Direct Sensing of Single Native RNA with a Single-Biomolecule

Subscriber access provided by Kaohsiung Medical University

Interface Components: Nanoparticles, Colloids, Emulsions, Surfactants, Proteins, Polymers

Direct Sensing of Single Native RNA with a SingleBiomolecule Interface of Aerolysin Nanopore Jie Yang, Yaqian Wang, Mengyin Li, Yi-Lun Ying, and Yi-Tao Long Langmuir, Just Accepted Manuscript • DOI: 10.1021/acs.langmuir.8b03264 • Publication Date (Web): 21 Nov 2018 Downloaded from http://pubs.acs.org on November 22, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Direct Sensing of Single Native RNA with a Single-Biomolecule Interface of Aerolysin Nanopore Jie Yang, Ya-Qian Wang, Meng-Yin Li, Yi-Lun Ying* and Yi-Tao Long Key Laboratory for Advanced Materials & School of Chemistry and Molecular En gineering, East China University of Science and Technology, Shanghai 200237, P. R. China KEYWORDS Single-molecule analysis, RNA sensing, Aerolysin nanopore, Singlemolecule interface.

ABSTRACT RNA sensing is of vital significance to advance our comprehension of gene expression and further benefits for medical diagnostic. Taking the advantage of the excellent sensing capability of the aerolysin nanopore as a single-biomolecule interface, here, we for the first time achieved the direct characterization of single native RNA of Poly (A)4 and Poly (U)4. Poly (A)4 induces approximately 10% large blockade current amplitude than Poly (U)4. The statistical duration of Poly (A)4 is 18.83 ± 1.08 ms, which is hundred times longer than that of Poly (U)4. Our results demonstrated that the capture of RNA homopolymers is restricted by the biased diffusion. The translocation of RNA needs to overcome a lower free energy barrier than DNA. Moreover, the strong RNA-interaction is attributed to the hydroxyl in pentose, which prolongs the translocation time. This study opens an avenue of aerolysin nanopores for 1 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 25

achieving directly RNA sensing including discrimination of RNA epigenetic modification and selective detection of miRNA.

INTRODUCTION

Accurate and robust RNA detection in biological sample can uncover a wealth of information, including estimation of mRNA and miRNA levels in cells, revealing splice patterns and other post-transcriptional modification, which will also be valuable as a tool for discovery of disease and in medical diagnostic

1,2.

The traditional techniques

such as molecular beacons, single-molecule fluorescence and deep sequencing have been applied to RNA sensing 3. However, there still remains critical challenges to be overcome in the RNA sensing including miRNA detection. For instance, reversetranscription polymerase chain reaction (RT-PCR) as the most common methods for miRNA detection needs the covalent labeling and amplification of the target 4. Converting RNA into cDNA using reverse transcriptase has been shown to introduce biases and artifacts 5, which may interfere both the proper characterization and quantification of transcripts. Other techniques

6-10

based on colorimetry,

bioluminescence, enzymatic activity, and electrochemistry have even achieved the discrimination of single-base difference between the miRNA family members. However, all these methods requiring labeling, an enzymatic reaction or amplification by which RNA cannot be directly detected. These drawbacks lead to the error-rate limitations and either base modifications or homopolymers cannot be detected 11.

2 ACS Paragon Plus Environment

Page 3 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Nanopore sensing has been investigated as a platform for nucleic acid analysis at single-molecule level

12-14.

Due to its inherent merits such as low cost, label free and

high through-out, it has the potential to enable the direct detection of RNA. In contrast to traditional single-molecule analytical methods such as atomic force microscope and optical tweezers requiring immobilization, the biological protein nanopore acting as a single-biomolecule interface provides a confined space for directly accommodating an individual molecule of interests 15. Thus, at an applied electrical force, a single molecule can be solitarily captured from the bulk solution into the biological nanopore protein. Moreover, free successive translocation of thousands of target molecules through the nanopore ensures a high through-out sensing without labeling. By analyzing amplitude, duration, and frequency of the current events, the information about the length, composition, conformation and dynamic motion of the analyte can be deduced from the fluctuations of blockade currents 16-21. The sensitivity of biological nanopore is critical to achieve the goal of directly sensing of RNA 22-24. Various biological nanopores have been used for RNA sensing. For example, the α-hemolysin nanopore was applied in selective miRNA detection with the addition of programmable oligonucleotide probe 25.

Previous study of mutant CsgG nanopore obtained full-length, strand-specific RNA

sequences with the help of processive enzyme

26.

