Direct Selective Functionalization of Nanometer-Separated Gold

Nanometer-Separated Gold Electrodes with DNA ... Received September 5, 2002. ..... and 5 nm of Ni/Cr followed by 17 nm of Au was deposited in stripes...
0 downloads 0 Views 510KB Size
Download PDF
Langmuir 2003, 19, 981-984

981

Direct Selective Functionalization of Nanometer-Separated Gold Electrodes with DNA Oligonucleotides Christoph Wa¨lti,*,† Rene´ Wirtz,† W. Andre´ Germishuizen,‡ David M. D. Bailey,‡ Michael Pepper,† Anton P. J. Middelberg,‡ and A. Giles Davies† Semiconductor Physics Group, Cavendish Laboratory, University of Cambridge, Cambridge CB3 0HE, United Kingdom, and Department of Chemical Engineering, University of Cambridge, Cambridge CB2 3RA, United Kingdom Received September 5, 2002. In Final Form: December 16, 2002 The ability to pattern a surface locally with different molecular monolayers in a well-controlled fashion and at nanoscale resolution has importance for molecular electronics and biotechnology applications, as well as for nanoengineering. Here, we report a new technique for selectively functionalizing closely spaced gold electrodes of separation below 50 nm with different thiolated oligonucleotides using a local, selective electrochemical desorption of a molecular protection layer followed by the subsequent adsorption of the oligonucleotides onto the exposed surface. This technique does not rely on the use of a local probe such as an atomic force microscope tip. We furthermore show that the surface-bound oligonucleotides retain their unique molecular recognition and self-assembly properties and so functionalize the electrode array.

Among the many challenges facing the development of a molecular-based nanotechnology, the directed assembly of discrete molecular objects and their controlled integration into macroscopic structures are fundamental.1 The selective self-assembly characteristic inherent to certain molecules (for example, the Watson-Crick specific base pairing that occurs between complementary single strands of DNA) is a property that could be exploited to address these challenges. For example, ordered suspensions of gold nanoparticles have been assembled by first functionalizing the nanoparticles with short DNA oligonucleotides and then introducing complementary DNA to tie the individual particles together as the strands hybridize.2 In principle, this concept could be employed to tackle the integration of nanoscale elements onto a macroscopic substrate, such as an array of metal electrodes. Providing each electrode is functionalized with anchoring oligonucleotides of a unique sequence, the nanoscale elements will assemble appropriately if they are functionalized with the complementary oligonucleotides. Indeed, the ability to pattern a surface locally with different molecular monolayers in a well-controlled fashion and with a high spatial resolution has importance for molecular electronics3,4 and biotechnology applications (including high-density DNA expression analysis, genotyping, and lab-on-the-chip applications),5-7 as well as for nanoengineering.2,8,9 * To whom correspondence should be addressed. E-mail: [email protected]. † Semiconductor Physics Group. ‡ Department of Chemical Engineering. (1) Lehn, J. M. Supramolecular Chemistry: Concepts and Perspectives; VCH: Weinheim, 1995. (2) Mirkin, C. A.; Letsinger, R. L.; Mucic, R. C.; Storhoff, J. J. Nature 1996, 382, 607. (3) Petty, M. C.; Bruce, M. R.; Bloor, D. An Introduction to Molecular Electronics; Edward Arnold: London, 1995. (4) Eichen, Y.; Braun, E.; Sivan, U.; Ben-Yoseph, G. Acta Polym. 1998, 49, 663. (5) Lennon, G. G. Drug Discovery Today 2000, 5, 59. (6) Schulze, A.; Downward, J. Nat. Cell Biol. 2001, 3, E190. (7) Bier, F. F.; Kleinjung, F. Fresenius’ J. Anal. Chem. 2001, 371, 151. (8) Alivisatos, A. P.; Johnsson, K. P.; Peng, X.; Wilson, T. E.; Loweth, C. J.; Bruchez, M. P., Jr.; Schultz, P. G. Nature 1996, 382, 609. (9) Mao, C.; Sun, W.; Seeman, N. C. Nature 1997, 386, 137.

