Discovery and Characterization of XY101, a Potent, Selective, and

Subscriber access provided by UNIV AUTONOMA DE COAHUILA UADEC

Article

Discovery and Characterization of XY101, a Potent, Selective, and Orally Bioavailable ROR# Inverse Agonist for Treatment of Castration-Resistant Prostate Cancer (CRPC) Yan Zhang, Xishan Wu, Xiaoqian Xue, Chenchang Li, Junjian Wang, Rui Wang, cheng Zhang, Chao Wang, Yudan Shi, Lingjiao Zou, Qiu Li, Zenghong Huang, Xiaojuan Hao, Kerry M. Loomes, Donghai Wu, Hongwu Chen, Jinxin Xu, and Yong Xu J. Med. Chem., Just Accepted Manuscript • Publication Date (Web): 09 Apr 2019 Downloaded from http://pubs.acs.org on April 9, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

Life Sciences, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences; Guangzhou Medical University; University of the Chinese Academy of Sciences Zou, Lingjiao; Guangzhou Institutes of Biomedicine and Health, Guangdong Provincial Key Laboratory of Biocomputing, Joint School of Life Sciences, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences; Guangzhou Medical University; University of the Chinese Academy of Sciences Li, Qiu; Guangzhou Institutes of Biomedicine and Health, Guangdong Provincial Key Laboratory of Biocomputing, Joint School of Life Sciences, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences; Guangzhou Medical University; University of the Chinese Academy of Sciences Huang, Zenghong; University of California Davis, Department of Biochemistry and Molecular Medicine, School of Medicine Hao, Xiaojuan; Commonwealth Scientific and Industrial Research Organization (CSIRO) Loomes, Kerry; University of Auckland, School of Biological Sciences & Maurice Wilkins Centre Wu, Donghai; Guangzhou Institutes of Biomedicine and Health, Chen, Hongwu; University of California Davis, Department of Biochemistry and Molecular Medicine, School of Medicine; University of California Davis, UC Davis Comprehensive Cancer Center Xu, Jinxin; Guangzhou Institutes of Biomedicine and Health, Xu, Yong; Guangzhou Institutes of Biomedicine and Health, Guangdong Provincial Key Laboratory of Biocomputing, Joint School of Life Sciences, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences; Guangzhou Medical University; Guangzhou Regenerative Medicine and Health Guangdong Laboratory (GRMH-GDL)

ACS Paragon Plus Environment

Journal of Medicinal Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 64

Discovery and Characterization of XY101, a Potent, Selective, and Orally Bioavailable RORγ Inverse Agonist for Treatment of Castration-Resistant Prostate Cancer (CRPC)

Yan Zhang, a,b,c,# Xishan Wu,a,b,c,# Xiaoqian Xue,a,d,# Chenchang Li,a Junjian Wang,e,f Rui Wang,a Cheng Zhang,a,g Chao Wang,a,b Yudan Shi,a,b Lingjiao Zou,a,b Qiu Li,a,b Zenghong Huang,f Xiaojuan Hao,h Kerry Loomes,i Donghai Wu,j Hong-Wu Chen,f,k Jinxin, Xu,j and Yong Xua,c,*

Guangdong Provincial Key Laboratory of Biocomputing, Joint School of Life

a

Sciences, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences; Guangzhou Medical University, Guangzhou, 510530, China. University of Chinese Academy of Sciences, No. 19 Yuquan Road, Beijing 100049,

b

China. Guangzhou

c

Regenerative

Medicine

and

Health

Guangdong

Laboratory

(GRMH-GDL), Guangzhou, 510530, China School of Life Science, Huizhou University, Huizhou, 516007, China

d

School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou, 510006,

e

China. Department of Biochemistry and Molecular Medicine, School of Medicine,

f

University of California, Davis, Sacramento, California 95817, USA. School of Pharmaceutical Sciences, Jilin University, Changchun, China, No.1266

g

Fujin Road, Chaoyang District, Changchun, Jilin, 130021, China. Manufacturing, Commonwealth Scientific and Industrial Research Organization

h

(CSIRO), Clayton, Vic 3168, Australia.


Page 3 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


School of Biological Sciences & Maurice Wilkins Centre, University of Auckland,

i

Auckland 1010, New Zealand. Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences;

j

Guangzhou, 510530, China UC Davis Compreehensive Cancer Center, University of California, Davis,

k

Sacramento, California 95817, USA.

Corresponding Author: Yong Xu, PhD, E-mail: [email protected]

*

These authors contributed equally to this work.

#



ABSTRACT We report the design, optimization and biological evaluation of nuclear receptor RORγ inverse agonists as therapeutic agents for prostate cancer treatment. The most potent compound 27 (designated as XY101) exhibited cellular activity with an IC50 value of 30 nM in a cell-based reporter gene assay with good selectivity against other NRs subtypes. The cocrystal structure of 27 in complex with the RORγ ligand binding domain (LBD) provided solid structural basis for its antagonistic mechanism. 27 potently inhibited cell growth, colony formation, and the expression of AR, AR-V7 and PSA. 27 also exhibited good metabolic stability and pharmacokinetic profile with oral bioavailability of 59% and half-life of 7.3 h. Notably, 27 demonstrated promising therapeutic effects with significant tumor growth inhibition in a prostate cancer xenograft model in mice. The potent, selective, metabolically stable and orally available RORγ inverse agonists represent a new class of compounds as potential therapeutics against prostate cancer.


Page 4 of 64

Page 5 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Prostate cancer is one of the most commonly diagnosed cancers in the world and the second leading cause of cancer mortality in man.1-3 Androgen deprivation therapy (ADT), first demonstrated by Charles Huggins in 1941, is the main option for advanced prostate cancer.4 Despite an initial benefit, unfortunately, the majority of patients will progress to castration-resistant prostate cancer (CRPC). CRPC continues to rely on androgen receptor (AR) signaling with multiple mechanisms including AR overexpression with or without amplification, AR mutations, AR splice variants and others. The second-generation anti-androgen therapies have recently emerged for the treatment of CRPC. These agents either suppress the synthesis of extragonadal androgens (e.g., abiraterone, a CYP17A1 irreversible inhibitor)5,6 or target the AR directly (e.g., enzalutamide, an AR antagonist).7,8 Although the discovery of abiraterone and enzalutamide represent breakthroughs in the treatment of metastatic CRPC, most of patients who initially have a response to these agents, eventually acquire secondary resistance.9-14 The development of novel therapies that can overcome aberrant AR signaling and improve patient outcome is an unmet medical need for the treatment of lethal prostate cancer.



Figure 1. Structures of RORγ Inverse Agonists.

The retinoic acid receptor-related orphan receptor γ (RORγ), a member of the nuclear receptor superfamily, is a ligand-dependent transcriptional factor. RORγt regulates the differentiation and function of Th17 immune cells that produce the pro-inflammatory cytokines, interleukin-17 (IL-17), interleukin-17F (IL-17F), and interleukin-22 (IL-22).15,16 As a result of its importance in multiple inflammatory pathways, RORγ has emerged as a valuable therapeutic target for the treatment of autoimmune and metabolic diseases. As such, multiple RORγ inverse agonists are in development for therapeutic purposes.17-20 The most well-known tool molecule T0901317 (1, Figure. 1) was identified initially by Tularik Inc. as an agonist of multiple nuclear receptors (NRS) including liver X receptor (LXR),21 pregnane X receptor (PXR),22 and farnesoid X receptor (FXR).23 Subsequently, T0901317 was identified as an inverse agonist of RORγ by Griffin’s group at Scripps, Florida.24 Using 1 as a starting compound, they developed a series of synthetic RORγ inverse agonists, including SR2211 (2).25 Compound 2 (Figure 1), containing a hexafluoroisopropanol group, showed an excellent selectivity for RORγ over other NRS in a cellular luciferase


Page 6 of 64

Page 7 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


reporter gene assay. Compound 2 has been evaluated for its therapeutic potential in suppression of Th17 cell-mediated autoimmune diseases in collagen-induced arthritis model.26 GSK has disclosed several para-sulfonylphenyl acetamide motifs bearing variations at the heterocyclic ring amide,27 aryl amide (3, Figure 1),28 and biaryl amide.29 Recently, there has been significant progress in the development of small molecule RORγ inverse agonists.30-33Some RORγ inverse agonists, including VTP-43742 (Vitae/Allergan, terminated), ARN-6039 (Arrien Pharmaceuticals), JTE-451 (Japan Tobacco), RTA 1701 (Reata), and AZD-0284 (AstraZeneca), have recently been advanced into clinical trials.34-38

Previously, we reported a series of novel and potent RORγ inverse agonists with diverse

scaffold

including

3,4-dihydropyrimidin-2(1H)-ones,

N-phenyl-2-(N-phenylphenylsulfonamido) acetamides, benzo[cd]indol-2(1H)-ones (4, Figure 1).39-42 We further found that RORγ is overexpressed and amplified in metastatic CRPC tumors. RORγ directly stimulates AR gene transcription by binding to an exonic ROR response element (RORE) that acts as a key determinant of AR gene expression. RORγ inverse agonists effectively reduced the expression and activity of full length AR and AR spliced variants that are active in CRPC, thereby inhibiting tumor growth and metastasis.39 Furthermore, RORγ inverse agonists displayed enhanced efficacy in enzalutamide-resistant tumors. These findings provide excciting proof-of-concept and an alternative therapeutic option for the treatment of CRPC by targeting RORγ, an upstream regulator of AR gene transcription.

In this study, we report the design, optimization, and biological evaluation of a series of novel RORγ inverse agonists based on the biphenyl-4-yl-amine scaffold as potent,



selective and orally available candidate for the treatment of prostate cancer. Targeting RORγ could circumvent secondary resistance problems associated with agents that directly target AR signaling and benefit patients with CRPC.

2. RESULTS AND DISCUSSION 2.1. Structure-based Design for RORγ Inverse agonists. To design novel and potent RORγ inverse agonists, we overlaid the predicted binding models of 2 and 3 (Figure 1) in complex with RORγ LBD (4QM0)43 derived from molecular docking as illustrated in Figure 2. Both compounds occupy the whole binding pocket with some key interactions including H-bond interactions with Arg367 and Phe377, edge-to-face π-π interaction with Phe378, and hydrophobic interaction with Phe388, Trp317, and other residues. Importantly, the middle phenyl groups of 2 and 3 superimposed nearly identically. By combining the structural features of 2 and the GSK compound (3) and keeping these interactions between the key pharmacophore and residues of RORγ LBD, we designed hybridized compounds with either a sulfonamide or amide linker as shown in Figure 2. Our aim was to obtain the optimal RORγ inverse agonists with improved potency and pharmacodynamics properties. To develop compounds with improved potency for RORγ, we focused on the polar region around Arg367 and performed an extensive SAR study.