Therefore, the site-specific

mutagenesis and processive enzymes were still needed to improve the capability of biological nanopore due to the high translocation speed of RNA. Nearly all these methods necessitating comprehensive procedures, which introduces selective probe or labels, will increase the cost of RNA sensing. 3 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 25

Recently, aerolysin porin produced by Aeromonas hydrophila 27 has emerged as an excellent biological nanopore for nucleic acids analysis 21. Due to its inherent merits, aerolysin nanopore has been widely utilized to study peptides Poly(ethylene glcol)(PEGs) 18, oligosaccharides

35,36

and DNAs

28-31,

37-39.

proteins

32-34,

Compared with

the structure of other biological nanopores (e.g. α-hemolysin 40, MspA 41, phi29 DNApackaging nanomotor 42, ClyA 43, FhuA 44, lysenin 45, and CsgG 46,47), aerolysin lacks the vestibule present in α -hemolysin and thus has a longer sensing constrictions with a varied diameter as narrow as 1.0 to 1.7 nm 48. Computational and experimental results reveal that two critical sensing spots (R220 and K238) exist in two sensitive regions, respectively 49,50. The nucleobases undergo dynamic non-covalent interactions with the residue at the two sensitive regions which act as natural “brakes” to efficiently slow the translocation speed of oligonucleotide. Hence, the aerolysin utilize its geometrical confined structure and strong interaction with the oligonucleotide to achieve the outstanding resolution of oligonucleotide discriminations 49. In this study, we explored the ability of wild-type aerolysin nanopore for directly characterizing the RNA molecules of Poly (A)4 and Poly (U)4. Our results showed that Poly (A)4 and Poly (U)4 generated the characteristic events which exhibits difference in both blockade amplitude and duration. Moreover, the voltage-dependent studies were conducted to investigate the interaction mechanism between RNA and single-biomolecule interface, which revealed that the capture of RNA homopolymers is restricted by the biased diffusion and the free energy barrier for RNA translocation is lower than that of DNA. The long translocation time of RNA originates from the strong interaction between the 4 ACS Paragon Plus Environment

Page 5 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

pentoses of RNA and the aerolysin. The distinguishable blockade currents of Poly (A)4 and Poly (U)4 was contributed to the base-dependent interaction between RNA and the aerolysin. We believe that aerolysin nanopore provides promising sensing interface for the future direct and high throughput non-enzyme RNA sequencing, direct discrimination of RNA epigenetic modification and selective miRNA detection in clinical diagnostics.

EXPERIMENTAL SECTION

Reagent and Chemicals The experimental method of mutant aerolysin production, formation of biological nanopores and data acquisition and analysis are the same to our previous work

49,51.

Trypsin-EDTA, and decane (anhydrous, ≥99%) were purchased from Sigma- Aldrich Co., Ltd. (St. Louis, MO). Diphytanoyl-sn-glycero-3-phosphocholine (chloroform, ≥99%) was purchased from Avanti Polar Lipids, Inc. (Alabaster, AL, USA). All polynucleotides samples were synthesized and HPLC- purified by Sangon Biotech Co., Ltd. (Shanghai, China). All reagents and materials are of analytical grade. All solutions were prepared using ultrapure water (18.2 MΩ cm at 25 °C) from a Milli-Q system (Billerica, MA, USA). Experimental Setup


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 25

Each experiment was conducted using one aerolysin channel inserted into a lipid bilayer formed spanning a 50 μm diameter horizontal orifice in a Delrin bilayer cup (Warner Instruments, Hamden, CT). Without otherwise mention, chambers on either side of the lipid bilayer contained 1 mL of buffer (1.0 M KCl, 10 mM Tris, 1.0 mM EDTA) at pH=8.0. All the experimental equipments have been pretreatment by DEPC treated water. The concentration of aerolysin added in the cis chamber is 1.5 μg mL-1. RNA was premixed in the cis solution in proportion to a final concentration of 2 μM. The entire apparatus was embedded in a faraday cage so that the temperature of all the solutions and components could be regulated to 19 ± 1oC. Proper grounding of the faraday cage block helped reduce electrical noise pick up. Data Acquisition and Analysis Planar bilayer current recordings were performed a homemade amplifier (Axopatch 200B, Molecular Devices) equipped with a Digidata 1440A A/D converter (Molecular Devices, Forest City, CA, USA). The signals were low-pass filtered at 5 kHz and acquired at the sampling rate of 100 kHz by running Clampex 10.4 software (Molecular Devices, Forest City, CA, USA). The data analysis was performed by using MOSAIC 52,53

software and OriginLab 9.0 (Origin- Lab Corporation, Northampton, MA). Events

were defined as those that decreased the current to less than 20% of the open value. The error represents standard deviation of three independent nanopore experiments.