Figure 1. Cyclic voltammograms of a bare Au electrode immediately after cleaning (dashed line) and the same electrode after coating with a MCH molecular monolayer (solid line) and after desorbing the MCH monolayer (dotted line). All voltammograms were measured at 62 mV/s in 100 mM phosphate buffer at pH 10 vs a Ag/AgCl reference electrode and started at -0.4 V. An up-and-down sweep is shown for each case.

A number of techniques are available for introducing oligonucleotides or other anchor molecules locally onto a surface, but none of these simultaneously meet the requirements of resolution, speed, and the ability to coat different electrodes uniquely. Microdrop dispensing systems10 provide simple approaches for the controlled multiple coating of an electrode array but are restricted to a spatial resolution of greater than 10 µm. Micromachining11 and microcontact printing12 offer spatial resolutions of several hundred nanometers but lack the ability of multiple coating. A much higher resolution (a few tens of nanometers) has been achieved by nanografting,13 but (10) Yershov, G.; Barsky, V.; Belgovskiy, A.; Kirillov, E.; Kreindlin, E.; Ivanov, I.; Parinov, S.; Guschin, D.; Drobishev, A.; Dubiley, S.; Mirzabekov, A. Proc. Natl. Acad. Sci. U.S.A. 1996, 93, 4913. (11) Abbott, N. L.; Folkers, J. P.; Whitesides, G. M. Science 1992, 257, 1380. (12) Kumar, A.; Whitesides, G. M. Science 1994, 263, 60. (13) Xu, S.; Liu, G. Y. Langmuir 1997, 13, 127.

10.1021/la026513w CCC: $25.00 © 2003 American Chemical Society Published on Web 01/24/2003

982

Langmuir, Vol. 19, No. 4, 2003

Letters

Figure 2. Optical image of the selectively coated electrode array after the detection procedure. The sub-50-nm gaps separating opposing electrodes occur at the upper junctions between the wide and narrow metal strips and are indicated by the arrows. The three narrow metal strips in the center of the picture are hence part of electrodes 4, 5, and 6. Electrodes labeled 2, 4, and 6 were coated with oligonucleotide X using the selective desorption technique described in the text and subsequently colored using the anti-biotin antibody detection scheme. The color contrast between the electrodes (electrodes 2, 4, and 6 are significantly darker than electrodes 1, 3, and 5) shows that a very high degree of selective coating has been achieved across the nanometer-sized gaps. Note that the narrow central stripes are initially darker than the wide features owing to the metal layer being thinner there.

this technique is slow, lacks a straightforward extension to allow multiple coating, and requires complex and expensive infrastructure. Recently, a variant of the nanografting technique, dip-pen nanolithography, has been reported.14-17 This technique uses an atomic force microscope (AFM) tip, coated with the anchor molecules, as a pen to draw onto the surface. The resolution of this coating technique is also on the nanometer scale, but a high level of stability and solubility of the anchor molecules is required. However, both techniques rely on a local probe (AFM) to coat the surface which is an inherently slow and sequential process. Here, we report a method for selectively coating a set of sub-50-nm-separated gold electrodes with different thiolated oligonucleotides in a controlled and simple fashion. Inspired by conventional UV photolithography, where a light sensitive resist that covers a surface is selectively removed to expose specific regions, we coat our electrode array with a molecular monolayer which acts as a resist. Monolayers of thiol compounds, including thiolated oligonucleotides, can be formed on gold surfaces by simply immersing the surface in an aqueous solution containing the thiolated molecules of interest.18,19 Electrochemical studies show that the gold-sulfur bond formed during this spontaneous chemisorption process can undergo reductive cleavage at about -1 V versus a Ag/AgCl reference electrode, depending on the pH of the electrolyte.20-24 We use these spontaneous chemisorption and electrochemical desorption mechanisms to control the (14) Piner, R. D.; Zhu, J.; Xu, F.; Hong, S. H.; Mirkin, C. A. Science 1999, 283, 661. (15) Lee, K. B.; Park, S. J.; Mirkin, C. A.; Smith, J. C.; Mrksich, M. Science 2002, 295, 1702. (16) Schwartz, P. V. Langmuir 2002, 18, 4041. (17) Demers, L. M.; Ginger, D. S.; Park, S. J.; Li, Z.; Chung, S. W.; Mirkin, C. A. Science 2002, 296, 1836. (18) Ulman, A. Chem. Rev. 1996, 96, 1533. (19) Herne, T. M.; Tarlov, M. J. J. Am. Chem. Soc. 1997, 119, 8916. (20) Widrig, C. A.; Chung, C.; Porter, M. D. J. Electroanal. Chem. 1991, 310, 335.

