Article pubs.acs.org/JAFC
Development of a PCR-Based Method for Detection of Delphinium Species in Poisoned Cattle Daniel Cook,* James A. Pfister, John R. Constantino, Jessie M. Roper, Dale R. Gardner, Kevin D. Welch, Zachary J. Hammond, and Benedict T. Green USDA ARS Poisonous Plant Research Laboratory, 1150 East 1400 North, Logan, Utah 84341, United States ABSTRACT: Toxic plants such as Delphinium spp. (i.e., larkspur) are a significant cause of livestock losses worldwide. Correctly determining the causative agent responsible for the death of an animal, whether by disease, poisonous plant, or other means, is critical in developing strategies to prevent future losses. The objective of this study was to develop an alternative diagnostic tool to microscopy and analytical chemistry to determine whether a particular poisonous plant was ingested. Polymerase chain reaction (PCR) is a tool that may allow detection of the genetic material from a specific plant within a complex matrix such as rumen contents. A pair of oligonucleotide primers specific to Delphinium spp. (i.e., larkspur) was developed; using these primers, a PCR product was detected in samples from an in vivo, in vitro, and in vivo/in vitro coupled digestion of Delphinium occidentale. Lastly, larkspur was detected in a matrix of ruminal material where the amount of larkspur was far less than what one would expect to find in the rumen contents of a poisoned animal. The PCR-based technique holds promise to diagnose larkspur and perhaps other toxic plant caused losses. KEYWORDS: Delphinium, PCR, diagnostic tool, rumen, poisoned
■
INTRODUCTION Larkspurs (Delphinium spp.) are poisonous plants on rangelands in the western United States. They are responsible for significant financial losses to the cattle industry and have been the subject of extensive research over the past century.1−3 Larkspur poisoning is estimated to cause losses to the livestock industry in the millions of dollars annually.4 Larkspur species are often divided into three groups principally based upon their height: low, intermediate, and tall.1 Taxonomic treatments of the genus Delphinium recognize greater than 50 species in North America.5−7 Seven of these species are responsible for most of the cattle losses in North America, D. andersonii, D. barbeyi, D. geyeri, D. glaucum, D. glaucescens, D. nuttallianum, and D. occidentale.2,8,9 Larkspur-induced poisoning in cattle is attributed to the norditerpene alkaloids that can represent up to 3% of the plant dry weight. When sufficient larkspur is ingested by cattle, these alkaloids cause neuromuscular paralysis by blocking nicotinic acetylcholine receptors in the muscle and brain, resulting in the clinical signs of labored breathing, increased heart rate, muscle tremors and fatigue, collapse, and ultimately death.2,10 The norditerpene alkaloids are divided into two main structural groups, the N-(methylsuccinimido) anthranoyllycoctonine type (MSAL-type) and the 7,8-methylenedioxylycoctonine type (MDL-type) norditerpenoid alkaloids.11,12 Determining the causative agent responsible for the death of an animal whether it be a disease, a poisonous plant, or some other entity is critical in developing strategies to prevent future losses.13 Each year cattle die on foothill and mountain ranges that contain larkspur as well as other poisonous plants. Oftentimes there is little evidence as to the cause of death other than the presence of larkspur plants in the pasture. Providing evidence of ingestion of a particular plant is one important step in determining the cause of the livestock loss. This article not subject to U.S. Copyright. Published 2015 by the American Chemical Society
Microscopy has been used to examine the rumen contents of animals for the presence of a particular plant.14,15 Both MSALand MDL-type norditerpene alkaloids can be detected in the rumen contents of poisoned animals by liquid chromatography−mass spectrometry (LC−MS) (unpublished data). This is a powerful diagnostic tool that points to the ingestion of a particular plant, however this technique may not be available to many veterinary diagnostic laboratories. Polymerase chain reaction (PCR) is an easily accessible tool that may allow detection of genetic material from a plant species within a complex matrix. Studies conducted with cattle have shown that plant-derived DNA is degraded throughout the digestive tract, but fragmented DNA was detectable in the gastrointestinal tract.16,17 Thus, the objective of these experiments was to evaluate the use of PCR as an alternative diagnostic tool to determine if Delphinium spp. could be detected within rumen contents in vitro and in vivo in simulations of a poisoning episode.