RESULTS AND DISCUSSIONS


Page 7 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 1. (a) Schematic illustration of a short RNA molecule traversing through an aerolysin nanopore. The potential across the bilayer is applied through Ag/AgCl electrodes. (b) Structures of single Poly (A)4 (upper) and Poly (U)4 (below). The adenine and uracil are labeled into blue and red, respectively. (c) Raw current traces for the addition of Poly (A)4 and Poly (U)4 to the cis solution and corresponding typical signals, respectively. All data were acquired at + 60 mV, 1.0 M KCl, 10 mM Tris and 1.0 mM EDTA at pH 8.0. The concentration of each RNA in cis chamber is 2 μM.

As illustrated in Figure 1a, a single aerolysin nanopore can self-assembly insert into a lipid bilayer across which a high voltage was applied via a pair of Ag and AgCl electrodes, leading to a stable open current. Nucleic acid of Poly (A)4 and ploy (U)4 were added into the cis side of aerolysin under + 60 mV, respectively. With cis side grounded, the negatively charged RNA was driven toward and through the aerolysin pore. Compared with structure of DNA, RNA contains the sugar ribose instead of deoxyribose. According to our previous studies, Poly (dA)4 produces longest duration and high capture ability among Poly (dA)n (n = 2 - 10). Therefore, in this study, Poly 7 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 25

(X)4 (X = A or U) were designed as a model RNA to demonstrate the capability of aerolysin nanopore for RNA sensing. As an RNA traversing through the pore, the characteristic blockade current was induced accompanying with various non-covalent interactions between the RNA with the aerolysin sensing interface. Previous study demonstrate that the low temperature could decelerate the translocation velocity of oligonucleotide

54.

Therefore, we performed all the experiments here at a low

temperature of 19 oC to prolong the translocation time of a RNA through the aerolysin (Figure S1). As shown in Figure 1c, the raw current traces of Poly (A)4 and Poly (U)4 exhibit significant differences both in current amplitude and durations. Especially, the duration of Poly (A)4 was at tens of milliseconds, almost hundred times longer than that of Poly (U)4.


Page 9 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 2. (a) Two-dimensional (2D) contour plots for aerolysin sensing of Poly (A)4 at + 60 mV. Top: histogram of I/I0; Right: histogram of duration with the chemical structure of Poly (A)4; Insert: 2D contour plots with logarithm of Y axis. The chemical structure of Poly (A)4 is created by Chimera 1.12. The histograms of I/I0 and the duration were fitted into single Gaussian and exponential equations, respectively. The number of blockades events in each scatter plot is at least 10,000. (b) Effects of the applied voltage on the duration (square) and frequency (circle) of Poly (A)4. The frequency for RNA homopolymers captured by aerolysin pore was calculated by f = 1/τon. Errors bars of data were based on three separate experiments. The recordings were made at 19 oC with a positive potential on the cis side at ground.

To further reveal the translocation dynamic of RNA inside the Aerolysin. We statistically analyzed the current blockade of Poly (A)4. The counter plots in Figure 2a show that the aerolysin analysis of Poly (A)4 generates two populations, which are labelled PI and PII. According to previous studies

21,

PI results from translocation

behavior, whereas PII could be ascribed to bumping between RNA molecule and the cap domain of aerolysin. The duration time of bumping events is constant with the voltage. As shown in Figure 2a insert, the bumping events are fall into the PII population with duration from 0.05 ms to 1 ms. Therefore, the events with duration time shorter than 1 ms are excluded in our following analysis on the translocation events of Poly (A)4. To illustrate the different translocation dynamics of of RNA and ssDNA, here, we compared the translocation events of Poly (A)4 with Poly (dA)4. Under the 9 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 25

applied voltage of + 60 mV, the I/I0 of Poly (A)4 was centered in 0.49 ± 0.01(the error represents standard deviation of three independent nanopore experiments), while Poly (dA)4 displayed a comparable centralized peak at 0.48 ± 0.01 (Figure S2). Here, we represent the degree of current blockade as I/I0 whereas I0 stands for the open pore current and I denotes as the residue current. Moreover, the peak width at half height for the current distribution of Poly (A)4 is also similar to that of Poly (dA)4, with the value of 0.012 and 0.010, respectively. The statistical duration (τoff) is obtained from the exponentially fitting to the histogram of translocation event in PI, which provides the value of 18.83 ± 1.08 ms and 13.11 ± 0.02 ms for Poly (A)4 and Poly d(A)4, respectively. These results reveal that the hydroxyl in pentose induces a strong interaction between RNA and aerolysin, leading to a long translocation time. However, the hydroxyl in pentose hardly effects the blockade volume of nucleotides, generating a comparable blockade amplitude for Poly (dA)4 and Poly (A)4. Next, the voltage-dependent studies were conducted to investigate energy barrier for the entrance and translocation of Poly (A)4. Under the voltage of + 60 mV, the percentage of translocation events in PI is 13.17% (Table S1). However, it drops to 7.25% as applied voltage decrease to + 50 mV (Figure S3). Therefore, it is hard for Poly (A)4 to traverse through the aerolysin below the applied voltage of + 60 mV. Notably, duration of Poly (A)4 shows non-monotonic relationship with the applied voltage, which could be divided into two regimes (Figure 2b). The duration first increases from + 60 mV to + 70 mV, then experiences a decrease at a higher voltage (> + 70 mV). These results prove that a free energy barrier exists during the translocation 10 ACS Paragon Plus Environment