Figure 3. Scanning electron micrograph of the junction region between electrodes 1 and 4 of Figure 2 (indicated by the arrow in Figure 2; electrode 1 is on the left and electrode 4 is on the right side of the gap). The gap is indicated by the white arrow. The picture was taken after the anti-biotin antibody detection process. The inset is an enlarged view of the central region of the main picture and shows the gap (dark line, indicated by the white arrow) to be significantly less than 50 nm.

formation and removal of molecular monolayers on the electrode array. The bare electrodes can be subsequently (21) Weisshaar, D. E.; Lamp, B. D.; Porter, M. D. J. Am. Chem. Soc. 1992, 114, 5860. (22) Imabayashi, S.; Hobara, D.; Kakiuchi, T.; Knoll, W. Langmuir 1997, 13, 4502. (23) Esplandiu, M. J.; Hagenstrom, H.; Kolb, D. M. Langmuir 2001, 17, 828. (24) Gittins, D. I.; Bethell, D.; Schiffrin, D. J.; Nichols, R. J. Nature 2000, 408, 67.

Letters

Langmuir, Vol. 19, No. 4, 2003 983

Figure 4. Electrode arrays in which electrodes 1, 3, and 5 are coated with oligonucleotides Y and electrodes 2, 4, and 6 with oligonucleotides X. Arrows indicate the nanoscale gaps separating opposing electrodes. (a) When the array is challenged with biotinylated oligonucleotides Y, followed by the anti-biotin antibody detection process, electrodes 1, 3, and 5 darken, confirming the presence of surface-bound oligonucleotides Y. (b) When the array is challenged with biotinylated oligonucleotides X, followed by the anti-biotin antibody detection process, electrodes 2, 4, and 6 darken, confirming the presence of surface-bound oligonucleotides X.

coated sequentially with different thiolated oligonucleotides. We monitor the coating and decoating steps with cyclic voltammetry (CV). The spatial resolution of this technique is currently limited only by the feature size of the electrode array. A series of opposing gold electrodes of sub-50-nm separation was fabricated on a Si/SiO2 wafer using standard UV lithography/lift-off techniques.25 The patterned wafer was cleaned by washing in “piranha etch” (30% H2O2, 70% H2SO4) for 1 h and then thoroughly rinsed in deionized water, ethanol, and again in deionized water. The entire electrode array was then coated with a protective molecular monolayer of 6-mercapto-1-hexanol (MCH) by immersing the wafer in a 1 mM aqueous solution of MCH for 60 min. Figure 1 compares the CV trace of a coated electrode (solid line) with that of a clean electrode prior to coating (dashed line). A reductive desorption feature observed at around -1 V for the coated electrode indicates the removal of the MCH monolayer. All electrochemical measurements were performed in 100 mM phosphate buffer at pH 10 using a standard three-electrode setup at a rate of 62 mV/s.26 A high-purity platinum wire was used as the counter electrode. All electrochemical potentials are reported versus a Ag/AgCl reference electrode. To obtain complete desorption of the MCH monolayer from a particular electrode, an electrochemical potential of -1.4 V versus Ag/AgCl was applied to the electrode for 2 min while keeping all other electrodes at open circuit. Figure 1 shows the CV trace after this procedure (dotted line), which, when compared with the trace for the clean (25) The electrode array was fabricated on a Si/SiO2 wafer using a two-step shadow evaporation technique (ref 33). In the first step, a series of opposing electrodes of separation 35 µm comprising a 35-nmthick Au layer on top of a 10-nm adhesive layer of Ni/Cr was created by standard UV photolithography, metal evaporation, and lift-off. In the second step, the wafer was tilted appropriately in the evaporator and 5 nm of Ni/Cr followed by 17 nm of Au was deposited in stripes connecting the opposing electrodes. However, because the wafer was tilted, the edges of the existing electrodes closest to the evaporation source shadowed the surface from the evaporation beam, leading to the formation of sub-50-nm-sized gaps between opposite electrodes. (26) Bard, A. J.; Faulkner, L. R. Electrochemical Methods; Wiley: New York, 1980.