■
MATERIALS AND METHODS
Primer Design. The internal transcribed spacer of the rDNA sequences (ITS) from several Delphinium and Aconitum species from the Intermountain West were aligned using Sequencher (Gene Codes Corporation, Ann Arbor, MI). Aconitum species were used as a negative control in designing the primers as it represents the most closely related genus to Delphinium from a phylogenetic perspective.18 The ITS sequence representing each respective species was previously published18 and available on GenBank: D. andersonii (AF258773), D. barbeyi (AF258709), D. bicolor (AF258711), D. geyeri (AF258762), D. glaucescens (AF258754), D. glaucum (AF258739), D. novomexicanum Received: Revised: Accepted: Published: 1220
November 5, 2014 January 7, 2015 January 8, 2015 January 8, 2015 DOI: 10.1021/jf5053496 J. Agric. Food Chem. 2015, 63, 1220−1225
Journal of Agricultural and Food Chemistry
Article
Figure 1. Alignment of the internal transcribed spacer (ITS) of the rDNA from several Delphinium and Aconitum species. Oligonucleotide primers Delph1F and Delph1R are shown. (AF258718), D. nuttallianum (AF258688), D. ramosum (AF258687), D. scaposum (AF258732), A. columbianum (AF258683), and A. delphiniifolium (AF258681). An oligonucleotide forward primer Delph1F (5′ GTGAAAAYAAACCGRGACGG 3′) and reverse primer Delph1R (5′ GGGGATGATGAGCACACAACCA 3′) were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA). Ruminally Cannulated Animals. Three ruminally cannulated Angus cows (510 kg) were maintained on a diet of alfalfa hay at maintenance levels (ca. 10 kg/day). The diet was offered twice daily at 8:30 and 16:00 h. All procedures were approved by the Utah State University IACUC committee and were conducted under veterinary supervision. Plant Material. Plant material from previous collections representing the following species were used to validate the specificity of the primers: D. occidentale (Logan, UT), D. nuttallianum (Colbrun, CO), D. andersonii (Garrison, UT), D. glaucesens (Dillon, MT), D. scaposum (Tuweep, AZ), D. ramosum (Cuchara, CO), D. barbeyi (Crested Butte, CO), D. occidentale (Wilsal, MT), A. columbianum (Elko, NV), and Medicago sativa (Logan, UT). Delphinium species were the target species while A. columbianum and M. sativa were used as negative controls to validate that the primers were specific. Samples when initially collected were placed on dry ice at the time of collection, frozen and freeze-dried upon return to the laboratory, and ground for subsequent DNA extraction. In Vivo Rumen Digestion. Delphinium occidentale leaves collected from Logan, UT, previously frozen, then thawed, were manually cut into pieces with a diameter ranging from 0.5 to 1.5 cm2. Five grams of cut leaves were placed in each of 27 nylon bags (10 cm × 20 cm and 50 μm pore size) (Ankom Technology, Macedon, NY), respectively.19 Three bags of material were freeze-dried as control samples. Eight bags each were incubated in the rumen of three ruminally cannulated cows. All eight bags were placed in a larger nylon bag of the same porosity with an inert weight enclosed so the samples would be continually submersed in rumen fluid in the ventral sac, and a 50 cm nylon string attached to allow movement within the rumen yet facilitate the retrieval of the bags. One bag was removed from each animal (n = 3) at the following time points: 4 h, 8 h, 12 h, 16 h, 20 h, 24 h, 36 h, and 48 h. Samples were immediately placed in a −20 °C freezer upon removal and subsequently freeze-dried and ground (1 mm screen). In Vitro Rumen Digestion. Delphinium occidentale leaves, previously frozen, then thawed, from Logan, UT, were cut into pieces with a diameter ranging from 0.5 to 1.5 cm2. Five grams of cut leaves were placed in each of 21 nylon bags (5 cm × 5 cm, 25 μm pore size, Ankom Technology). Three nylon bags were freeze-dried as control samples. Six bags were placed in each of three nonrotating digestion vessels containing freshly collected and anaerobic rumen inoculum (Daisy II incubator, Ankom Technology) at 39 °C representing a composite rumen fluid sample from the three cannulated cows. One bag was removed from each digestion vessel (n = 3) at the following time points: 8 h, 16 h, 24 h, 32 h, 40 h, and 48 h. Samples were immediately placed in a −20 °C freezer upon removal and subsequently freeze-dried and ground (1 mm screen). In Vivo and In Vitro Rumen Digestion. Delphinium occidentale leaves, previously frozen, then thawed, from Logan, UT, were cut into pieces with a diameter ranging from 0.5 to 1.5 cm2. Five grams of cut