Page 11 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

of Poly (A)4 through an aerolysin pore. Below the threshold voltage of + 70 mV, the electric driving force is not able to overcome the high energy barrier for the majority of RNAs to traverse through the aerolysin. As the further increase of applied voltage, the RNA eventually overcome the energy barrier resulting in an accelerated translocation speed. Similar to the previous study 54, the bases in the Poly (A)4 chain need extend to a more linear structure prior to its sliding through the aerolysin. This extension may involve energy penalties referable to both entropic as well as enthalpic (unstacking) changes, which is probably one of the reasons for the energy barrier of RNA translocation. The RNA molecule is unable to overcome the high barrier for exiting the pore under the electrical force below the threshold voltage of + 70 mV. The fully translocation of Poly (A)4 at above + 70 mV produce the exponential decrease of the duration with the applied potential, which can be scaled as τ = τDexp(−zinsideeV/kBT), in which τD is the diffusive relaxation time linked to the analyte, e is the magnitude of the elementary charge, kB is the Boltzmann constant and T is the temperature 55. We further reckoned the value of fractional average charge per RNA inside the aerolysin nanopore (zinside) and the critical potential Vc value needs for the RNA to get over the free energy barrier traversing in such a confined space, where Vc can be calculated by Vc = kBT/ zinsidee. The zinside of Poly (A)4 in the aerolysin nanopore is approximate to 1.0, larger than that of Poly (dA)4 about 0.7

21.

This result suggests that Poly (A)4 undergoes a

stronger interaction with the aerolysin sensing interface comparing with Poly (dA)4. The critical potential (Vc) for oligonucleotides to overcome the entropic barrier traversing inside aerolysin nanopore is 24 mV for Poly (A)4 and 38 mV for Poly (dA)4. 11 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 25

The short RNA is probably globally more flexible compared to short single strand DNA, thus the Poly (A)4 could easily extend to linear structure, leading to a lower Vc. Therefore, the results above reveal that the flexible RNA suffers a strong pore-analyte interaction to extend into a more linear conformation before its fully translocation. Moreover, the frequency for Poly (A)4 grows with the voltage increasing linearly (Figure 2b), which reveals that the capture of RNA homopolymers is restricted by the biased diffusion.

Figure 3. (a) Two-dimensional (2D) contour plots for aerolysin sensing of Poly (U)4 at + 60 mV. Top: histogram of I/I0; Right: histogram of duration with the chemical structure of Poly (U)4; Insert: 2D contour plots with logarithm of Y axis. The chemical structure of Poly (U)4 is is created by Chimera 1.12. The I/I0 and the duration histograms 12 ACS Paragon Plus Environment

Page 13 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

were fitted with single Gaussian peak distribution. The short-lived events are recovered by MOSAIC software 48. The number of blockades events in each scatter plot is at least 10,000. (b) Effects of the applied voltage on the duration (square) and frequency (circle) of Poly (U)4. The frequency for RNA homopolymers captured by aerolysin pore was calculated by f = 1/ τon where τon is the interval time between two adjacent single molecule blockade events. Errors bars of data were based on three separate experiments. The recordings were made at 19 oC with a positive potential on the cis side at ground. As opposed to the two populations of Poly (A)4, the scatter plots of Poly (U)4 only yields a single distribution. As shown in Figure 3a, statistical I/I0 value of Poly (U)4 is about 0.56 ± 0.02, which is larger than that of Poly (A)4 (I/I0 = 0.49 ± 0.01). Therefore, Poly (A)4 has a larger blockade amplitude than Poly (U)4 since size of adenine is larger than uracil. Our previous study demonstrated that there were two main constricted regions where the diameter of the inner region of β-barrel is as narrow as 1 nm

50.