Page 8 of 64

Page 9 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Design and optimization strategy for novel biphenyl-4-yl-amines derivatives as RORγ inverse agonist. The binding modes of compounds 2 (magenta) and 3 (blue) in complex with RORγ ligand binding domain (LBD) (PDB code: 4QM0) were predicted by molecular docking. The ligands and important residues are shown as sticks. The hydrogen bonds and π-π interactions are shown as red and green dashed lines, respectively. Figures were prepared using PyMOL.

2.2. Chemistry. The synthesis of sulfonamide and amide compounds is depicted in Scheme 1. The commercially available 2-fluoroaniline (5) reacted with hexafluoroacetone trihydrate (6) using a catalytic amount of p-toluenelsuphonic acid, which afforded the desired hexafluoropropanol intermediate 7. A subsequent diazo-reaction using intermediate 7 and potassium iodide under acidic conditions yielded the corresponding 4-iodophenyl analogue

8.

Intermediate

8

was

coupled

with

the

Boc-protected

aminophenyl-4-boronic acid to afford 9. Deprotection of the N-Boc functionality using TFA in DCM provided the unsubstituted amine derivative 10. Compound 10 was treated with the appropriate sulfonyl chloride or carboxylic acids to generate final sulfonamides 11, 12, 15, 16, 18-21 and amides 22, 23, 26-36. Appropriate sulfonyl chlorides were synthesized from benzyl halides, extrusion of SO2, and chlorination.



Page 10 of 64

Hydrolysis of the carboxylic ester analogue 16 and nitrile analogue 12 afforded the targeted compound 17 and 13, respectively. Reduction of the nitro analogues 22 and 23 afforded the amino compounds 24 and 25, respectively. The amidation of compound 17 afforded the targeted compound 14.

Scheme

1.

Synthesis

of

N-([1,1'-biphenyl]-4-yl)-sulfonamide

and

N-([1,1'-biphenyl]-4-yl)amide derivatives.

Reagents and conditions: (a) p-toluenesulfonic acid, 90 °C, 12 h, 30%; (b) HCl, NaNO2, DMF, 0 5 °C, 0.5 h; KI, 0 °C - rt, 12 h, 96%; (c) (4-((tert-butoxycarbonyl)amino)phenyl)boronic acid, Pd(PPh3)4, K2CO3, 1,4-dioxane, 80 °C, 5 h, 74 %; (d) TFA, DCM, rt, 3 h, 91%; (e) R1-SO2Cl, pyridine, 80 °C, 2 h, 33% − 75%. (f) R2-COOH, HATU, DIPEA, DCM, rt, 3 h, 47% − 88%.

2.3. Structure−Activity Relationships of Sulfonamide Derivatives Dual-luciferase reporter assay and thermal shift assay (TSA) were firstly used for SAR evaluation.The luciferase reporter assay can test the activity of compounds on RORγ transcription while the TSA assay can determine the thermodynamic stability of RORγ LBD in the presence of tested compounds. To find more potent RORγ ligand based on the modeled complex structures, we incorporated various polar groups into the para-position on the benzyl group to allow formation of an H-bond with the carbamidine of Arg367 (Table 1). The substitution at the para-position of the


Page 11 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


benzyl group with methylsulfonyl (11), cyano (12), aminocarbonyl (13), and methyl-aminocarbonyl (14) showed weak inhibitory activities with IC50 values of less than 10 μM. Compound 15 bearing a nitro group at para-position of benzyl group exhibited an IC50 value of 2.22 μM. Significantly, the methyl ester derivative 16 offered significant improvement in both RORγ transcription activities (IC50 = 0.09 μM) and stabilization effects for the RORγ protein with a temperature shift of 8.0 °C. In contrast, the corresponding carboxyl acid derivative 17 abolished transcriptional activity.

Table 1. Structure–activity relationships of sulfonamide derivatives

Gal4-RORγ-LBDa IC50 (μM)

TSAb ΔTm (°C)

cLogP

11

7.76 ± 0.56

1.0

3.68

12

7.55 ± 1.09

0

4.75

13

8.72 ± 2.11

0

3.83

14

8.05 ± 1.40

0

4.04

15

2.22 ± 0.51

1.5

5.06

16

0.09 ± 0.01

8.0

5.29

17

(23%)

0

5.06

18

1.49 ± 0.21

3.5

5.06

Cmpd

R1



Page 12 of 64

19

7.66 ± 0.06

1.0

4.98

20

4.24 ± 1.12

4.0

5.29

21

2.96 ± 0.50

2.0

5.29

All assay results are reported as mean ± SD from at least three independent experiments. aIC50 values were calculated from the luciferase assay. bΔTm values were calculated from the thermal shift assay.

There are two other important residues Gln286 and Arg364 near Arg367. We therefore also investigated the effects of substitutions at the meta- or ortho-positions of the benzyl group (18, 19, 20, 21) to explore whether the H-bond formed or not. The luciferase reporter assay showed that the meta-substituent analogue 18 afforded an approximately equipotent transcriptional response to the para-substituent analogue 15, while the ortho-substituent analogue 19 exhibited weaker activities than those of 18 and 15. For the methyl ester group substitutions, both the meta- (20) and ortho-positions (21) were less potent than 16. A molecular docking analysis also supported a favorable ligand binding interaction with 16 through a key H-bond with Arg367 (Figure 3). From this SAR analysis the most potent compound in this series is 16.


Page 13 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. 3D presentation of the predicted binding mode of 16 (yellow) with RORγ LBD (PDB code: 4QM0). For clarity, only important residues (gray) at the binding site are shown.

2.4. Structure−Activity Relationships of Amide Derivatives. To further explore the chemical space, we synthesized compounds with an amide linker (Table 2). For comparison with the sulfonamide derivatives, the nitro (22, 23), methyl sulfonyl (26), ethyl sulfonyl (27) derivatives with the amide linker were designed and synthesized to assess whether the critical interactions with residues around Arg367 were maintained. When a nitro group was introduced, compound 23 with an ortho-position substituent and compound 22 with a para-position substituent both showed encouraging activities with IC50 values of 0.19 and 1.49 μM, respectively (Table 2). The TSA assay also demonstrated that both 23 and 22 stabilized RORγ LBD with temperature shifts of 4-6 °C. When compared to compounds (15, 19) with sulfonamide linkers, 22 and 23 with amide linkers exhibited better activities. Their respective reduced products, 24 and 25 exhibited slightly decreased potencies. Coupling either methyl sulfonyl and ethyl sulfonyl groups to the benzyl group generated 26 and 27, respectively. Both these compounds showed significant improved potency (IC50 = 0.12 μM, 0.03 μM) as compared with the



Page 14 of 64

corresponding compounds with sulfonamide linker (11). Compounds 26 and 27 also showed good protein stabilizing abilities with temperature shifts of 7.8 and 10.1 °C, respectively.

Table 2. Structure–activity relationships of amide derivatives

Gal4-RORγ-LBDa IC50 (μM)

TSAb ΔTm (°C)

cLogP

22

1.49 ± 0.50

6.0

5.13

23 (XY018)

0.19 ± 0.02

4.2

5.05

24

4.16 ± 2.26

1.5

4.16

25

0.96 ± 0.46

1.5

4.11

26

0.12 ± 0.03

7.8

3.75

27 (XY101)

0.03 ± 0.01

10.1

4.28

28

4.17 ± 2.10

6.3

5.44

29

1.83 ± 0.89

5.9

5.97

30

0.82 ± 0.06

5.8

6.50

31

3.08 ± 0.17

7.8

4.62

32

0.46 ± 0.04

5.2

4.11

33

0.93 ± 0.38

5.4

4.46

34

1.52 ± 0.36

5.0

4.15

35

1.98 ± 0.71

5.2

5.95

Cmpd

R2


Page 15 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


36

1.08 ± 0.28

6.5

7.56

All assay results are reported as mean ± SD from at least three independent experiments. aIC50 values were calculated from the luciferase assay. bΔTm values were calculated from the thermal shift assay.

To further confirm the importance of the physicochemical properties, compounds with either hydrophobic or polar head groups were synthesized (Table 2). Changing the substituent from a butyl (28) to a hexyl group (30) led to a 5-fold improvement in IC50 value from the luciferase reporter assay (4.17 μM to 0.82 μM, respectively) and a corresponding thermal shift stabilization effect for RORγ LBD as shown by the TSA assay (6.3 °C and 5.8 °C, respectively). We also synthesized compounds with polar group in the alkyl tail (32, 33, and 34). Compound 32 included polar atoms at the tail of flexible alkyl chain and exhibited a good inhibitory effect with an IC50 of 0.46 μM and temperature shift of 5.2 °C. By comparison, the bulky and nonpolar substituted analogues, 35 and 36, showed moderate activities. Among them, compound 27 was one of the most potent compounds with strong biochemical activity.

To explain the structural basis for the SAR, we successfully determined the cocrystal structure of 27 bound to RORγ LBD. In this cocrystal structure, there are 3 RORγ LBD-ligand complexes. The overall structures of the three subunits superimposed very well in the ligand binding pocket (Supporting Information Figure 1). As expected, the NH of the amide linker makes an H-bond interaction with the backbone carbonyl of Phe377. The carbonyl oxygen atom of the amide forms indirect H-bond interactions with residues Gln286, His323, and Glu379 via a water molecule (Figure 4). Also as expected, the middle phenyl ring forms face-to-edge π-π interactions with



Phe378. The two oxygen atoms of ethyl sulfone form H-bond interactions with the backbone NH of Leu287 and carbamidine of Arg367. The ethyl sulfone occupies the hydrophobic cavity surrounded by residues Ala327, Val361, Arg364, and Met365, which is consistent with the binding modes for GSK compound obtained by Kallen and Narjes (Supporting information Figure S2).19,27,44 The hexafluoroisopropanol group, pointing to residues Trp317 and His479, may disrupt the His479-Tyr502 interaction thereby pushing H-12 outward. When comparing the structures of 27 and 1 in complex with RORγ LBD, we can see that the hexafluoroisopropanol doesn’t superimpose well. However, both molecules push H-12 and contribute to the antagonistic conformation (Supporting information Figure S2).44,45

Figure 4. Cocrystal structure of compound 27 in complex with the RORγ LDB (2.30 Å, PDB code: 6J1L). (A) Compound 27 forms extensive interactions with the RORγ LDB. Water molecules are shown as spheres in red. Hydrogen bonds and π-π stacking interactions are indicated by dashed lines in red and green, respectively. For clarity, only important residues (gray) at the binding site are shown. (B) Compound 27 is well-defined by the electron density and fits snugly in the ligand binding pocket. The electrostatic potential surface is shown.