leaves were placed in each of 21 nylon bags as noted above. Three nylon bags were freeze-dried as control samples. Eighteen bags were placed in the rumen of a canulated cow. All 18 bags were placed in a larger bag with the same porosity and an inert weight enclosed so the samples would be continually submersed in rumen fluid in the ventral sac, and a 50 cm string attached to allow movement and to facilitate the retrieval of the bags. All the bags were retrieved at 8 h, and three were immediately frozen. The remaining 15 bags were immediately placed into three nonrotating digestion vessels (Daisy II Incubator, Ankom Technology) containing freshly collected and anaerobic rumen fluid maintained at 39 °C representing a composite sample obtained from the three cannulated cows. One bag was removed from each digestion vessel (n = 3) at the following time points: 16 h (24 h total; 8 h in vivo + 16 h in vitro), 24 h (32 h total), 40 h (48 h total), 48 h (56 h total), and 64 h (72 h total). Samples were immediately placed in a −20 °C freezer upon removal and subsequently freeze-dried and ground. In Vivo Rumen Digestion Sensitivity. Different ratios of D. occidentale leaves from Logan, UT, previously frozen, then thawed, and an alfalfa hay mixture were prepared. Four replicate nylon bags of the following ratios were prepared (g of larkspur:g of alfalfa): 5:0, 1:2.13, 1:5.25, 1:11.5, 1:24, 1:49. One bag of each ratio was freeze-dried as a control sample. One sample of each ratio was placed in the rumen of each of the three cannulated cows. All bags were placed in a larger nylon bag of the same porosity with an inert weight so the samples would be submersed in rumen fluid, and a 50 cm string attached to allow movement within the ventral sac and to facilitate the retrieval of the bags. After 8 h all the samples were retrieved from the cannulated cows. In addition, 3 other ratios were prepared representing the control sample only, namely, 1:99, 1:199, and 1:399. Samples were immediately placed in a −20 °C freezer upon removal and subsequently freeze-dried and ground. DNA Extraction. DNA was extracted from ∼150 mg of freezedried ground tissue using the ZR plant/seed DNA MiniPrep kit (Zymo Research Corp., Irvine, CA). Extractions were performed according to the manufacturer’s instructions with one exception: the volume of lysis solution used was increased to 1.2 mL. DNA was quantitated with the ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE). Polymerase Chain Reaction (PCR). All PCR was performed with a Bio-Rad Dyad PCR detector (Bio-Rad Laboratories Inc., Hercules, CA). Thermal cycling conditions for all material were as follows: (a) an initial denaturation step for 3 min at 94 °C, (b) followed by 10 cycles of 30 s at 94 °C, 45 s at 60 °C, and 30 s at 72 °C, (c) followed by 25 cycles of 30 s at 94 °C, 45 s at 54 °C, and 30 s at 72 °C, and (d) a final extension of 5 min at 72 °C. Each reaction had a total volume of 50 μL containing 500 ng of DNA. GoTaq DNA polymerase (Promega Corporation, Madison, WI) was used following the reaction conditions recommended by the manufacturer. PCR products were resolved on a 1% agarose gel containing ethidium bromide at 118 V for 20 min and visualized under UV illumination. Agarose gels were visualized and analyzed with a Kodak Image Station 2000RT imager and its software (Eastman Kodak, Rochester, NY). Norditerpene Alkaloid Analysis. Prepared mixtures of plant material were analyzed for larkspur alkaloids by LC−MS.20 An aliquot 1221
DOI: 10.1021/jf5053496 J. Agric. Food Chem. 2015, 63, 1220−1225
Journal of Agricultural and Food Chemistry
Article
of plant material (100 mg) was extracted with 4.0 mL of methanol for 2 h by mechanical rotation in a sealed (screw cap) test tube. The sample was filtered, and a 0.500 mL aliquot of the extract was diluted with 0.500 mL of 20 mM ammonium acetate in a 1.5 mL autosample vial. LC−ESI-MS analyses was completed using a Thermo Scientific LCQ Advantage system with Surveyor HPLC and autosampler (Thermo Scientific, San Jose, CA). An injection volume of 10 μL was used on a 100 × 2.1 mm i.d., 5 μm, BetaSil C18 column (Thermo Scientific, San Jose, CA) eluted with a mixture of acetonitrile (A) and 0.5% acetic acid/0.05% trifluoroacetic acid (B) at a flow rate of 0.400 mL/min and the following linear gradient: 5−15% A from 0 to 1 min; 15−75% A from 1 to 8 min; 75% A from 8 to 10 min; 75−5% A from 10 to 11 min; and 5% A from 11 to 16 min. The flow from the column was connected directly to the ESI source. The major alkaloid in the D. occidentale plant material is deltaline and under the chromatographic conditions eluted with retention time of 4.1 min and gives a strong MH+ ion (m/z 508). Detection of the alkaloid was targeted by reconstructed ion chromatograms for this select ion.