Due to the narrow sensing interface, the aerolysin nanopore owns an ultra-

sensitive resolution for discrimination of different RNA molecules. The duration of Poly (U)4 decreases exponentially with the increased voltage (Figure 3b), demonstrating that the majority of the events generates by the translocation behavior of Poly (U)4. Due to the rapid translocation, the blockage events of Poly (U)4 is hard to be acquired at the voltage higher than +80 mV. Therefore, we further analysis the Poly (U)4 events under the applied voltage ranging from +40 mV to + 80 mV. Comparing to Poly (A)4, the voltage-dependent duration of Poly (U)4 did not shows a threshold voltage, suggesting that the free energy barrier for Poly (U)4 translocation is lower than 13 ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 25

Poly (A)4. The duration of Poly (U)4 was about 0.10 ± 0.01 ms, which is almost hundred times shorter than that of Poly (A)4. These results suggested that aerolysin sensing interface had a strong interaction with adenine nucleobase

49.

In addition, the peak

width at half height for the current distribution of Poly (U)4 is 0.153, which was nearly 13 times wider than that of Poly (A)4. These results suggest that Poly (U)4 displays more various behaviors inside aerolysin nanopore. We hypothesize that the fast translocation speed leads the multiple interactions between Poly (U)4 and aerolysin interface. The frequency for Poly (U)4 also linearly grows with the increasing voltage, which reveals a biased diffusion limited entrance (Figure 3b). However, the frequency of Poly (U)4 is less than that of Poly (A)4 under the same voltage. This may result from the missing event due to fast translocation speed of Poly (U)4 which is beyond bandwidth of the amplified (5 kHZ). The above results suggest that Poly (U)4 is preferable to transverse through the aerolysin with a low energy barrier although it experiences an ultrafast translocation.

CONCLUSIONS

In summary, we demonstrated that the single RNA could be directly discriminated by the single-biomolecule sensing interface of the aerolysin nanopore without label or chemical modification. Poly (A)4 and Poly (U)4 induce characteristic blockade events during their translocation process. The statistical analysis of the distinguishable current blockade and duration, demonstrate that that the bases of RNA experiences featured interaction with aerolysin interface. Furthermore, the voltage-dependent duration and 14 ACS Paragon Plus Environment

Page 15 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

frequency demonstrate that the capture of RNA homopolymers was restricted by the biased diffusion and the free energy barrier for translocation was lower than that of DNA. The hydroxyl in pentose induces a strong interaction between RNA and aerolysin, leading to a long translocation time. The future designing of the non-covalent interaction between the mutant aerolysin sensing interface and RNA could produce the characteristic current signature for practical RNA sensing in real samples. As shown in Figure S4, the initial attempts of aerolysin nanopore of miRNA detection strongly supports the possibility that aerolysin nanopore could achieve accurately sensing of disease-associated RNA without label and enzyme, which will further benefit the medical diagnostic. Moreover, the nanopore array makes it possible for RNA sensing in large scale and high throughput. ASSOCIATED CONTENT Supporting Information. The following files are available free of charge. Effects of temperature on the duration for Poly (A)4; Statistical analysis of Poly (dA)4 at + 60 mV with an aerolysin nanopore; Scatter plots of poly (A)4 under + 50 mV; Scatter plots of hsa-miR-1264 (Sequence: CAAGUCUUAUUUGAGCACCUGUU) under + 160 mV; Translocation possibility of events under different voltage (PDF)

AUTHOR INFORMATION


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 25

Corresponding Author *E-mail [email protected]. ORCID Yi-Lun Ying: 0000-0001-6217-256X Notes The authors declare no competing financial interest. Author Contributions Y.-T.L., J.Y., and Y.-L.Y. conceived the idea and designed the experiments; J.Y. and Y.-Q.W. performed the experiments; J.Y. and Y.-L.Y. analysed the data; J.Y., Y.-L.Y., Y.-T.L. and M.-Y.L cowrote the paper. All authors have given approval to the final version of manuscript. ACKNOWLEDGMENT This research was supported by the National Natural Science Foundation of China (21834001 and 61871183), Innovation Program of Shanghai Municipal Education Commission (2017-01-07-00-02-E00023), the “Chen Guang” project supported by Shanghai Municipal Education Commission and Shanghai Education Development Foundation (17CG27) and and the Fundamental Research Funds for the Central Universities (222201718001, 222201717003) REFERENCES 1.

Goodwin, S.; J.D. McPherson.; W.R. McCombie. Coming of age: ten years of next-

generation sequencing technologies. Nat. Rev. Genet. 2016, 17, 333-351. 2.

Fang, X.; Tan, W. Aptamers generated from cell-SELEX for molecular medicine:

a chemical biology approach. Acc. Chem. Res. 2009, 43, 48-57. 16 ACS Paragon Plus Environment

Page 17 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

3.