2.5. Selectivity over Other Nuclear Receptors.


Page 16 of 64

Page 17 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


To investigate the selectivity profile, compounds 16, 23, 26, 27 and 30 were assessed using the cellular reporter gene assay against RORα, RORβ, LXRα, and FXR, which are widely used in nuclear receptor ligand discovery studies.40-42 RORγ, RORα, RORβ， LXRα, and FXR are categorized into the same subgroup of NRs based on their sequence homology. As shown in Table 3, the tested compounds displayed different nuclear receptor activity profiles. Compound 23 displayed very weak RORα antagonistic activity (7.57 μM with a maximum of 37% inhibition), and compound 30 exhibited similar potencies for RORα, FXR with RORγ. On the other hand, compounds 16, 26, 27 exhibited potent RORγ activity in the reporter gene assay and excellent selectivity for RORγ versus the other NRs in our selectivity panel.

2.6. Evaluation of Binding Affinities by AlphaScreen and Isothermal Titration Calorimetric (ITC) Assays. To further confirm the ability of ligands to bind to RORγ LBD and disrupt its interaction with co-regulators, potent compounds were selected for AlphaScreen assay based on the luciferase and TSA assay datas (Table 3). By definition, any compound disrupting the recruitment of the SRC1 co-activator peptide acts as an RORγ inverse agonist. Most of the tested compounds exhibited IC50 values in the micromolar range. The most active compound 27 exhibited an IC50 value of 0.75 μM in the AlphaScreen assay. These results suggest that these compounds potently disrupt the interaction of RORγ LBD and SRC1 and function as inverse agonists.

Table 3. Potency and selectivity profiles

Cmpd

IC50 (μM)

IC50 (μM)

IC50 (μM)

IC50 (μM)

IC50 (μM)

IC50 (μM)

Kd (μM)

RORγ

RORα

RORβ

LXRα

FXR

AlphaScreen

ITC



Page 18 of 64

1

0.33

2.6 (55)

NA

16

0.09 ± 0.01

NA

NA

NA

NA

4.83 ± 0.08

23

0.19 ± 0.02

7.57 (37)

NA

NA

NA

3.46 ± 1.32

0.78

26

0.12 ± 0.03

NA

NA

NA

NA

2.28 ± 0.05

0.56

27

0.03 ± 0.01

NA

NA

NA

NA

0.75 ± 0.09

0.38

30

0.82 ± 0.06

1.74 (80)

NA

NA

1.25 (93)

5.31 ± 0.22

0.05 (agonist) 5.3 (agonist)

NA = not active. Transcriptional activities were measured using reporter gene assays in 293T cells with Gal4-RORγ LBD, Gal4-RORα-LBD, Gal4-RORβ-LBD, Gal4-LXRα-LBD, Gal4-FXR-LBD expression vectors. IC50 values are reported as means ± SD. In vitro binding to the RORγ LBD was measured using AlphaScreen and ITC assays.

Furthermore, compounds 23, 26, and 27 were selected for binding affinity determination using isothermal titration calorimetry (ITC). All these tested compounds exhibited Kd values in the nanomolar range, which further validated their binding affinities to RORγ LBD. Compound 27 was identified as the most active compound with a Kd value of 380 nM (Table 3 and Supporting Information Figure S3).

2.7. Inhibitory Effects on Cell Growth, Colony Formation and Gene Expression in Prostate Cancer Cells by inverse agonists. Given their encouraging potencies and selectivities, representative compounds were assessed for their inhibitory effects on cell growth on a panel of human prostate cancer cell lines such as LNCaP, 22Rv1, C4-2B with distinct expression levels of AR and AR variants, and the AR-negative cell lines, DU145 and PC-3 (Table 4). The second-generation androgen receptor antagonist enzalutamide was used as a reference. In AR-positive LNCaP cells, these RORγ inverse agonists showed stronger cell


Page 19 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


growth inhibition as compared with enzalutamide. All the tested RORγ inverse agonists were more effective than the second generation antiandrogen enzalutamide in cell growth inhibition, further supporting the promising therapeutic potential of RORγ inhibition on CRPC. In particular, the RORγ selective inverse agonist 27 displayed a 7-fold higher cell growth inhibition activity than enzalutamide.

In the other two CRPC cells, C4-2B and 22Rv1, which express high levels of AR-V7, these compounds were also more potent than enzalutamide. However, when compared to their effects on LNCaP cells, the growth inhibition activities of several of these compounds were slightly weaker in C4-2B and 22Rv1 cells. Notably, in AR-negative DU145 cell line, these compounds showed much weaker growth inhibition activity, which is consistent with our previous study.39 Otherwise, these compounds exhibited similar potencies for 22Rv1 and PC-3 cells. Overall, these compounds exhibited reasonable potency in the three AR-positive prostate cancer cell lines LNCaP, C4-2B, and 22Rv1.

Table 4. Anti-proliferation effects of inverse agonists against the prostate cancer cell lines LNCaP, 22Rv1, C4-2B, DU145, and PC-3 Cmpd

AR-positive cell lines (IC50)

AR-negative cell lines (IC50)

LNCaP

22Rv1

C4-2B

DU145

PC-3

Enzalutamide

42.37 ± 2.37

36.66 ± 4.21

23.56 ± 0.61

44.70 ± 0.93

53.38 ± 0.47

2

6.79±1.18

6.42±1.03

10.06

45.69±2.1

24.82±2.41

16

14.83 ± 2.01

23.59 ± 0.47

23.79

～60

30.88 ± 0.95

30

7.13 ± 0.8

5.64 ± 0.14

5.53

25.64 ± 1.04

12.36 ± 2.40

23

5.14 ± 0.36

9.00 ± 0.33

9.20

28.43 ± 0.89

11.14 ± 1.78

26

11.10 ± 0.42

18.21 ± 0.99

13.82

41.23 ± 0.47

21.84 ± 0.01



27

5.83 ± 1.39

14.17 ± 1.10

10.57

Page 20 of 64

36.92 ± 2.43

19.25 ± 0.31

Cell viability, as measured by Cell-Titer GLO (Promega) of prostate cancer cells treated with the indicated concentrations of compounds for 72-96 h. Experiments were performed independently two times.

To evaluate the long-term cell growth inhibitory effects, colony formation assays were performed for the representative compound 27 over a period of 14 days. Consistent with the cell viability assay, treatment of C4-2B cells with 27 reduced colony formations in a dose-dependent manner (Figure 5A). Colony formation was reduced to less than 10% in C4-2B cells at the concentration of 8 μM.

Figure 5. RORγ inverse agonists suppress colony formation, and expression of AR and AR regulated genes. (A) Compound 27 inhibited colony formation of C4-2B prostate cancer cells. Cells were cultured and treated with vehicle (DMSO), 2 μM, 4 μM, or 8 μM 27 for 14 days followed by staining. (B) qRT-PCR analysis for mRNA expression of full length AR (AR-FL), AR variant (AR-V7), prostate-specific antigen (PSA), KLK2, ERG, TMPRSS2, and C-MYC in LNCaP cells treated with vehicle, 5


Page 21 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


μM compounds 2, 23, or 27 for 48 h. (C) PSA transcriptional activity was evaluated using luciferase reporter assays in LNCaP cells transfected with a PSA-luc reporter plasmid. Cells were treated with vehicle or with 0.4 μM, 2.0 μM, or 10.0 μM 23, 26 or 27. Data represent mean ± standard error of the mean (s.e.m.) (n = 3) from one of three independent experiments. *P ≤ 0.05, **P ≤ 0.01 by two-tailed Student’s t-test. (D) Western blot analysis of AR (AR-FL) and AR variants (AR-vs) levels in 22Rv1 cells treated with vehicle or different doses of 26, and 27 for 48h. Lysates from 22Rv1 cells were analyzed by western blot analysis using an antibody specific for the AR NTD. Representative densitometry data for both full length AR (AR-FL) and AR variants (AR-vs) are shown with GAPDH as a loading control.

To explore whether the RORγ inverse agonists regulate the expression of AR, AR-regulated genes and other oncogenes in prostate cancer cells, qRT-PCR analysis was performed in LNCaP cells. As shown in Figure 5B, the AR-regulated genes PSA (also known as KLK3), KLK2 and TMPRSS2 were strongly suppressed at the mRNA level upon 27 treatment. MYC, a known oncogene in many types of cancer including prostate cancer, was also significantly down-regulated by 27. Compound 27 also strongly suppressed the mRNA expression of full length AR (AR-FL). As prostate-specific antigen (PSA) is used extensively as a biomarker in the clinical management of prostate cancer, a PSA promoter driven luciferase reporter assay was also used as a surrogate to further evaluate the potential impact of compounds on the transcription of PSA.46 Compounds 26 and 27 significantly reduced the transcriptional activity of PSA in a dose-dependent manner (Figure 5C). Furthermore, western blot analysis indicated that treatment of 22Rv1 cells with compound 26 and 27 resulted in significant down regulation of both AR-FL and AR variants levels (Figure 5D). These



results indicated that the RORγ inverse agonists 26 and 27 effectively inhibited cell growth and related gene expression in prostate cancer cells.

2.8. Assessment of Metabolic Stability and Pharmacokinetic (PK) Properties for RORγ Inverse Agonists 23, 26, and 27. To assess the potential of this series of RORγ inverse agonists in vivo, we further investigated the metabolic stability and pharmacokinetic properties of compounds 23, 26 and 27 (Table 5 and Supporting Information Figure S4). An in vitro metabolic stability study with rat liver microsomes (RLM) indicated that all 3 tested compounds exhibited excellent metabolic stability. After incubation with rat liver microsomes for 60 min, 79%, 78%, 93% compound remaining were detected for 23, 26, and 27, respectively. Compound 27 is very stable in this study with very large half-life (Supporting Information Figure S4).

In a PK study, plasma levels of these inverse agonists were monitored after a single oral dose (po) of 10 mg/kg or an intravenous (iv) dose of 2 mg/kg (Table 5). Compound 23 exhibited reasonable PK profiles with high plasma exposure AUC(0-∞) value of 6444 (μg/L·h) and maximum plasma concentration (Cmax) value of 839 (μg/L), after a 2 mg/kg iv administration. However, 23 demonstrated relatively low oral bioavailability of 19% after an oral administration. In contrast to 23, both of the compounds 26 and 27 exhibited significantly improved PK profiles with high plasma exposure AUC(0-∞) values of 24481 and 19577 μg/L·h, reasonable oral bioavailability values of 52% and 59%, and good oral half-life values of 8.67 h and 7.32 h, respectively, after a 10 mg/kg oral administration. In addition, compounds 26 and 27 possessed low clearance and a modest volume of distribution (Vz). The above results


Page 22 of 64

Page 23 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


suggested that 26 and 27 may have good in vivo efficacies when orally administered.