In Vivo Rumen Digestion. An in vivo rumen digestion was performed to determine the length of time one may expect to detect larkspur in a living bovine after the animal ate the plant. A PCR product was amplified from D. occidentale samples that had been incubated in the rumen of the three cannulated cows after 4 h, 8 h, 12 h, and 16 h (Figure 3). At the 20 h and 24 h
■
RESULTS AND DISCUSSION Primer Specificity. Candidate specific oligonucleotide DNA primers were developed by aligning and comparing the ITS sequence from several Delphinium spp. as well as representative Aconitum spp. (Figure 1). Oligonucleotide DNA primers were tested to determine if they were specific to representative Delphinium taxa of the Western United States. Preliminary experiments were performed to optimize the annealing temperature and reaction conditions that would ensure they were specific to Delphinium and not other taxa. The optimal reaction conditions were an annealing temperature of 60 °C for 10 cycles followed by 25 cycles at an annealing temperature of 54 °C. The annealing temperature is critical as lower temperatures will result in amplification of a product from Aconitum. A 500 base pair (bp) product was amplified from the seven Delphinium species but not from the Aconitum or alfalfa sample (Figure 2). The results show that the primers
Figure 2. Agarose gel electrophoresis showing specificity of primers. 1000bp marker (LD) shown as a reference. Lanes: occidentale (Logan, UT); 2, D. nuttallianum; 3, D. andersonii; glaucescens; 5, D. scaposum; 6, D. ramosum; 7, D. barbeyi; occidentale; 9, A. columbianum; and 10, M. sativa.
Figure 3. Agarose gel electrophoresis showing amplification of PCR products from the in vivo rumen digestion. 1000bp marker (LD) shown as a reference. Triplicates of undigested positive control (+ctrl) and digested (4−48 h) D. occidentale. Negative control (−ctrl) representing A. columbianum and M. sativa.
time points, a PCR product was detected from 1 or 2 of the replicate samples (Figure 3). No PCR product was amplified from the samples after 36 h and 48 h. As expected, a PCR product was detected from the three control samples but not from the Aconitum or alfalfa sample (Figure 3). DNA was extracted from all the plant material a second time and PCR performed, and the same results were obtained (data not shown). These results suggest that the DNA representing D. occidentale is degraded over time and that by 36 h post incubation a PCR product is no longer detectable. Studies have shown that plant DNA, particularly naked DNA, may be rapidly degraded by the microbial activity in rumen fluid.21 Using realtime PCR, Alexander et al.22 found that digestion of DNA in canola was highly correlated with the digestive activity of intestinal microorganisms. However, DNA from maize has been shown to survive for up to 24 h in the rumen of sheep.23 Further, Wiedemann et al.24 reported that survival of corn DNA in the bovine rumen depended on fragment length, previous processing, and the length of time incubated in the rumen. The in vivo digestion and DNA degradation observed here may have occurred faster than would be expected in a natural grazing scenario, as the starting plant material was initially cut into smaller fragments compared to the large bites consumed by a grazing ruminant.25 However, biting, mastication, and comminution by a grazing animal may rapidly render grazed larkspur somewhat similar to the chopped material used in this study. Delphinium plants are nutritious and highly digestible;25,26 as such much of the ingested larkspur probably ends up in the upper layer in the ruminal dorsal sac, part of the raft or mat that is composed primarily of rapidly fermenting, buoyant particles. Digestion and retention time in the rumen
DNA 1, D. 4, D. 8, D.