Liu, D.; Graber, J. H. Quantitative comparison of EST libraries requires

compensation for systematic biases in cDNA generation. BMC Bioinf. 2006, 7, 77. 4. Wang, W. T.; Chen, Y. Q. Circulating miRNAs in cancer: from detection to therapy. J. Hematol. Oncol. 2014, 7, 86. 5.

Conlon, P.; Yang, C. J.; Wu, Y.; Chen, Y.; Martinez, K.; Kim, Y.; Tan, W. Pyrene

excimer signaling molecular beacons for probing nucleic acids. J. Am. Chem. Soc. 2008, 130, 336-342. 6.

Duan, R.; Zuo, X.; Wang, S.; Quan, X.; Chen, D.; Chen, Z.; Xia, F. Lab in a tube:

ultrasensitive detection of microRNAs at the single-cell level and in breast cancer patients using quadratic isothermal amplification. J. Am. Chem. Soc. 2013, 135, 46044607. 7.

Pan, W.; Liu, B.; Gao, X.; Yu, Z.; Liu, X.; Li, N.; Tang, B. A graphene-based

fluorescent nanoprobe for simultaneous monitoring of miRNA and mRNA in living cells. Nanoscale 2018, 10, 14264-14271. 8.

Yao, C.; Sun, M.; Yuan, Q.; Niu, M.; Chen, Z.; Hou, J.; He, Z. MiRNA-133b

promotes

the

proliferation

of

human

Sertoli

cells

through

targeting

GLI3. Oncotarget 2016, 7, 2201. 9.

Bi, S.; Zhang, J.; Hao, S.; Ding, C.; Zhang, S. Exponential amplification for

chemiluminescence resonance energy transfer detection of microRNA in real samples based on a cross-catalyst strand-displacement network. Anal. Chem. 2011, 83, 36963702.


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 25

10. Xi, Q.; Zhou; D. M.; Kan; Y. Y.; Ge, J.; Wu, Z. K.; Yu, R. Q.; Jiang, J. H. Highly sensitive and selective strategy for microRNA detection based on WS2 nanosheet mediated

fluorescence

quenching

and

duplex-specific

nuclease

signal

amplification. Anal. Chem. 2014, 86, 1361-1365. 11. Vilfan, I. D.; Tsai, Y. C.; Clark, T. A.; Wegener, J.; Dai, Q.; Yi, C.; Korlach, J. Analysis of RNA base modification and structural rearrangement by single-molecule real-time detection of reverse transcription. J. Nanobiotechnol. 2013, 11, 8. 12.Wang, Y.; Gu, L. Q.; Tian, K. The aerolysin nanopore: from peptidomic to genomic applications. Nanoscale 2018, 10, 13857-13866. 13.Oukhaled, A.; Bacri, L.; Pastoriza-Gallego, M.; Betton, J. M.; Pelta, J. Sensing proteins through nanopores: fundamental to applications. ACS chem. Biol. 2012, 7, 1935-1949. 14. Deamer, D.; Akeson, M.; Branton, D. Three decades of nanopore sequencing. Nat. Biotechnol. 2016, 34, 518-524. 15.Ying, Y. L.; Chao, C.; Hu, Y. X.; Long, Y. T. A single biomolecule interface for advancing the sensitivity, selectivity, and accuracy of sensors. Natl. Sci. Rev. 2018, 5,450-452. 16. Shi, X.; Li, Q.; Gao, R.; Si, W.; Liu, S. C.; Aksimentiev, A.; Long, Y. T. The Dynamics of a Molecular Plug Docked onto a Solid-State Nanopore. J. Phys. Chem. Lett. 2018. 17. Shi. W; Friedman, A. K.; Baker, L. A. Nanopore sensing. Anal. Chem. 2016, 89, 157-188. 18 ACS Paragon Plus Environment

Page 19 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

18. Baaken, G.; Halimeh, I.; Bacri, L.; Pelta, J.; Oukhaled, A.; Behrends, J. C. Highresolution size-discrimination of single nonionic synthetic polymers with a highly charged biological nanopore. ACS Nano 2015, 9, 6443-6449. 19. Asandei, A.; Rossini, A. E.; Chinappi, M.; Park, Y.; Luchian, T. Protein nanoporebased