Journal of Medicinal Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46

Page 24 of 64

Table 5. Intravenous (iv) and oral (po) pharmacokinetic parameters for 23, 26, and 27 in rats Cmax (µg/L)

Tmax (h)

AUC(0-t) (µg/L·h)

AUC(0-∞) (µg/L·h)

T1/2 (h)

Cl (mL/h/kg)

Vz (mg/kg)

23 iv (2 mg/kg)

839 ± 38

0.19 ± 0.10

3335 ± 495

6444 ± 1719

7.67 ± 2.36

326.67 ± 92.57

3425 ± 594

23 po (10 mg/kg)

721 ± 120

8.00 ± 0.00

3217 ± 781

-

-

26 iv (2 mg/kg)

980 ± 53

0.08 ± 0.00

7660 ± 329

10352 ± 664

12.71 ± 1.21

1425 ± 161

5.33 ±2.31

21645 ± 3950

24481 ± 5807

8.67 ± 0.05

818 ± 19

0.14 ± 0.10

6105 ± 719

7398 ± 757

9.98 ± 0.88

1200 ± 182

6.00 ± 2.00

18829 ± 3083

19577 ± 1879

7.32 ± 1.08

Route

26 po (10 mg/kg) 27 iv (2 mg/kg) 27 po (10 mg/kg)

F (%)

19 193.73 ± 12.28

3544 ± 271 52

272.26 ±28.23

3935 ± 693 59

The pharmacokinetic parameters were tested in 6 rats. Compounds were formulated in 5% DMSO, 40% PEG400, 55% 20% HP-β-CD. Values are reported as means ± SD.


Page 25 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.9. Compound 27 Inhibits Prostate Cancer Tumor Growth. To further evaluate the effect of RORγ inverse agonists on prostate cancer tumor growth, we generated xenograft tumors using a 22Rv1 prostate cancer cell line that expresses high levels of multiple AR variants. Mice were treated with either vehicle or the RORγ inverse agonist 27 (five times per week) via intraperitoneal injection (IP, 5 mg/kg) or oral gavage (PO, 50 mg/kg). The efficacy data show that compound 27 exhibited significant antitumor activities during the treatment period with tumor growth inhibition (TGI) of 53% or 69% (Figure 6). Furthermore, the treatment with 27 was well tolerated without obvious body weight loss (data not shown).

Figure 6. Antitumor activity of compound 27 in a 22Rv1 xenograft mouse model (n = 6 mice per group). Mice were treated with vehicle or 27 (5 mg/kg i.p. or 50 mg/kg orally) 5 times per week. Treatment started when 22Rv1 tumors reached approximately 100 mm3. Mean tumor volume ± s.e.m.

3. CONCLUSIONS In summary, we report the design, synthesis, and optimization of a large series of novel RORγ inverse agonists for the treatment against prostate cancer. A structure-based drug design approach was successfully utilized to generate the



promising compound, 27, which disrupted the recruitment of the co-activator SRC1 to RORγ and displayed remarkable inhibition of the RORγ transcription activity. Determination of the high-resolution crystal structure of 27-RORγ complex provided direct structural evidence on how the compound 27 disrupts RORγ LBD and functions as inverse agonist. In vitro, compound 27 exhibited potent inhibitory activities on cell growth, colony formation, and expression of AR and AR regulated genes in AR-positive prostate cancer cell lines. Compound 27 exhibited good metabolic stability, favorable pharmacokinetic profiles in rat with excellent oral bioavailability (F = 59%) and half-life time (7.32 h). In vivo, oral administration of compound 27 significantly suppressed tumor growth in 22Rv1 tumor xenograft model. The potent, selective, metabolic stable and orally bioavailable RORγ inverse agonist 27 (XY101) was selected as a candidate compound for future preclinical studies for the treatment of advanced prostate cancer and other diseases.

4. EXPERIMENTAL SECTION 4.1. Molecular Docking Studies. The crystal structure of RORγ in complex with the inverse agonist (PDB code: 4QM0.pdb) was downloaded from Protein Data Bank (http://www.pdb.org). All the ligand and protein preparations were performed in Maestro (version 9.4, Schr dinger, LLC, New York, NY, 2013) implemented in the Schr dinger program. The proteins were prepared using the Protein Preparation Wizard within Maestro 9.4 (Schr dinger, LLC). Hydrogens were added, bond orders were assigned, and missing side chains for some residues were added using Prime. The added hydrogens were subjected to energy minimization until the root-mean-square deviation (RMSD) relative to the starting geometry reached 0.3 Å. The Glide docking program in Maestro 9.4 was used


Page 26 of 64

Page 27 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


for docking studies. For Glide docking, the grid was defined using a 20 Å box centered on the ligand, and the important water molecules around ligand were kept. All parameters were kept as default. The designed molecules were docked using Glide SP mode, and the predicted binding modes of all the compounds were ranked according to their glidescores.

4.2. General Chemistry. All commercial reagents were used without further purification unless otherwise specified. Enzalutamide were purchased from Selleck. Final compounds were purified either by silica gel chromatography (300-400 mesh) or by recrystallization. 1H-NMR and

C-NMR spectra were recorded on Bruker AV-400 or AV-500 spectrometer.

13

Coupling constants (J) are expressed in hertz (Hz). NMR chemical shifts (δ) are reported in parts per million (ppm) units relative to the internal control (TMS). Low or high resolution ESI-MS were recorded on an Agilent 1200 HPLC-MSD mass spectrometer or an Applied Biosystems Q-STAR Elite ESI-LC-MS/MS mass spectrometer, respectively. Compound purities were determined by reverse-phase high-performance liquid chromatography (HPLC) with 20% solvent A (H2O) and 80% solvent B (MeOH or 0.5‰ NH3 in MeOH) as eluents. HPLC analysis uses a Dionex Summit HPLC column (Inertsil ODS-SP, 5.0 μm, 4.6 mm × 250 mm (GL Sciences Inc.)) with a UVD170U detector, and a manual injector, a P680 pump with a detection wavelength of 254 nm and a flow rate of 1.0 mL/min. The purity of all the final compounds was determined by HPLC to be >95%.

General Procedure for Synthesis of Sulfonyl Chlorides. Step 1. A mixture of halide (1.0 equiv) and sodium sulfite (1.2 equiv) in H2O (0.1 M) and EtOH (0.2 M) was



Page 28 of 64

heated to reflux overnight. The mixture was cooled to room temperature and concentrated until a precipitate began to form. The product was collected by filtration and azeotroped with toluene. The resulting solid was used in the next step. Step 2. To a suspension of the sodium sulfonate (1.0 equiv) in CH2Cl2 (0.1 M) were added DMF (0.7 equiv) and SOCl2 (3.9 equiv). After 1.5 h, the white suspension was concentrated and azeotroped with toluene. The sulfonyl chlorides thus formed were used without further purification.

2-(4-Amino-3-fluorophenyl)-1,1,1,3,3,3-hexafluoropropan-2-ol

(7).

To

2-fluoroaniline (5, 6.0 g, 54 mmol) in a pressure vessel was added hexafluoroacetone trihydrate (6, 12.5 g, 56.7 mmol) and p-toluenelsuphonic acid (0.85 g, 5.4 mmol). The reaction mixture was stirred at 90 °C for 12 h. Water was added, and the mixture was extracted with EtOAc (3 × 150 mL). The organic layer was washed with saturated NaHCO3 solution and brine and dried over Na2SO4. The solid was filtered off, and the filtrate was concentrated under reduced pressure. The resulting crude product was purified by silica gel chromatography with petroleum ether/EtOAc (10/1, v/v) and dried to give 7 as white solid (4.45 g, 30 % yield). MS (ESI), m/z for C9H6F7NO ([M + 1]+): Calcd 277.14, found 278.0.

1,1,1,3,3,3-hexafluoro-2-(3-fluoro-4-iodophenyl)propan-2-ol (8). To a solution of 7 (4.45 g, 16.1 mmol) in DMF (50 mL) was added concentrated HCl (18 mL, 73 mmol) at 0 °C, stirred 5 min, and sodium nitrite (1.7 g, 24 mmol) was added, dissolved in H2O (20 mL) at 0 °C. The reaction mixture was stirred at 0 °C for 30 min, then added potassium iodide (4.0 g, 24 mmol) in portions, and then the reaction mixture was stirred at room temperature for overnight. Water was added, and the mixture was


Page 29 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


extracted with EtOAc (3 × 150 mL). The organic layer was washed with saturated NaHCO3 solution and brine and dried over Na2SO4. The solid was filtered off, and the filtrate was concentrated under reduced pressure. The resulting crude product was purified by silica gel chromatography with petroleum ether/EtOAc (50/1, v/v) to obtain 8 (6.2 g, 96 % yield). 1H NMR: (400 MHz, DMSO-d6) δ 7.31 (d, J = 8.4 Hz, 1H), 7.48 (d, J = 1.6 Hz, 9.2 Hz, 1H), 8.05 (dd, J = 6.8 Hz, 8.4 Hz, 1H), 9.07 (s, 1H).

Tert-butyl(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphe nyl]-4-yl)carbamate (9). To a solution of 8 (6.2 g, 16 mmol) in 1,4-dioxane (100 mL) and water (20 mL) was added (4-((tert-butoxycarbonyl)amino)phenyl)boronic acid (4.2 g, 17.6 mmol), followed by addition of potassium carbonate (6.6 g, 48 mmol) and Pd(PPh3)4 (0.9 g, 0.78 mmol), the vessel was purged with argon, sealed and heated to 80 °C for 5 h. Water was added, and the mixture was extracted with EtOAc (3 × 150 mL). The organic layer was washed with saturated NaHCO3 solution and brine and dried over Na2SO4. The solid was filtered off, and the filtrate was concentrated under reduced pressure. The resulting crude product was purified by silica gel chromatography with petroleum ether/ EtOAc (20/1, v/v) to yield 9 (5.4 g, 74 % yield). 1H NMR (400 MHz, CDCl3) δ 7.54 – 7.44 (m, 6H), 7.40 (d, J = 8.4 Hz, 1H), 6.57 (s, 1H), 3.82 (s, 1H), 1.53 (d, J = 3.2 Hz, 9H).

2-(4'-amino-2-fluoro-[1,1'-biphenyl]-4-yl)-1,1,1,3,3,3-hexafluoro propan-2-ol (10). To a solution of 9 (5.35 g, 11.8 mmol) in DCM (50 mL) was added trifluoroacetic acid (7 mL, 96 mmol) dropwise at 0 °C. The reaction mixture was stirred at room temperature for 3 h. The mixture was concentrated under reduced pressure and recrystallization was then carried out in petroleum ether/EtOAc to afford 10 (3.8 g,



Page 30 of 64

91% yield). 1H NMR (400 MHz, DMSO-d6) δ 8.91 (s, 1H), 7.61 (t, J = 8.4 Hz, 1H), 7.50 – 7.47 (m, 2H), 7.30 (d, J = 7.2 Hz, 2H), 6.65 (d, J = 8.4 Hz, 2H), 5.41 (s, 2H).