amplified a product with all of the Delphinium species tested including five of the more important Delphinium species in the Western United States in terms of cattle losses. DNA was extracted from all the plant material a second time and PCR performed, and the same results were obtained (data not shown). The alignment of the ITS from the Delphinium species (Figure 1) suggests that the primers would also amplify other species including D. geyeri and D. glaucum. To further demonstrate that the primers amplified a Delphinium species, the PCR product could be verified by restriction enzyme digestion or sequencing. 1222
DOI: 10.1021/jf5053496 J. Agric. Food Chem. 2015, 63, 1220−1225
Journal of Agricultural and Food Chemistry
Article
5). As expected, a PCR product was detected from the three control samples but not from the Aconitum or alfalfa sample
will depend on many complex, interrelated factors, however for comparison ingested larkspur plants are likely to be very similar in retention time to high quality alfalfa hay.26 Effects of long form (i.e., intact) or chopped alfalfa hay on ruminal retention time were small when high quality alfalfa was used.27 The retention time in the rumen of high quality alfalfa hay is 18−21 h,27,28 and larkspur is probably similar. In Vitro Rumen Digestion. An in vitro rumen digestion was performed to determine the length of time one may expect to detect larkspur in a bovine rumen after a fatal poisoning episode, as the digestion vessels in the Daisy II digestion apparatus were not rotating as is typically done during in vitro experiments (i.e., mimicking a static rumen). A PCR product was detected from D. occidentale samples that had been incubated in digestion vessels of rumen fluid in each of the three replicates up to 40 h (Figure 4). At the 48 h time point, a
Figure 5. Agarose gel electrophoresis showing amplification of PCR products from the in vivo and in vitro coupled rumen digestion. 1000bp marker (LD) shown as a reference. Triplicates of undigested positive control (+ctrl) and digested (8−72 h) D. occidentale. Negative control (−ctrl) representing A. columbianum and M. sativa.
(Figure 5). DNA was extracted from all the plant material a second time and PCR performed, and the same results were obtained (data not shown). The results from this experiment were similar to the in vitro digestion alone. In Vivo Rumen Digestion Sensitivity. When collecting rumen samples from poisoned animals, it is not possible to sample the entire rumen. Thus, a rumen from a dead animal has to be randomly sampled with the assumption that the distribution of the plant material is fairly uniform throughout the rumen. Based on research at this Laboratory, we calculate that a minimum of 5−10% of a cow’s daily diet needs to be ingested larkspur for the cow to become poisoned.29−31 Consequently, in the best case scenario, a random sample of rumen contents will contain 5−10% (1:20−1:10) of larkspur plant material. Therefore, different ratios of alfalfa to D. occidentale were prepared to determine if it was feasible to detect 5% larkspur, or lower, in the rumen. A PCR product was detected from each undigested control ratio ranging from the D. occidentale only sample to 1 g of D. occidentale to 399 g of alfalfa (Figure 6). For comparison, the 1:399 sample was analyzed by LC−MS (Figure 7). The norditerpene alkaloids were detected in it and all other ratios. A PCR product was detected from each of the triplicate digested ratios ranging from the D. occidentale only sample to 1 g of D. occidentale to 49 g of
Figure 4. Agarose gel electrophoresis showing amplification of PCR products from the in vitro rumen digestion. 1000bp marker (LD) shown as a reference. Triplicates of undigested positive control (+ctrl) and digested (8−48 h) D. occidentale. Negative control (−ctrl) representing A. columbianum and M. sativa.