surface, indicates that the monolayer on this particular electrode was removed. We note that the other electrodes, which were kept at open circuit during the desorption step, were not affected and their CV traces (not shown) remained similar to the solid line in Figure 1. The large increase in current observed in all traces below -1.2 V is associated with hydrogen evolution.23 To demonstrate that the MCH monolayer can act as a molecular mask, Figure 2 shows an electrode array from which the MCH was selectively desorbed from electrodes numbered 2, 4, and 6. Thiolated oligonucleotides X of sequence 5′CAGGATGGCGAACAACAAGA3′-thiol (the thiol is connected to the oligonucleotide via a carbon C6linker) were dissolved in 10 mM tris(hydroxymethyl)aminomethane, 1 mM EDTA, and 1 M NaCl solution of pH 8 to a final concentration of 10 µM. The array, with the MCH molecular mask now covering only electrodes 1, 3, and 5, was then immersed in this aqueous solution for 60 min to allow the oligonucleotides to chemisorb to the exposed electrodes. To detect the bound oligonucleotides and to show that they retain their selective self-assembly properties, a solution of biotinylated oligonucleotide X of sequence 5′TCTTGTTGTTCGCCATCCTG3′-biotin (complementary to X) was applied to the electrode array for 90 min to allow the biotinylated oligonucleotides to hybridize to the surface-bound oligonucleotide monolayers.19,27,28 Using an anti-biotin antibody detection procedure,29,30 the presence of the biotin label (and hence the thiolated oligonucleotides) can be detected via a local color darkening. Figure 2 shows that this occurs on electrodes 2, 4, and 6 from which the MCH monolayer was removed. We note that the gap between opposing electrodes is too small to be resolved by optical microscopy in Figure 2 but its presence can be inferred from the coloring of the electrodes and the abrupt change in color across the designed location of the (27) Levicky, R.; Herne, T. M.; Tarlov, M. J.; Satija, S. K. J. Am. Chem. Soc. 1998, 120, 9787. (28) Steel, A. B.; Herne, T. M.; Tarlov, M. J. Anal. Chem. 1998, 70, 4670.