N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]-4-y l)-1-(4-(methylsulfonyl)phenyl)methanesulfonamide (11). To a solution of 10 (100 mg,

0.28

mmol)

in

pyridine

(20

mL)

was

added

(4-(methylsulfonyl)phenyl)methanesulfonyl chloride (113 mg, 0.42 mmol). The mixture was stirred at 80 °C for 2 h. Water was added and the mixture was extracted with EtOAc (3 × 50 mL). The organic layer was washed with saturated NaHCO3 solution and brine and dried over Na2SO4. The solid was filtered off and the filtrate was concentrated under reduced pressure. The resulting crude product was purified by silica gel chromatography with petroleum ether/EtOAc (4/1, v/v) to obtain 11 (126 mg, 75% yield). 1H NMR (400 MHz, DMSO-d6) δ 10.18 (s, 1H), 9.03 (s, 1H), 7.93 (d, J = 8.0 Hz, 2H), 7.71 (t, J = 8.4 Hz, 1H), 7.59 – 7.53 (m, 6H), 7.32 (d, J = 8.4 Hz, 2H), 4.72 (s, 2H), 3.21 (s, 3H). MS (ESI), m/z for C23H18F7NO5S2 ([M - 1]-): Calcd 585.51, found 584.0. HPLC analysis: MeOH − H2O (80:20), 6.56 min, 98.37% purity.

1-(4-cyanophenyl)-N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)[1,1'-biphenyl]-4-yl)methanesulfonamide (12). Compound 12 was prepared according to the general procedure described for 11. Flash column chromatography eluent: petroleum ether/EtOAc = 2/1; yield, 42%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.15 (s, 1H), 9.04 (s, 1H), 7.84 (d, J = 8.0 Hz, 2H), 7.71 − 7.67 (m, 1H), 7.59 – 7.48 (m, 4H), 7.50 (d, J = 8.0 Hz, 2H), 7.30 (d, J = 8.4 Hz, 2H), 4.71 (s, 2H). C NMR (125 MHz, DMSO-d6) δ 159.6, 157.68, 138.5, 135.14, 132.2, 132.0, 132.0,

13

130.9, 129.8, 129.78, 129.5, 129.4, 128.8, 123.9, 123.2, 118.9, 118.5, 115.0, 114.8,


Page 31 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


111.1, 57.1. MS (ESI), m/z for C23H15F7N2O3S ([M – 1]–): Calcd 532.43, found 531.0. HPLC analysis: MeOH − H2O (80:20), 8.4 min, 98.75% purity.

4-((N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]4-yl)sulfamoyl)methyl)benzamide (13). To a solution of 12 (50mg, 0.09 mmol) in EtOH (2 mL) were added NaOH (0.5 mmol) and DMSO (0.5 ml). 30% H2O2 (0.5 mL) was then added to the mixture and stirred at -10 °C for 20 min. The reaction mixture was stirred at room temperature overnight. Upon completion, the reaction was quenched by saturated aqueous NaHSO3. Water was added, the aqueous layer extracted with ethyl acetate (3 × 50 mL), and the organic layer was washed with brine, dried with Na2SO4 and evaporated. The residue was purified by silica gel chromatography with petroleum ether/EtOAc (4/1, v/v) to afford 13 (31 mg, 63%) as white solid. 1H NMR (400 MHz, DMSO-d6) δ 10.11 (s, 1H), 9.02 (s, 1H), 7.98 (s, 1H), 7.85 (d, J = 7.9 Hz, 2H), 7.71 (t, J = 8.1 Hz, 1H), 7.49 - 7.65 (m, 4H), 7.40 (s, 1H), 7.36 (d, J = 8.2 Hz, 2H), 7.32 (d, J = 8.4 Hz, 2H), 4.61 (s, 2H). 13C NMR (125 MHz, DMSO-d6) δ 167.4, 159.7, 157.7, 138.7, 134.1, 132.6, 131.8, 131.0, 131.0, 131.0, 130.0, 129.8, 129.6, 129.5, 128.6, 127.5, 123.2, 118.8, 115.0, 114.8, 56.9. MS (ESI), m/z for C23H17F7N2O4S ([M – 1]–): Calcd 550.08, found 549.0.

4-((N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]4-yl)sulfamoyl)methyl)-N-methylbenzamide (14). To a solution of compound 17 (50 mg, 0.09 mmol) in DCM was added HATU (51.7 mg, 0.136 mmol) and DIPEA (34.8 mg, 0.27 mmol) and stirred for 10 min. Methanamine (4.2 mg, 0.136 mmol) was added and the reaction stirred at room temperature for 5 h. Water was added, the



Page 32 of 64

aqueous layer extracted with ethyl acetate (3 × 50 mL), and the organic layer was washed with brine, dried with Na2SO4 and evaporated. The residue was purified by silica gel chromatography with petroleum ether/EtOAc (4/1, v/v) to afford 14 (30 mg, 59%) as white solid.1H NMR (400 MHz, DMSO-d6) δ 10.12 (s, 1H), 9.03 (s, 1H), 8.44 (d, J = 4.3 Hz, 1H), 7.80 (d, J = 7.7 Hz, 2H), 7.70 (t, J = 8.1 Hz, 1H), 7.51 – 7.62 (m, 4H), 7.36 (d, J = 7.8 Hz, 2H), 7.31 (d, J = 8.2 Hz, 2H), 4.61 (s, 2H), 2.77 (d, J = 4.2 Hz, 3H).

C NMR (125 MHz, DMSO-d6) δ 166.1, 159.7, 157.7, 138.7, 134.4,

13

132.4, 131.8, 131.0, 131.0, 130.9, 129.8, 129.8, 129.6, 129.5, 128.6, 127.1, 123.2, 118.7, 115.0, 114.8, 56.9 26.2. MS (ESI), m/z for C24H19F7N2O4S ([M + 1] +): Calcd 564.47, found 565.1.

N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]-4-y l)-1-(4-nitrophenyl)methanesulfonamide

(15).

Compound

15

was

prepared

according to the general procedure described for 11. Flash column chromatography eluent: petroleum ether/EtOAc = 5/1; yield, 65%; yellow solid; 1H NMR (400 MHz, DMSO-d6) δ 10.17 (s, 1H), 9.03 (s, 1H), 8.22 (d, J = 8.8 Hz, 2H), 7.70 – 7.66 (m, 1H), 7.60 – 7.53 (m, 6H), 7.31 (d, J = 8.8 Hz, 2H), 4.78 (s, 2H). MS (ESI), m/z for C22H15F7N2O5S ([M – 1]–): Calcd 552.42, found 551.0. HPLC analysis: MeOH − H2O (80:20), 10.25 min, 99.17% purity.

Methyl-4-((N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-bi phenyl]-4-yl)sulfamoyl)methyl)benzoate

(16).

Compound

16

was

prepared

according to the general procedure described for 11. Flash column chromatography eluent: petroleum ether/EtOAc = 5/1; yield, 72%; white solid; 1H NMR (400 MHz,


Page 33 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


DMSO-d6) δ 10.11 (s, 1H), 9.02 (s, 1H), 7.93 (d, J = 8.0 Hz, 2H), 7.69 (t, J = 8.0 Hz, 1H), 7.56 – 7.53 (m, 4H), 7.44 (d, J = 8.0 Hz, 2H), 7.30 (d, J = 8.4 Hz, 2H), 4.67 (s, 2H), 3.84 (s, 3H).

C NMR (125 MHz, DMSO-d6) δ 165.9, 159.6, 157.7, 138.6,

13

134.8, 131.8, 131.7, 131.3, 130.9, 129.8, 129.8, 129.4, 129.1, 128.7, 123.2, 118.8, 115.0, 114.8, 57.2, 52.1. MS (ESI), m/z for C24H18F7NO5S ([M – 1]–): Calcd 565.46, found 564.0. HRMS (ESI) for C24H18F7NO5S ([M + 1]+), Calcd 566.08667, found 566.08610. HPLC analysis: MeOH − H2O (80:20), 10.95 min, 99.81% purity.

4-((N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]4-yl)sulfamoyl)methyl)benzoic acid (17). 16 (100 mg, 0.17 mmol) was dissolved in THF (5 mL) and 2 mol/L NaOH aqueous solution (5 mL). The mixture was stirred at room temperature for 2 h. The solvent was removed and diluted hydrochloric acid was added dropwise, and a white precipitate was formed. The precipitate was collected by filtration and washed with water (10 mL×2). The resulting crude product was purified by recrystallization with petroleum ether/EtOAc to afford 17 (85 mg, 88%) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ 12.73 (s, 1H), 10.11 (s, 1H), 9.02 (s, 1H), 7.92 (d, J = 8.0 Hz, 2H), 7.70 (t, J = 8.0 Hz, 1H), 7.51- 7.62 (m, 4H), 7.42 (d, J = 8.0 Hz, 2H), 7.31 (d, J = 8.4 Hz, 2H), 4.65 (s, 2H). MS (ESI), m/z for C23H16F7NO5S ([M + 1]+): Calcd 551.43, found 552.0. HPLC analysis: MeOH − H2O (80:20), 4.7 min, 99.02% purity.


(18).

Compound

18

was

prepared

according to the general procedure described for 11. Flash column chromatography eluent: petroleum ether/EtOAc = 5/1; yield, 65%; yellow solid; 1H NMR (400 MHz,



Page 34 of 64

DMSO-d6) δ 10.15 (s, 1H), 9.03 (s, 1H), 8.21 (d, J = 8.4 Hz, 2H), 8.17 (s, 1H), 7.76 (d, J = 7.6 Hz, 1H), 7.72 – 7.64 (m, 2H), 7.62 – 7.51 (m, 4H), 7.29 (d, J = 8.4 Hz, 2H), 4.81 (s, 2H). 13C NMR (125 MHz, DMSO-d6) δ 159.6, 157.7, 147.5, 138.5, 137.7, 131.8, 130.9, 129.9, 129.8, 129.5, 129.4, 128.8, 125.7, 123.1, 118.8, 115.0, 114.8, 56.5. MS (ESI), m/z for C22H15F7N2O5S ([M – 1]–): Calcd 552.42, found 551.0. HPLC analysis: MeOH − H2O (80:20), 9.65 min, 97.38% purity.


(19).

Compound

19

was

prepared

according to the general procedure described for 11. Flash column chromatography eluent: petroleum ether/EtOAc = 4/1; yield, 62%; yellow solid; 1H NMR (400 MHz, DMSO-d6) δ 10.29 (s, 1H), 9.04 (s, 1H), 8.04 (dd, J = 8.0, 1.2 Hz, 1H), 7.78 – 7.62 (m, 3H), 7.62 – 7.47 (m, 5H), 7.26 (d, J = 8.8 Hz, 2H), 5.02 (s, 2H). 13C NMR (125 MHz, DMSO-d6) δ 159.6, 157.7, 149.4, 138.3, 134.5, 133.5, 131.8, 130.9, 130.1, 129.7, 129.5, 129.4, 128.9, 125.2, 123.4, 123.2, 118.9, 115.0, 114.8, 53.6. MS (ESI), m/z for C22H15F7N2O5S ([M - 1]-): Calcd 552.42, found 551.0. HPLC analysis: MeOH − H2O (80:20), 9.30 min, 99.54% purity.


(20).