PCR product was amplified from one of the replicate samples (Figure 4). As expected a PCR product was detected from the three control samples but not from the Aconitum or alfalfa sample (Figure 4). DNA was extracted from all the plant material a second time and PCR performed, and the same results were obtained (data not shown). Differences were observed in the length of time a PCR product was detected between the in vivo and in vitro rumen digestion of D. occidentale. This was evident by the quality and quantity of DNA extracted from the starting material (data not shown). This may be due to the viability of the microflora in the in vitro rumen compared to the in vivo rumen. Further, it may be related to the total ruminal conditions during the in vivo process, including microbial numbers and activity, and rumen fermentation and motility resulting in faster degradation of the target DNA. In the in vitro digestion the rumen fluid was not moving nor was the plant material continually bathed in rumen fluid. The plant material in the nylon bags was buoyant, and moved to the top of the digestion vessel with the other plant material equivalent to the rumen mat. However, there still was evidence of digestion as the nylon bag expanded over time due to the production of gases as the result of fermentation. In Vivo and In Vitro Rumen Digestion. An in vivo digestion was coupled with an in vitro digestion to determine the length of time one may expect to detect larkspur in a bovine that consumed larkspur and died 8 h later. A PCR product was detected from D. occidentale samples that had been incubated in vivo and in vitro from 8 h to 72 h in all three replicates (Figure
Figure 6. Agarose gel electrophoresis showing amplification of PCR products from different undigested ratios of larkspur to alfalfa. 1000bp marker (LD) shown as a reference. Ratios represent grams of larkspur:grams of alfalfa. 1223
DOI: 10.1021/jf5053496 J. Agric. Food Chem. 2015, 63, 1220−1225
Journal of Agricultural and Food Chemistry
Article
supporting the idea that PCR could be used as a diagnostic tool if the dead animals are found and samples collected within 2 days. In summary, we developed a pair of oligonucleotide primers specific to Delphinium spp. Using these primers, a PCR product was detected in samples from an in vivo, in vitro, and in vivo/in vitro coupled digestion of D. occidentale. Lastly, using this method, we were able to detect larkspur in a matrix where the amount of larkspur was far less than what one would expect to find in the rumen contents of a poisoned animal. These data demonstrate that this method and the primers are both specific and sensitive, a characteristic of a good diagnostic tool. This research offers a proof of principle that PCR-based methods could be used as a diagnostic tool to detect a plant of interest in the rumen contents of a poisoned animal. However, further research is needed to validate this method. For example, rumen samples need to be collected and analyzed from actual field cases of poisoned cattle. Also additional research needs to be performed to compare the sensitivity and robustness of this PCR-based method to chemical methods where the norditerpene alkaloids are detected. Finally, hypothetically, a PCRbased method could be developed for diagnosis of poisoning by any other plant species that is acutely toxic such as water hemlock, death camas (Zigadenus spp.), and oleander (Nerium oleander).
Figure 7. LC−MS analysis of mixture of D. occidentale and alfalfa (1 g:399 g). (A) Total ion chromatogram (TIC) and reconstructed ion chromatogram (RIC) (m/z 508) of the methanol extract from the mixed plant material. The alkaloid deltaline eluting at tR = 4.08 min. (B) Mass spectrum of the peak at 4.1 min.
alfalfa (Figure 8). As expected, a PCR product was not detected from the Aconitum or alfalfa sample (Figure 8). DNA was
■
AUTHOR INFORMATION
Corresponding Author
*Tel: (435) 752-2941. Fax: (435) 753-5681. E-mail: daniel.
[email protected]. Notes
The authors declare no competing financial interest.
■ ■
Figure 8. Agarose gel electrophoresis showing amplification of PCR products from undigested positive control (+ctrl) and the in vivo rumen digestion from different ratios of larkspur to alfalfa. 1000bp marker (LD) shown as a reference. Ratios represent grams of larkspur:grams of alfalfa. Negative control (−ctrl) representing A. columbianum and M. sativa.