discrimination

between

selected

neutral

amino

acids

from

polypeptides. Langmuir 2017, 33, 14451-14459. 20. Ettedgui, J.; Kasianowicz, J. J.; Balijepalli, A. Single molecule discrimination of heteropolytungstates and their isomers in solution with a nanometer-scale pore. J. Am. Chem. Soc. 2016, 138, 7228-7231. 21. Cao, C.; Ying, Y.-L.; Hu, Z. L.; Liao, D. F.; Tian, H.; Long, Y.-T. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore. Nat. Nanotechnol. 2016, 11, 713-718. 22. Xi, D.; Shang, J.; Fan, E.; You, J.; Zhang, S.; Wang, H. Nanopore-based selective discrimination of microRNAs with single-nucleotide difference using locked nucleic acid-modified probes. Anal. Chem. 2016, 88, 10540-10546. 23. Wanunu, M.; Dadosh, T.; Ray, V.; Jin, J.; McReynolds, L.; Drndić, M. Rapid electronic detection of probe-specific microRNAs using thin nanopore sensors. Nat. Nanotechnol. 2010, 5, 807-814. 24. Zahid, O. K.; Wang, F.; Ruzicka, J. A.; Taylor, E. W.; Hall, A. R. Sequencespecific recognition of microRNAs and other short nucleic acids with solid-state nanopores. Nano Lett. 2016, 16, 2033-2039.


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 25

25. Wang, Y.; Zheng, D.; Tan, Q.; Wang, M. X.; Gu, L. Q. Nanopore-based detection of circulating microRNAs in lung cancer patients. Nat. Nanotechnol. 2011, 6, 668-674. 26. Garalde, D. R.; Snell, E. A.; Jachimowicz, D.; Sipos, B.; Lloyd, J. H.; Bruce, M.; Jordan, M. Highly parallel direct RNA sequencing on an array of nanopores. Nat. Methods 2018, 15, 201-206. 27. Parker, M. W.; Buckley, J. T.; Postma, J. P.; Tucker, A. D.; Leonard, K.; Pattus, F.; Tsernoglou, D. Structure of the Aeromonas toxin proaerolysin in its water-soluble and membrane-channel states. Nature 1994, 367, 292. 28. Stefureac, R.; Long, Y.-T.; Kraatz, H. B.; Howard, P.; Lee, J. S. Transport of αhelical peptides through α-hemolysin and aerolysin pores. Biochemistry 2006, 45, 9172-9179. 29. Piguet, F.; Ouldali, H.; Pastoriza-Gallego, M.; Manivet, P.; Pelta, J.; Oukhaled, A. Identification of single amino acid differences in uniformly charged homopolymeric peptides with aerolysin nanopore. Nat. Commun. 2018, 9, 966. 30. Long, Y.-L.; Zhang, M. Self-assembling bacterial pores as components of nanobiosensors for the detection of single peptide molecules. Sci. China, Ser. B: Chem. 2009, 52, 731-733. 31. Li, S.; Cao, C.; Yang, J.; Long, Y.-T. Detection of peptides with different charges and

lengths

by

using

the

aerolysin

nanopore. ChemElectroChem

doi.org/10.1002/celc.201800288


Page 21 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

32. Payet, L.; Martinho, M.; Pastoriza-Gallego, M.; Betton, J. M.; Auvray, L.; Pelta, J.; Mathé, J. Thermal unfolding of proteins probed at the single molecule level using nanopores. Anal. Chem. 2012, 84, 4071-4076. 33. Merstorf, C.; Cressiot, B.; Pastoriza-Gallego, M.; Oukhaled, A.; Betton, J. M.; Auvray, L.; Pelta, J. Wild type, mutant protein unfolding and phase transition detected by single-nanopore recording. ACS Chem. Biol. 2012, 7, 652-658. 34. Pastoriza-Gallego, M.; Rabah, L.; Gibrat, G.; Thiebot, B.; van der Goot, F. G.; Auvray, L.; Pelta, J. Dynamics of unfolded protein transport through an aerolysin pore. J. Am. Chem. Soc. 2011, 133, 2923-2931. 35. Fennouri, A.; Daniel, R.; Pastoriza-Gallego, M.; Auvray, L.; Pelta, J.; Bacri, L.Kinetics of enzymatic degradation of high molecular weight polysaccharides through a nanopore: experiments and data-modeling. Anal. Chem. 2013, 85, 8488-8492. 36. Fennouri, A.; Przybylski, C.; Pastoriza-Gallego, M.; Bacri, L.; Auvray, L.; Daniel, R. Single molecule detection of glycosaminoglycan hyaluronic acid oligosaccharides and depolymerization enzyme activity using a protein nanopore. ACS Nano 2012, 6, 9672-9678. 37. Cao, C.; Yu, J.; Li, M. Y.; Wang, Y. Q.; Tian, H.; Long, Y.-T. Direct Readout of Single Nucleobase Variations in an Oligonucleotide. Small 2017, 13, 1702011. 38. Yu, J.; Cao, C.; Long, Y.-T. Selective and sensitive detection of methylcytosine by aerolysin nanopore under serum condition. Anal. Chem. 2017, 89, 11685-11689.