Compound

20

was

prepared

according to the general procedure described for 11. Flash column chromatography eluent: petroleum ether/EtOAc = 5/1; yield, 46%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.08 (s, 1H), 9.02 (s, 1H), 8.00 – 7.86 (m, 2H), 7.71 – 7.60 (m, 1H), 7.63 – 7.45 (m, 6H), 7.30 (d, J = 8.8 Hz, 2H), 4.68 (s, 2H), 3.84 (s, 3H). 13C NMR (125 MHz, DMSO-d6) δ 165.8, 159.6, 157.78, 138.7, 135.8, 131.7, 130.9, 130.3,


Page 35 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


129.8, 128.9, 128.9, 128.6, 123.2, 118.8, 115.0, 114.8, 56.9, 52.1. MS (ESI), m/z for C24H18F7NO5S ([M - 1]-): Calcd 565.46, found 564.0. HPLC analysis: MeOH − H2O (80:20), 10.86 min, 99.26% purity.


(21).

Compound

21

was

prepared

according to the general procedure described for 11. Flash column chromatography eluent: petroleum ether/ EtOAc = 6/1; yield, 55%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.12 (s, 1H), 9.02 (s, 1H), 7.83 (d, J = 7.6 Hz, 1H), 7.72 – 7.67 (m, 1H), 7.58 – 7.54 (m, 6H), 7.40 (d, J = 7.6 Hz, 1H), 7.25 (d, J = 8.8 Hz, 2H), 5.07 (s, 2H), 3.70 (s, 3H). 13C NMR (125 MHz, DMSO-d6) δ 167.1, 159.6, 157.7, 138.6, 133.6, 132.0, 131.8, 131.1, 130.9, 130.3, 129.7, 129.7, 129.4, 128.7, 128.5, 123.2, 118.5, 115.0, 114.8, 54.4, 52.1. MS (ESI), m/z for C24H18F7NO5S ([M – 1]–): Calcd 565.46, found 564.0. HPLC analysis: MeOH − H2O (80:20), 11.85 min, 99.89% purity.

N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]-4-y l)-2-(4-nitrophenyl)acetamide (22). Compound 22 was prepared following the general procedure described for 26. Flash column chromatography eluent: petroleum ether/EtOAc = 3/1; yield, 47%; yellow solid; 1H NMR (400 MHz, CDCl3) δ 8.25 (d, J = 8.0 Hz, 2H), 7.61 – 7.45 (m, 8H), 7.35 (s, 1H), 4.29 (s, 1H), 3.85 (s, 2H). 13C NMR (125 MHz, DMSO-d6) δ 168.2, 164.6, 159.6, 157.7, 146.4, 143.8 139.2, 131.7, 130.8, 130.6, 129.7, 129.3, 129.3, 128.7, 123.4, 123.2, 119.2, 115.0, 114.8, 38.2. MS (ESI), m/z for C23H15F7N2O4 ([M + 1]+): Calcd 516.37, found 517.0. HPLC analysis: MeOH − H2O (80:20), 12.23 min, 96.63% purity.



N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]-4-y l)-2-(2-nitrophenyl)acetamide (23). Compound 23 was prepared according to the general procedure described for 26. Flash column chromatography eluent: petroleum ether/EtOAc = 4/1; yield, 33%; yellow solid; 1H NMR (400 MHz, CDCl3) δ 8.09 (d, J = 8.4 Hz, 1H), 7.94 (s, 1H), 7.66 (t, J = 7.2 Hz, 1H), 7.53 (qd, J = 16.4, 8.4 Hz, 9H), 4.26 (s, 1H), 4.03 (s, 2H). 13C NMR (125 MHz, DMSO-d6) δ 167.8, 159.7, 157.7, 149.0, 139.3, 133.7, 133.5, 131.7, 130.8, 130.5, 129.7, 129.6, 129.3, 129.3, 128.4, 124.6, 123.9, 123.2, 121.6, 119.1, 115.0, 114.8, 40.7. MS (ESI), m/z for C23H15F7N2O4 ([M + 1]+): Calcd 516.37, found 517.0. HRMS (ESI) for C23H15F7N2O4 ([M + 1]+), Calcd 517.09928, found 517.09850. HPLC analysis: MeOH − H2O (80:20), 9.83 min, 99.45% purity.

2-(4-aminophenyl)-N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl) -[1,1'-biphenyl]-4-yl)acetamide (24). To a solution of 22 (80 mg, 0.15 mmol) in methanol (10 mL) was added 10% Pd/C (15 mg). The reaction flask was evacuated and backfilled with hydrogen twice. The reaction mixture was stirred at room temperature under a hydrogen balloon for 5 h. The reaction mixture was filtered through a pad of Celite and concentrated under vacuum to yield 24. 1H NMR (400 MHz, DMSO-d6) δ 1H NMR (400 MHz, DMSO-d6) δ 10.20 (s, 1H), 9.00 (s, 1H), 7.82 – 7.62 (m, 3H), 7.62 – 7.41 (m, 4H), 6.99 (d, J = 8.4 Hz, 2H), 6.55 – 6.41 (m, 2H), 4.94 (s, 2H), 3.45 (s, 2H).

C NMR (125 MHz, DMSO-d6) δ 170.2, 157.7, 147.2,

13

139.6, 130.8, 129.7, 129.6, 129.4, 129.2, 129.2, 123.8, 123.1, 122.7, 119.1, 115.0, 114.8, 113.8, 99.5, 42.7. MS (ESI), m/z for C23H17F7N2O2 ([M – 1]–): Calcd 486.39, found 485.0. HRMS (ESI) for C25H20F7NO4S ([M + 1]+), Calcd 564.10740, found 564.10770. HPLC analysis: MeOH − H2O (80:20), 7.47 min, 99.17% purity.


Page 36 of 64

Page 37 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2-(2-aminophenyl)-N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl) -[1,1'-biphenyl]-4-yl)acetamide (25). Compound 25 was prepared according to the general procedure described for 24. Flash column chromatography eluent: petroleum ether/ EtOAc = 2/1; yield, 88%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.31 (s, 1H), 9.00 (s, 1H), 7.76 -7.65 (m, 3H), 7.61 – 7.49 (m, 4H), 7.06 (dd, J = 7.5, 1.3 Hz, 1H), 6.95 (td, J = 7.9, 1.5 Hz, 1H), 6.67 (dd, J = 7.9, 1.0 Hz, 1H), 6.54 (td, J = 7.4, 1.1 Hz, 1H), 5.09 (s, 2H), 3.52 (s, 2H). MS (ESI), m/z for C23H17F7N2O2 ([M – 1]–): Calcd 486.39, found 485.0. HPLC analysis: MeOH − H2O (80:20), 7.44 min, 98.86% purity.

N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]-4-y l)-2-(4-(methylsulfonyl)phenyl)acetamide

(26).

To

a

solution

of

2-(4-(methylsulfonyl)phenyl)acetic acid (66 mg, 0.31 mmol) in DCM (20 mL) was added HATU (213 mg, 0.56 mmol) and DIPEA (0.5 mL). The mixture was stirred at room temperature for 5 min, then added 10 (100 mg, 0.28 mmol). The reaction mixture was stirred at room temperature for 3 h. Water was added, and the mixture was extracted with EtOAc (3 × 50 mL). The organic layer was washed with saturated NaHCO3 solution and brine and dried over Na2SO4. The solid was filtered off, and the filtrate was concentrated under reduced pressure. The resulting crude product was purified by silica gel chromatography with petroleum ether/EtOAc (5/1, v/v) to obtain 26 as a white solid (73 mg, 43% yield). 1H NMR (400 MHz, DMSO-d6) δ 10.43 (s, 1H), 9.00 (s, 1H), 7.89 (d, J = 8.4 Hz, 2H), 7.77 – 7.66 (m, 3H), 7.66 – 7.32 (m, 6H), 3.83 (s, 2H), 3.19 (s, 3H).

C NMR (125 MHz, DMSO-d6) δ 168.4, 159.7, 157.7,

13

141.8, 139.3, 139.2, 131.6, 130.9, 130.2, 129.7, 129.6, 129.3, 129.3, 128.6, 127.0,



123.2, 119.2, 115.0, 114.8, 43.6, 43.0. MS (ESI), m/z for C24H18F7NO4S ([M – 1]–): Calcd 549.46, found 547.9. HRMS (ESI) for C24H18F7NO4S ([M + 1]+), Calcd 550.09175, found 550.09190. HPLC analysis: MeOH − H2O (80:20), 7.26 min, 99.51% purity.

2-(4-(ethylsulfonyl)phenyl)-N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxyprop an-2-yl)-[1,1'-biphenyl]-4-yl)acetamide (27). Compound 27 was prepared according to the general procedure described for 26. Flash column chromatography eluent: petroleum ether/EtOAc = 3/1; yield, 50%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.44 (s, 1H), 9.00 (s, 1H), 7.85 (d, J = 8.4 Hz, 2H), 7.76 – 7.65 (m, 3H), 7.62 (d, J = 8.4 Hz, 2H), 7.59 – 7.48 (m, 4H), 3.82 (d, J = 12.4 Hz, 2H), 3.27 (q, J = 14.8, 7.2 Hz, 2H), 1.09 (t, J = 7.2 Hz, 3H).

C NMR (125 MHz, DMSO-d6) δ 168.9, 160.2,

13

158.2, 142.5, 139.8, 137.4, 132.2, 131.4, 130.7, 130.2, 129.8, 129.8, 129.1, 128.3, 123.7, 119.7, 115.5, 115.3, 49.7, 43.4, 7.6. MS (ESI), m/z for C25H20F7NO4S ([M – 1]–): Calcd 563.49, found 562.2. HPLC analysis: MeOH − H2O (80:20), 7.92 min, 99.71% purity.

N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]-4-y l)pentanamide (28). Compound 28 was prepared according to the general procedure described for 26. Flash column chromatography eluent: petroleum ether/EtOAc = 8/1; yield, 72%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.07 (s, 1H), 9.13 (s, 1H), 7.71 − 7.66 (m, 3H), 7.57 − 7.50 (m, 4H), 2.32 (t, J = 7.2 Hz, 2H), 1.59 − 1.53 (m, 2H), 1.36 − 1.27 (m, 2H), 0.88 (t, J = 7.2 Hz, 3H). 13C NMR (125 MHz, DMSO-d6) δ 170.2, 159.7, 157.7, 139.5, 130.8, 129.8, 129.7, 129.2, 129.2, 128.2, 123.2, 119.2, 115.0, 114.8, 49.6, 30.9, 29.6. MS (ESI), m/z for C20H18F7NO2 ([M + 1]+): Calcd


Page 38 of 64

Page 39 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


437.36, found 438.1. HPLC analysis: MeOH − H2O (80:20), 16.78 min, 99.95% purity.