ACKNOWLEDGMENTS We thank Kermit Price and Scott Larsen for their technical assistance. REFERENCES
(1) Marsh, C. D.; Clawson, A. B.; Marsh, H. Larkspur poisoning of livestock. U.S., Dep. Agric., Bull. 1916, No. No.365, 91. (2) Pfister, J. A.; Gardner, D. R.; Panter, K. E.; Manners, G. D.; Ralphs, M. H.; Stegelmeier, B. L.; Schoch, T. K. Larkspur (Delphinium spp.) poisoning in livestock. J. Nat. Toxins 1999, 8, 81−94. (3) Pfister, J. A.; Ralphs, M. H.; Gardner, D. R.; Stegelmeier, B. L.; Manners, G. D.; Panter, K. E.; Lee, S. T. Management of three toxic Delphinium species based on alkaloid concentrations. Biochem. Syst. Ecol. 2002, 30, 129−138. (4) Nielsen, D. B.; Ralphs, M. H.; Evans, J. S. Economic feasibility of controlling tall larkspur on rangelands. J. Range Manage. 1994, 47, 369−372. (5) Ewan, J. A synopsis of the North American species of Delphinium. Univ. Colorado Studies, Ser. D 1945, 2, 55−244. (6) Warnock, M. J. A taxonomic conspectus of North American Delphinium. Physiologia 1995, 78, 73−101. (7) Warncok, M. J. Delphinium Linnaeus. Flora North Am. 1997, 3, 196−240. (8) Kingsbury, J. M. Poisonous plants of the US and Canada; Prentice Hall: 1964. (9) Green, B. T.; Gardner, D. R.; Pfister, J. A.; Cook, D. Larkspur poison weed: 100 years of Delphinium research. Rangelands 2009, 31, 22−27. (10) Green, B. T.; Welch, K. D.; Cook, D.; Gardner, D. R. Potentiation of the actions of acetylcholine, epibatidine, and nicotine by methyllycaconitine at fetal muscle-type nicotinic acetylcholine receptors. Eur. J. Pharmacol. 2011, 662, 15−21.
extracted from a subset of the plant material a second time and PCR performed, and the same results were obtained (data not shown). These results suggest that, if a rumen from a poisoned animal were sampled from several spots at random, there would likely be sufficient larkspur to detect a PCR product based upon the amount of larkspur one would expect to find in a poisoned animal. Two principal limitations exist with using PCR as a diagnostic tool. The first is a matter of sampling the rumen from the poisoned animal. How much material would need to be sampled to provide confidence that the sample is representative of the overall rumen contents? The data reported here are promising, as a PCR product was detected at a ratio of 1:399, while larkspur is likely to comprise 5−10% (1:20−1:10) or higher of the rumen contents of a poisoned animal.2,29,31 However, in the cases of plants that are more acutely toxic such as water hemlock (Cicuta spp.), this may not be feasible as there could be much less plant material. The second limiting factor is the integrity of the template DNA. Often there is a lapse in time between the death of an animal and its discovery and the subsequent sampling of rumen contents. The data reported here suggests that up to 48 h after the death of the animal, as mimicked by the coupled in vivo and in vitro samples, larkspur can still be detected by PCR, thus 1224
DOI: 10.1021/jf5053496 J. Agric. Food Chem. 2015, 63, 1220−1225
Journal of Agricultural and Food Chemistry
Article
(11) Olsen, J. D.; Manners, G. D.; Pelletier, S. W. Poisonous properties of Larkspur (Delphinium spp.). Collect. Bot. (Barcelona) 1990, 19, 141−151. (12) Panter, K. E.; Manners, G. D.; Stegelmeier, B. L.; Lee, S. T.; Gardner, D. R.; Ralphs, M. H.; Pfister, J. A.; James, L. F. Larkspur poisoning: alkaloid structure−activity relationships and toxicity. Biochem. Syst. Ecol. 2002, 30, 113−128. (13) Stegelmeier, B. L.; Green, B. T.; Panter, K. E.; Welch, K. D.; Hall, J. O. Identifying Plant Poisoning in Livestock. Rangelands 2009, 31, 5−9. (14) Sparks, D. R.; Malechek, J. C. Estimating percentage dry weight in diets using a microscopic technique. J. Range Manage. 