol oxidase cDNA is up-regulated in wounded tissues. Plant Mol. Biol. 1995, 27, 429−433. (22) Morante-Carriel, J. A. Ph.D. Thesis, Universidad de Alicante, 2012 (23) Sellés, S.; Casado-Vela, J.; Bru, R. Isolation of a latent polyphenol oxidase from loquat fruit (Eriobotrya japonica Lindl.): kinetic characterization and comparison with the active form. Arch. Biochem. Biophys. 2006, 446, 175−185. (24) Wang, W.; Scali, M.; Vignani, R.; Spadafora, A.; Sensi, E.; Mazzuca, S.; Cresti, M. Protein extraction for two-dimensional electrophoresis from olive leaf, a plant tissue containing high levels of interfering compounds. Electrophoresis 2003, 24, 2369−2375. (25) Bensadoun, A.; Weinstein, D. Assay of proteins in the presence of interfering materials. Anal. Biochem. 1976, 70, 241−250. (26) Raghupathi, R. N.; Diwan, A. M. A protocol for protein estimation that gives a nearly constant color yield with simple proteins and nullifies the effects of four known interfering agents: microestimation of peptide groups. Anal. Biochem. 1994, 219, 356−359.

(27) Laemmli, U. K. Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4. Nature 1970, 227, 680− 685. (28) Neuhoff, V.; Arold, N.; Taube, D.; Ehrhardt, W. Improved staining of proteins in polyacrylamide gels including isoelectric focusing gels with clear background at nanogram sensivity using Coomasie Brilliant blue G-250 and R-250. Electrophoresis 1988, 9, 255−262. (29) Meza, J. E.; Miller, C. A.; Fischer, S. M. Improved tryptic digestion of proteins using 2,2,2-trifluoroethanol (TFE). Agilent Technologies-Application Note 5989-1781EN; Agilent Technologies: Santa Clara, CA, 2004 (http://www.chem.agilent.com/Library/ posters/Public/5989-1781EN.pdf). (30) Shevchenko, A.; Wilm, M.; Vorm, O.; Mann, M. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 1996, 68, 850−858. (31) Larkin, M. A.; Blackshields, G.; Brown, N. P.; Chenna, R.; McGettigan, P. A.; McWilliam, H.; Valentin, F.; Wallace, I. M.; Wilm, A.; Lopez, R.; Thompson, J. D.; Gibson, T. J.; Higgins, D. G. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947−2948. (32) Wilkins, M. R.; Gasteiger, E.; Bairoch, A.; Sanchez, J. C.; Williams, K. L.; Appel, R. D.; Hochstrasser, D. F. Protein identification and analysis tools in the ExPASy server. Methods Mol. Biol. 1999, 112, 531−552. (33) Barr, J. R.; Maggio, V. L.; Patterson, D. G., Jr.; Cooper, G. R.; Henderson, L. O.; Turner, W. E.; Smith, S. J.; Hannon, W. H.; Needham, L. L.; Sampson, E. J. Isotipe dilution- Mass spectrometric quantification of specific proteins: Model application with apolipoprotein A-I. Clin. Chem. 1996, 42, 1676−1682. (34) Gerber, S. A.; Rush, J.; Stemman, O.; Kirschner, M. W.; Gygi, S. P. Absolute quantification of proteins and phosphoproteins from cell lysates by tandem MS. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 6940− 6945. (35) Janecki, D. J.; Bemis, K. G.; Tegeler, T. J.; Sanghani, P. C.; Zhai, L.; Hurley, T. D.; Bosron, W. F.; Wang, M. A multiple reaction monitoring method for absolute quantification of the human liver alcohol dehydrogenase ADH1C1 isoenzyme. Anal. Biochem. 2007, 369, 18−26. (36) Jessome, L. L.; Volmer, D. A. Ion suppression: a major concern in mass spectrometry. LCGC North Am. 2006, 24, 498−510. (37) Lehmann, U.; Wienkoop, S.; Tschoep, H.; Weckwerth, W. If the antibody fails - a mass Western approach. Plant J. 2008, 55, 1039− 1046. (38) Halvey, P. J.; Ferrone, C. R.; Liebler, D. C. GeLC-MRM Quantitation of Mutant KRAS Oncoprotein in Complex Biological Samples. J. Proteome Res. 2012, 11, 3908−3913. (39) Sommer, A.; Ne’eman, E.; Steffens, J. C.; Mayer, A. M.; Harel, E. Import, targeting, and processing of a plant polyphenol oxidase. Plant Physiol. 1994, 105, 1301−1311. (40) Koussevitzky, S.; Ne’eman, E.; Sommer, A.; Steffens, J.; Harel, E. Purification and properties of a novel chloroplast stromal peptidase. Processing of polyphenol oxidase and other imported precursors. J. Biol. Chem. 1998, 273, 27064−27069. (41) Sellés, S.; Casado-Vela, J.; Bru, R. Effect of detergents, trypsin and unsaturated fatty acids on latent loquat fruit polyphenol oxidase: Basis for the enzyme’s activity regulation. Arch. Biochem. Biophys. 2007, 464, 295−305. (42) MacLean, B.; Tomazela, D. M.; Shulman, N.; Chambers, M.; Finney, G. L.; Frewen, B.; Kern, R.; Tabb, D. L.; Liebler, D. C.; MacCoss, M. J. Skyline: an open source document editor for creating and analyzing targeted proteomics experiments. Bioinformatics 2010, 26, 966−968. (43) King, R. S.; Flurkey, W. Effects of limited proteolysis on broad bean polyphenol oxidase. J. Sci. Food Agric. 1987, 41, 231−240. (44) Desiere, F.; Deutsch, E. W.; King, N. L.; Nesvizhskii, A. I.; Mallick, P.; Eng, J.; Chen, S.; Eddes, J.; Loevenich, S. N.; Aebersold, R. The PeptideAtlas project. Nucleic Acids Res. 2006, 34, D655−D658. (45) Keshishian, H.; Addona, T.; Burgess, M.; Kuhn, E.; Carr, S. A. Quantitative, Multiplexed Assays for Low Abundance Proteins in 5721



Article

Plasma by Targeted Mass Spectrometry and Stable Isotope Dilution. Mol. Cell. Proteomics 2007, 6, 2212−2229. (46) Zhang, H.; Liu, Q.; Zimmerman, L. J.; Ham, A. J. L.; Slebos, R. J. C.; Rahman, J.; Kikuchi, T.; Massion, P. P.; Carbone, D. P.; Billheimer, D.; Liebler, D. C. Methods for peptide and protein quantitation by liquid chromatography-multiple reaction monitoring mass spectrometry. Mol. Cell Proteomics 2011, 10, 1−17.

5722


Development and Validation of MRM Methods to ... - ACS Publications

Recommend Documents