N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]-4-y l)hexanamide (29). Compound 29 was prepared according to the general procedure described for 26. Flash column chromatography eluent: petroleum ether/EtOAc = 5/1; yield, 48%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.02 (s, 1H), 8.98 (s, 1H), 7.65 - 7.78 (m, 3H), 7.48 - 7.60 (m, 4H), 2.33 (t, J = 7.4 Hz, 2H), 1.67 – 1.54 (m, 2H), 1.35 – 1.28 (m, 4H), 0.90 – 0.84 (m, 3H). 13C NMR (125 MHz, DMSO-d6) δ 176.75, 164.9, 162.9, 144.9, 136.8, 136.1, 135.0, 134.9, 134.4, 133.4, 129.1, 128.4, 126.8, 124.3, 41.7, 36.1, 30.0, 27.1, 19.1. MS (ESI), m/z for C21H20F7NO2 ([M + 1]+): Calcd 451.38, found 452.1. HPLC analysis: MeOH − H2O (80:20), 13.82 min, 96.98% purity.

N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]-4-y l)heptanamide (30). Compound 30 was prepared according to the general procedure described for 26. Flash column chromatography eluent: petroleum ether/EtOAc = 5/1; yield, 46%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.03 (s, 1H), 8.96 (s, 1H), 7.73 − 7.67 (m, 3H), 7.58 − 7.51 (m, 4H), 2.33 (t, J = 7.2 Hz, 2H), 1.54 – 1.65 (m, 2H), 1.38 − 1.20 (m, 6H), 0.87 (t, J = 6.4 Hz, 3H). 13C NMR (125 MHz, DMSO-d6) δ 171.5, 159.7, 157.7, 139.6, 131.6, 130.8, 130.6, 129.8, 129.7, 129.2, 128.2, 123.2, 119.0, 115.0, 114.8, 36.4, 31.0, 28.3, 25.0, 21.9, 13.9. MS (ESI), m/z for C22H22F7NO2 ([M + 1]+): Calcd 465.41, found 466.1. HRMS (ESI) for C22H22F7NO2 ([M + 1]+), Calcd 466.16115, found 466.16040. HPLC analysis: MeOH − H2O (80:20), 8.19 min, 99.99% purity.



4,4,4-trifluoro-N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1 '-biphenyl]-4-yl)butanamide (31). Compound 31 was prepared according to the general procedure described for 26. Flash column chromatography eluent: petroleum ether/EtOAc = 5/1; yield, 51%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.02 (s, 1H), 8.99 (s, 1H), 7.80 – 7.63 (m, 3H), 7.60 – 7.43 (m, 4H), 2.33 (t, J = 8.0 Hz, 2H), 1.61 (t, J = 8.0 Hz, 2H). 13C NMR (125 MHz, DMSO-d6) δ 168.5, 159.7, 157.7, 139.2, 131.7, 130.9, 130.8, 129.7, 129.6, 129.3, 129.3, 128.5, 123.2, 119.1, 115.0, 114.8, 28.8, 28.5, 28.3, 18.1. MS (ESI), m/z for C19H13F10NO2 ([M – 1]–): Calcd 477.30, found 476.1. HPLC analysis: MeOH − H2O (80:20), 12.05 min, 98.87% purity.

Methyl-4-((2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphe nyl]-4-yl)amino)-4-oxobutanoate (32). Compound 32 was prepared according to the general procedure described for 26. Flash column chromatography eluent: petroleum ether/EtOAc = 4/1; yield, 62%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.17 (s, 1H), 9.02 (s, 1H), 7.80 – 7.63 (m, 3H), 7.60 – 7.39 (m, 4H), 3.60 (s, 3H), 2.72 – 2.56 (m, 4H).

C NMR (125 MHz, DMSO-d6) δ 172.8, 170.0, 159.6, 157.7, 139.4,

13

131.6, 130.8, 129.7, 129.2, 129.2, 128.2, 123.1, 119.0, 115.0, 114.8, 51.3, 30.9, 28.4. MS (ESI), m/z for C20H16F7NO4 ([M – 1]–): Calcd 467.34, found 466.3. HPLC analysis: MeOH − H2O (80:20), 8.37 min, 99.35% purity.

Methyl-5-((2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphe nyl]-4-yl)amino)-5-oxopentanoate (33). Compound 33 was prepared according to the general procedure described for 26. Flash column chromatography eluent:


Page 40 of 64

Page 41 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


petroleum ether/EtOAc = 4/1; yield, 80%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.08 (s, 1H), 9.01 (s, 1H), 7.75 – 7.67 (m, 3H), 7.60 – 7.50 (m, 4H), 3.60 (s, 3H), 2.43 – 2.32 (m, 4H), 1.92 – 1.78 (m, 2H). 13C NMR (125 MHz, DMSO-d6) δ 173.0, 170.8, 159.6, 157.7, 139.5, 131.6, 130.8, 129.7, 129.2, 129.2, 128.2, 123.1, 119.1, 115.0, 114.8, 51.2, 35.3, 32.6, 20.3. MS (ESI), m/z for C21H18F7NO4 ([M + 1]+): Calcd 481.37, found 482.1. HPLC analysis: MeOH − H2O (80:20), 9.36 min, 99.73% purity.

N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]-4-y l)-5-oxohexanamide (34). Compound 34 was prepared according to the general procedure described for 26. Flash column chromatography eluent: petroleum ether/EtOAc = 4/1; yield, 69%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.05 (s, 1H), 9.00 (s, 1H), 7.74 – 7.66 (m, 3H), 7.57 – 7.51 (m, 4H), 2.54 – 2.45 (m, 2H), 2.33 (t, J = 7.2 Hz, 2H), 2.09 (s, 3H), 1.73 – 1.88 (m, 2H).

C NMR (125 MHz,

13

DMSO-d6) δ 208.1, 171.1, 159.7, 157.7, 139.5, 131.6, 130.8, 129.8, 129.7, 129.2, 129.2, 128.2, 123.9, 123.1, 121.6, 119.1, 115., 114.8, 41.9, 35.4, 29.7, 19.2. MS (ESI), m/z for C21H18F7NO3 ([M + 1]+): Calcd 465.37, found 466.1. HPLC analysis: MeOH − H2O (80:20), 8.35 min, 99.58% purity.

N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]-4-y l)-3-phenylpropanamide (35). Compound 35 was prepared according to the general procedure described for 26. Flash column chromatography eluent: petroleum ether/EtOAc = 8/1; yield, 56%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.09 (s, 1H), 9.00 (s, 1H), 7.74 – 7.66 (m, 3H), 7.60 – 7.50 (m, 4H), 7.33 – 7.21 (m, 5H), 2.93 (t, J = 8.1 Hz, 2H), 2.66 (t, J = 7.8 Hz, 2H). 13C NMR (125 MHz, DMSO-d6) δ 170.6, 159.7, 157.7, 141.1, 139.5, 131.6, 130.8, 129.8, 129.7, 129.2, 129.21, 128.28,



128.21, 125.92, 123.14, 119.08, 115.01, 114.79, 37.97, 30.76. MS (ESI), m/z for C24H18F7NO2 ([M – 1]–): Calcd 485.4, found 483.0. HPLC analysis: MeOH − H2O (80:20), 16.55 min, 97.27% purity.

4-cyclohexyl-N-(2'-fluoro-4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'biphenyl]-4-yl)butanamide (36). Compound 36 was prepared according to the general procedure described for 26. Flash column chromatography eluent: petroleum ether/EtOAc = 10/1; yield, 68%; white solid; 1H NMR (400 MHz, DMSO-d6) δ 10.03 (s, 1H), 8.99 (s, 1H), 7.73 – 7.67 (m, 3H), 7.57 – 7.51 (m, 4H), 2.31 (t, J = 7.4 Hz, 2H), 1.75 – 1.53 (m, 7H), 1.30 – 1.05 (m, 6H), 0.95 – 0.77 (m, 2H). 13C NMR (125 MHz, DMSO-d6) δ 171.5, 159.6, 157.7, 139.6, 131.6, 130.8, 129.8, 129.7, 129.2, 129.2, 128.2, 123.1, 121.6, 119.0, 115.0, 114.8, 36.8, 36.7, 36.4, 32.8, 26.2, 25.8, 22.5. MS (ESI), m/z for C25H26F7NO2 ([M + 1]+): Calcd 505.48, found 506.0. HPLC analysis: MeOH − H2O (80:20), 18.96 min, 98.06% purity.

4.3. Biological Assays. 4.3.1. Cell Transient Transfection Assays. 293T cells were maintained in DMEM (Dulbecco’s modified Eagle’s medium) containing 10% FBS (foetal bovine serum). 293T cells were plated at 15000/well (100 μL/well) in 96-well plates 24 h before transient transfection. For Gal4-RORγ driven reporter assays, 25 ng Gal4-RORγ LBD plasmid, 25 ng pG5-luc reporter plasmid and 5 ng Renilla luciferase expression plasmid per well were cotransfected into 293T cells. For Gal4-RORα driven reporter assays, 25 ng Gal4-RORα LBD plasmid, 60 ng pG5-luc reporter plasmid and 2 ng Renilla luciferase expression plasmid per well were cotransfected into 293T cells. For Gal4-RORα driven reporter assays, 25 ng


Page 42 of 64

Page 43 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Gal4-RORβ LBD plasmid, 60 ng pG5-luc reporter plasmid and 2 ng Renilla luciferase expression plasmid per well were cotransfected into 293T cells. For Gal4-LXRα driven reporter assays, 25 ng Gal4-LXRα LBD plasmid, 120 ng pG5-luc reporter plasmid and 2 ng Renilla luciferase expression plasmid per well were cotransfected into 293T cell. For Gal4-FXR driven reporter assays, 25 ng Gal4-FXR LBD plasmid, 120 ng pG5-luc reporter plasmid and 2 ng Renilla luciferase expression plasmid per well were cotransfected into 293T cell. The cells were transiently transfected in Opti-MEM medium using a DNA (μg) to Lipofectamine 2000 (Invitrogen) transfection reagent (μL) ratio of 1:3. Ligands were added 5 h after transfection and the cells harvested after another 24 h for a luciferase assay using the dual-luciferase reporter assay system (Promega). Luciferase activities were normalized to Renilla activity, which was cotransfected as an internal control. All assays were performed in triplicate, and standard deviations calculated accordingly.

4.3.2. Expression and Purification of the RORγ LBD. Human RORγ (residues 262-507, wild type or C455E mutant) was expressed with an N-terminal His6-fusion protein in E. coli BL21 (DE3) competent cells from the expression vector pET24a (Novagen, Madiso, WI). Cells were grown in LB (Luria-Bertani) broth at 25 °C until the OD600 reached approximately 1.0 (approximately 4.5 h), and then the cells were induced with 0.1 mM IPTG (isopropyl-β-D-thiogalactopyranoside) at 16 °C overnight. The cells were harvested, resuspended and high-pressure homogenized in 200 mL of extract buffer (20 mM Tris-HCl (pH 8.0), 500 mM NaCl, 10% glycerol) per 6 litres of cells. The lysate was centrifuged at 20000 rpm for 40 min, and then the supernatant was loaded onto a 20-mL NiSO4-loaded His Trap HP column (GE Healthcare, Piscataway, NJ). The



column was washed with Buffer A (20 mM Tris-HCl (pH 8.0), 500 mM NaCl, 20 mM imidazole, 10% glycerol), and RORγ was eluted with a 50-500 mM imidazole gradient. A gel filtration column (Hiload 16/60 Superdex 75 column GE Healthcare) was used for a second purification (elution buffer, 10 mM HEPES (PH 7.5), 150 mM NaCl, 2 mM TCEP, 5% glycerol). The purified protein was stored at -80 °C until used for binding assays and crystallization.