1968, 21, 264−265. (15) Holechek, J. L.; Vavra, M.; Pieper, R. D. Botanical composition determination of range herbivore diets: a review. J. Range Manage. 1982, 35, 309−315. (16) Chowdhury, E. H.; Mikami, O.; Murata, H.; Sultana, P.; Shimada, N.; Yoshioka, M.; Guruge, K. S.; Yamamoto, S.; Miyazaki, S.; Yamanaka, N. Fate of maize intrinsic and recombinant genes in calves fed genetically modified maize Bt11. J. Food Prot. 2004, 67, 365−370. (17) Einspanier, R.; Lutz, B.; Rief, S.; Berezina, O.; Zverlov, V.; Schwarz, W.; Mayer, J. Tracing residual recombinant feed molecules during digestion and rumen bacterial diversity in cattle fed transgene maize. Eur. Food Res. Technol. 2004, 218, 269−273. (18) Koontz, J. A.; Soltis, P. S.; Soltis, D. E. Using phylogeny reconstruction to test hypotheses of hybrid origin in Delphinium section Diedropetala (Ranunculaceae). Syst. Bot. 2004, 29, 345−357. (19) Ørskov, E. R.; Hovell, F. D.; Mould, F. The use of the nylon bag technique for the evaluation of feedstuffs. Trop. Anim. Prod. 1980, 5, 195−213. (20) Gardner, D. R.; Panter, K. E.; Pfister, J. A.; Knight, A. P. Analysis of toxic norditerpenoid alkaloids in Delphinium species by electrospray, atmospheric pressure chemical ionization, and sequential tandem mass spectrometry. J. Agric. Food Chem. 1999, 47, 5049−5058. (21) Duggan, P. S.; Chambers, P. A.; Heritage, J.; Forbes, J. M. Survival of free DNA encoding antibiotic resistance from transgenic maize and the transformation activity of DNA in ovine saliva, ovine rumen fluid and silage effluent. FEMS Microbiol. Lett. 2000, 191, 71− 77. (22) Alexander, T. W.; Sharma, R.; Deng, M. Y.; Whetsell, A. J.; Jennings, J. C.; Wang, Y.; Okine, E.; Damgaard, D.; McAllister, T. A. Use of quantitative real-time and conventional PCR to assess the stability of the cp4 epsps transgene from Roundup Ready® canola in the intestinal, ruminal, and fecal contents of sheep. J. Biotechnol. 2004, 112, 255−266. (23) Duggan, P. S.; Chamber, P. A.; Heritage, J.; Forbes, J. M. Fate of genetically modified maize DNA in the oral cavity and rumen of sheep. Br. J. Nutr. 2003, 89, 159−166. (24) Wiedemann, S.; Lutz, B.; Kurtz, H.; Schwarz, F.; Albrecht, C. In situ studies on the time-dependent degradation of recombinant corn DNA and protein in the bovine rumen. J. Anim. Sci. 2006, 84, 135− 144. (25) Pfister, J. A.; Manners, G. D.; Ralphs, M. H.; Hong, Z. X.; Lane, M. A. Effects of phenology, site, and rumen fill on tall larkspur consumption by cattle. J. Range Manage. 1988, 41, 509−514. (26) Pfister, J. A.; Adams, D. C.; Arambel, M. J.; Olsen, J. D.; James, L. F. Sublethal levels of toxic larkspur: effects on intake and rumen dynamics in cattle. Nutr. Rep. Int. 1989, 40, 629−636. (27) Shaver, R. D.; Nytes, A. J.; Satter, L. D.; Jorgensen, N. A. Influence of amount of feed intake and forage physical form on digestion and passage of prebloom alfalfa hay in dairy cows. J. Dairy Sci. 1986, 69, 1545−1559. (28) Shaver, R. D.; Satter, L. D.; Jorgensen, N. A. Impact of forage fiber content on digestion and digesta passage in lactating dairy cows. J. Dairy Sci. 1988, 71, 1556−1565. (29) Pfister, J. A.; Panter, K. E.; Manners, G. D. Effective dose in cattle of toxic alkaloids from tall larkspur (Delphinium barbeyi). Vet. Hum. Toxicol. 1994, 36, 10−11.
(30) Pfister, J. A.; Gardner, D. R.; Price, K. W. Grazing risk on tall larkspur-infested ranges. Rangelands 1997, 19, 12−15. (31) Welch, K. D.; Green, B. T.; Gardner, D. R.; Cook, D.; Pfister, J. A.; Stegelmeier, B. L.; Panter, K. E.; Davis, T. Z. Influence of 7,8methylenedioxylycoctonine-type alkaloids on the toxic effects associated with ingestion of tall larkspur (Delphinium spp.) in cattle. Am. J. Vet. Res. 2010, 71, 487−492.
1225
DOI: 10.1021/jf5053496 J. Agric. Food Chem. 2015, 63, 1220−1225