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 25

39. Liao, D. F.; Cao, C.; Ying, Y.-L.; Long, Y.-T. A General Strategy of Aerolysin Nanopore Detection for Oligonucleotides with the Secondary Structure. Small 2018, 14, 1704520. 40. Kawano, R.; Schibel, A. E.; Cauley, C.; White, H. S. Controlling the translocation of

single-stranded

DNA

through

α-hemolysin

ion

channels

using

viscosity. Langmuir 2008, 25, 1233-1237. 41. Butler, T. Z.; Pavlenok, M.; Derrington, I. M.; Niederweis, M.; Gundlach, J. H. Single-molecule DNA detection with an engineered MspA protein nanopore. Proc. Nat. Acad. Sci. 2008, 105, 20647-20652. 42. Wendell, D.; Jing, P.; Geng, J.; Subramaniam, V.; Lee, T. J.; Montemagno, C.; Guo, P. Translocation of double-stranded DNA through membrane-adapted phi29 motor protein nanopores. Nat. Nanotechnol. 2009, 4, 765-772. 43. Soskine, M.; Biesemans, A.; De Maeyer, M.; Maglia, G. Tuning the size and properties of ClyA nanopores assisted by directed evolution. J. Am. Chem. Soc. 2013, 135, 13456-13463. 44. Mohammad, M. M.; Iyer, R.; Howard, K. R.; McPike, M. P.; Borer, P. N.; Movileanu, L. Engineering a rigid protein tunnel for biomolecular detection. J. Am. Chem. Soc. 2012, 134, 9521-9531. 45. Aoki, T.; Hirano, M.; Takeuchi, Y.; Kobayashi, T.; Yanagida, T.; Ide, T. Single channel properties of lysenin measured in artificial lipid bilayers and their applications to biomolecule detection. Proc. Jpn. Acad., Ser. B 2010, 86, 920-925.


Page 23 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

46. Goyal, P.; Krasteva, P. V.; Van Gerven, N.; Gubellini, F.; Van den Broeck, I.; Troupiotis-Tsaïlaki, A.; Hultgren, S. J. Structural and mechanistic insights into the bacterial amyloid secretion channel CsgG. Nature 2014, 516, 250-253. 47. Brown, C. G.; Clarke, J. Nanopore development at Oxford Nanopore. Nat. Biotechnol. 2016, 34, 810-811. 48. Iacovache, I.; De Carlo, S.; Cirauqui, N.; Dal Peraro, M.; Van Der Goot, F. G.; Zuber, B. Cryo-EM structure of aerolysin variants reveals a novel protein fold and the pore-formation process. Nat. Commun. 2016, 7, 12062. 49. Wang, Y.; Li, M.; Qiu, H.; Cao, C.; Wang, M.; Wu, X.; Huang J., Ying, Y.-L. Long, Y.-T. Identification of essential sensitive regions of the aerolysin nanopore for single oligonucleotide analysis. Anal. Chem. 2018, 9, 7790-7794. 50. Cao, C.; Li, M. Y.; Cirauqui, N.; Wang, Y. Q.; Dal Peraro, M.; Tian, H.; Long, Y. -T. Mapping the sensing spots of aerolysin for single oligonucleotides analysis. Nat. Commun. 2018, 9, 2823. 51. Wang, Y. Q.; Cao, C.; Ying, Y.-L.; Li, S.; Wang, M. B.; Huang, J.; Long, Y. T. Rationally Designed Sensing Selectivity and Sensitivity of an Aerolysin Nanopore via Site-Directed Mutagenesis. ACS Sens. 2018, 3, 779-783. 52. Balijepalli, A.; Ettedgui, J.; Cornio, A. T.; Robertson, J. W.; Cheung, K. P.; Kasianowicz, J. J.; Vaz, C. Quantifying short-lived events in multistate ionic current measurements. ACS Nano 2014, 8, 1547-1553.


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 25

53. Forstater, J. H.; Briggs, K.; Robertson, J. W.; Ettedgui, J.; Marie-Rose, O.; Vaz, C.; Balijepalli, A. MOSAIC: a modular single-molecule analysis interface for decoding multistate nanopore data. Anal. Chem. 2016, 88, 11900-11907. 54. Meller, A.; Nivon, L.; Branton, D. Voltage-driven DNA translocations through a nanopore. Phys. Rev. Lett. 2001, 86, 3435. 55. Nakane, J.; Wiggin, M.; Marziali, A. A nanosensor for transmembrane capture and identification of single nucleic acid molecules. Biophys. J. 2004, 87, 615-621.


Page 25 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

BRIEFS Characterization of nucleic acid of Poly (A)4 and Poly (U)4 using a single-biomolecule interface of aerolysin nanopore.

For Table of Contents Only


Direct Sensing of Single Native RNA with a Single-Biomolecule

Recommend Documents