984

Langmuir, Vol. 19, No. 4, 2003

gap. A scanning electron microscope (SEM) picture of the region between electrodes 1 and 4 is shown in Figure 3; the shortest distance between the electrodes is considerably less than 50 nm. The other electrode pairs were separated by similar-sized gaps (not shown). An advantage of this technique is its ability to coat further electrodes with different thiolated oligonucleotides by using existing oligonucleotide monolayers as protection against subsequent oligonucleotide monolayer formation. It has been shown19,27 that when thiolated oligonucleotides are adsorbed onto an electrode, the resulting monolayer is not perfect, since the oligonucleotides can bind not only via the terminal sulfur-gold bonds but also weakly via noncovalent amine bonds31 and lie flat on the surface. This leads to defects in the monolayer that prevent it from serving as a protection layer. However, Herne and Tarlov19 showed that by immersing this imperfect monolayer in a 1 mM MCH solution for 60 min, the nonspecifically bound oligonucleotides are replaced with MCH molecules bound to the surface by gold-sulfur bonds to produce a mixed oligonucleotide-MCH monolayer with good protection characteristics. Figure 4 shows two electrode arrays on which electrodes 1, 3, and 5 were coated with thiolated oligonucleotide Y (5′AGGTCGCCGCCC3′-thiol) and then immersed in 1 mM MCH for 60 min to strengthen the protection capabilities of the oligonucleotide monolayers. Next, the MCH remaining on electrodes 2, 4, and 6 of both arrays was desorbed to allow coating with thiolated oligonucleotide X. This coating step does not significantly affect existing MCH-oligonucleotide monolayers since the exchange rate between two thiolated oligonucleotides of similar length, (29) Wirtz, R.; Walti, C.; Germishuizen, W. A.; Pepper M.; Middelberg, A. P. J.; Davies, A. G. Nanotechnology 2003, 14, 7. (30) The protocol employed to visualize a specific oligonucleotide monolayer formed on a particular electrode of the array is based on a colorimetric detection of oligonucleotide hybridization, discussed in detail elsewhere (ref 29). Biotinylated oligonucleotides of sequences complementary to those of the thiolated oligonucleotides X and Y (X, 5′TCTTGTTGTTCGCCATCCTG3′-biotin; Y, 5′GGGCGGCGACCT3′biotin) were dissolved in 10 mM tris(hydroxymethyl)aminomethane, 1 mM EDTA (TE solution), and 1 M NaCl to a final concentration of 2.5 µM. The appropriate biotinylated oligonucleotide solution was then applied to the electrode array for 90 min at room temperature to hybridize onto the complementary surface-bound thiolated oligonucleotides. The biotinylated oligonucleotide solution was rinsed off in Tris-buffered saline (TBS), and after several further washing steps, the electrode array was immersed in a 1:1000 dilution of monoclonal anti-biotin antibody conjugated with alkaline phosphatase in TBS/Tween20 for 60 min. Immersing the electrode array in a solution of 5-bromo-4-chloro3-indolyl phosphate/nitro blue tetrazolium causes a local color darkening where alkaline phosphatase is present and therefore where the biotinylated oligonucleotides are hybridized to the electrode array. All oligonucleotides were purchased from MWG Biotech AG; all other reagents were purchased from Sigma. (31) Leff, D. V.; Brandt, L.; Heath, J. R. Langmuir 1996, 12, 4723.

Letters

one of which is bound to a gold surface, is expected to be very small.32 Subsequently, both arrays were again immersed in 1 mM MCH for 60 min, which does not significantly affect the oligonucleotide densities on electrodes already coated with mixed MCH-oligonucleotide monolayers.32 The arrays were then challenged with different biotinylated oligonucleotides for 90 min: the array in Figure 4a was challenged with biotinylated oligonucleotide Y (of sequence 5′GGGCGGCGACCT3′biotin, complementary to Y), and the array in Figure 4b with biotinylated oligonucleotide X. The color change resulting from subsequent detection with the anti-biotin antibody procedure confirms that the thiolated oligonucleotides X and Y bound to the desired electrodes and demonstrates that this technique can be used to deposit different oligonucleotides selectively onto sub-50-nmseparated electrodes. We note that the anti-biotin antibody detection shows not only that the required coating has been achieved but also that the bound thiolated oligonucleotides, which could act as anchor molecules in nanoassembly applications, remain intact and can still hybridize with their complementary counterparts. In conclusion, we have presented a method to selectively functionalize closely spaced electrodes of separation below 50 nm using electrochemical techniques. We successfully coated a set of electrodes with two different oligonucleotides and demonstrated, by the hybridization of complementary biotinylated oligonucleotides, that their selfassembly properties remained intact. The technique is fast and reliable, does not require expensive infrastructure, and is suitable for molecular nanoelectronics and nanoassembly, and other emerging applications in the field of molecular-based nanotechnology, as well as for biotechnology applications. Acknowledgment. We thank D. A. Williams and J. E. Cunningham for their help taking the SEM pictures. This research was in part funded by the EPSRC. C.W. acknowledges the financial support of the Schweizerische Nationalfonds zur Fo¨rderung der wissenschaftlichen Forschung. R.W. thanks the Gottlieb Daimler- and Karl Benz-Stiftung and the George and Lillian Schiff Foundation. W.A.G. and A.G.D. acknowledge the Cambridge Commonwealth Trust and the Royal Society, respectively. We gratefully acknowledge E. W. Rendell for providing the potentiostat. LA026513W (32) Steel, A. B.; Levicky, R. L.; Herne, T. M.; Tarlov, M. J. Biophys. J. 2000, 79, 975. (33) Philipp, G.; Weimann, T.; Hinze, P.; Burghard, M.; Weis, J. Microelectron. Eng. 1999, 46, 157.