4.3.3. Thermal Stability Shift Assay. The thermal stability shift assay (TSA) is an increasingly popular method to identify small molecule ligands. All reactions were buffered in 10 mM HEPES, pH 7.5, 150 mM NaCl and 5% (v/v) glycerol at a final concentration of 10 μM protein and 200 μM compounds. The 10 μL reaction mix was added to 96-well PCR plates. SYPRO Orange (Sigma) was added as a fluorescence probe at a dilution of 1:1000 and incubated with the compounds on ice for 30 min. The total DMSO concentration was less than 2%. The TSA was carried out using a Bio-Rad CFX96 Real-Time PCR System. The temperature was raised at a step of 0.5 °C per minute from 30 °C to 80 °C. The fluorescence readings were recorded at a 0.5 °C interval. All experiments were performed in duplicate.

4.3.4. AlphaScreen Assay. Ligands were evaluated for their ability to disrupt the interactions between RORγ LBD and the SRC1-4 coactivator peptide utilizing luminescence-based AlphaScreen technology (Perkin Elmer) using a hexahistidine detection kit from Perkin Elmer (Norwalk, CT). All reactions contained 200 nM receptor LBD bound to nickel acceptor beads (5 μg/mL) and 50 nM biotinylated SRC1-4 peptide bound to


Page 44 of 64

Page 45 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


streptavidin donor beads (5 μg/mL) in the presence of the indicated amounts of control compounds, 2, or candidate compounds. Compound concentrations varied from 150 nM to 200 μM in the dose-response assay. The AlphaScreen assay buffer contained 50 mM MOPS, 50 mM NaF, 0.05 mM CHAPS and 0.1 mg/mL bovine serum albumin (BSA) at a pH of 7.4. The N-terminal biotinylated coactivator peptide SRC1-4 sequence was QKPTSGPQTPQAQQKSLLQQLLTE.

4.3.5. Isothermal Titration Calorimetry Assay. The ITC measurements were carried out using an ITC200 instrument (Microcal, GE Healthcare). All experiments were performed at 25 °C while stirring at 1,000 rpm in an ITC buffer (50 mM HEPES, 150 mM NaCl, 0.5 mM TCEP and pH 7.5). All titrations of RORγ protein with ligand were performed using an initial injection of 0.5 µL followed by 20 identical injections of 2 µL with a duration of 4 seconds per injection and a spacing of 180 seconds between injections. The stock solutions of ligands and the RORγ proteins were diluted with the ITC buffer to a compound concentration of 30 µM and protein concentration of 300 µM before the titrations. The final concentration of DMSO in the reaction buffer was less than 0.25% of the total volume.

In order to estimate the background of the heat of dilution for the proteins, the proteins were titrated into ITC buffer on separate experiments. Data was corrected for heats of dilution by subtracting the data from independent titrations of proteins into buffer. In all the cases, a single binding site mode was employed and a nonlinear least-squares algorithm was used to obtain best-fit values of the stoichiometry (n), change in enthalpy (ΔH), and binding constant (Kd). Thermodynamic parameters were



subsequently calculated with the formula ΔG = ΔH − TΔS = −RTlnK, where ΔG, ΔH, ΔS, T, and R are the changes in free energy, enthalpy, entropy of binding, experimental temperature, and the gas constant, respectively. Titrations were run in triplicate to ensure reproducibility. MicroCalTM Origin7 software was used to collect and process the data.

4.3.6. Crystallization, Data Collection, and Structure Determination. The purified and concentrated RORγ LBD protein with a C455E mutation was incubated with ligand at a molar ratio of 1:5 for 40 min on ice. All crystallizations were carried out using the sitting drop vapor diffusion method in 24-well plates at 20 °C. Crystals of RORγ LBD (C455E) with ligand 27 were grown by mixing 2 μL of the protein (10 mg/mL) with 1 μL of reservoir solution containing 0.2 M (NH4)2SO4, 20% PEG8000, 0.1 M BisTris, pH 7.2. Most crystals appeared in 2 days and grew to full size approximately 2 weeks. Crystals were cryoprotected using the well solution supplemented with additional ethylene glycol and were flash frozen in liquid nitrogen. All diffraction data were collected on beamline BL19U1 at Shanghai Synchrotron Radiation Facilities (SSRF) at 100 K. Data sets were processed (indexing and integration) using the program MOSFLM47 and scaled using Aimless from the Collaborative Computational Project 4 (CCP4) program suite.48 Molecular replacement was performed with the CCP4 program Phaser49 using RORγ LBD complex structure (PDB code: 5AYG) as a search model. The model was refined using CCP4 program REFMAC550 and rebuilt with COOT.51 The quality of the model was checked using MolProbity.52 Structure figures were prepared using the program PyMOL. The statistics of data collection and the model refinement are summarized in Supporting Information Table S1. Crystals of 27 with RORγ LBD (C455E) diffracted


Page 46 of 64

Page 47 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


to resolutions of 2.30 Å. The coordinates were deposited in the PDB with the code: 6J1L.PDB.

4.3.7. Prostate Cancer Cell Culture, Cell Viability, and Cell Colony Formation Assays. LNCaP, C4-2B, 22Rv1, DU145 and PC-3 prostate cancer cells were cultured in RPMI1640, plus 10% FBS; Cells were grown at 37 °C in 5% CO2 incubators. For cell viability, cells were seeded in 384 opaque-walled plates with clear bottoms at 500-1000 cells per well (optimum density for growth) in a total volume of 20 μL of media. After 12 h, compounds were added in a total volume of 10 μL of media (triple diluted) to each well with final concentration from 5 nM to 100 μM. For LNCaP, 22Rv1, C4-2B, DU145, and PC-3 cells, the media was RPMI1640 containing 10% FBS. The measurement was conducted 96 h after seeded for LNCaP, C4-2B, 22Rv1, PC-3 and 72 h after seeded for DU145, respectively. Then, 25 μL of Cell-Titer GLO reagents (Promega) was added, and luminescence was measured on an EnSpire Multimode Plate Reader (PerkinElmer), according to the manufacturer’s instructions. The estimated in vitro half-maximal inhibitory concentration (IC50) values were calculated using GraphPad Prism 6 software.

For colony formation, 1500 C4-2B cells per well were seeded in 6-well plates and treated with vehicle or indicated concentrations of 27. When the cell colony grew visible, the medium was removed and the plates were washed with 2 mL PBS for one time. The cell colonies were stained with 2.5% crystal violet (in MeOH) for 2 h. The plates were scanned with a HP scanner.



Page 48 of 64

4.3.8. PSA Luciferase Reporter Gene Assay. PSA luciferase reporter gene assays were carried out as previously described.46,53,54 LNCaP cells were seeded in 24-well plates and transiently transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. 200 ng PSA-Luc reporter plasmid (PSA promoter driven luciferase reporter plasmid, a gift from Dr. H. Eric Xu) and a 10 ng renilla luciferase expression plasmid per well were cotransfected into LNCaP cells. Chemicals were added 24 h after transfection. The cells were harvested after another 24 h for a luciferase assay using the dual-luciferase reporter assay system (Promega). Luciferase activities were normalized to Renilla activity, which was co-transfected as an internal control. All of the assays were performed in triplicate, and the standard deviations were calculated accordingly.

4.3.9. Analysis of mRNA Expression in Cells. LNCaP prostate cancer cells were cultured in RPMI1640 containing 10% FBS at 37 °C in 5% CO2 incubators. For qRT-PCR analysis, LNCaP were seeded at 1.5 × 105 cells per well in 12-well plates. 24 h later, cells were treated with 5 μM

of

compounds 2 or 27 for 48 h. Total RNA was then isolated with an Eastep ® Super Total RNA Extraction Kit and cDNA was synthesized from 1,000 ng total RNA using the All-in-oneTM First-Strand cDNA Synthesis Kit. qPCR analyses were performed in triplicate using standard SYBR green reagents. Full length AR, AR-V7, PSA (KLK3), KLK2, TMPRSS2, C-MYC and ERG gene expression levels were assessed by real-time PCR, normalizing to β-Actin. Primer sequences for qPCR used are as


Page 49 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


follows: AR-FL_fwd, ACA TCA AGG AAC TCG ATC GTA TCA TTG C; AR-FL_rev, TTG GGC ACT TGC ACA GAG AT; AR-V7_fwd, CAGGGATGACTCTGGGAGAA; AR-V7_rev, GCCCTCTAGAGCCCTCATTT; PSA_fwd, CAC AGG CCA GGT ATT TCA GGT; PSA_rev, GAG GCT CAT ATC GTA GAG CGG; KLK2_fwd, CAA CAT CTG GAG GGG AAA GGG; KLK2_rev, AGG CCA AGT GAT GCC AGA AC; TMPRSS2_fwd, CAA GTG CTC CAA CTC TGG GAT; TMPRSS2_rev, AAC ACA CCG ATT CTC GTC CTC; C-MYC_fwd, GGC TCC TGG CAA AAG GTC A; C-MYC_rev, CTG CGT AGT TGT GCT GAT GT; ERG_fwd, CGC AGA GTT ATC GTG CCA GCA GAT; ERG_rev, CCA TAT TCT TTC ACC GCC CAC TCC; β-Actin_fwd, GAG AAA ATC TGG CAC CAC ACC; β-Actin_rev, ATA CCC CTC GTA GAT GGG CAC.

4.3.10. Cell Lysates and Western Blotting. 22Rv1 cells were treated with vehicle or different concentrations of 27 for 48 h before harvested for western blot. Antibodies used were AR (Abclonal; A2053) and GAPDH (Abclonal; AC001). Cells were lysed in a buffer containing 1% Nonidet P40, 150 mM NaCl, 10 mM Tris/HCl (pH 7.5) and 1 mM EDTA. 20 µg aliquots were separated by SDS–PAGE and transferred onto a PVDF membrane. The membrane was incubated for 1 h in blocking buffer (Tris-buffered saline, 0.1% Tween (TBST), 5% non-fat dry milk) followed by incubation overnight at 4 °C with primary antibody (AR, Abclonal; A2053; GAPDH, Abclonal, AC001). After washing with TBST, the blot was incubated with horseradish peroxidase (HRP)-conjugated secondary antibody



(Abclonal, AS014) and signals were visualized by enhanced chemiluminescence system according to the manufacturer’s protocol (Forscience). Densitometry data for both full length AR (AR-FL) and AR variants (AR-vs) are provided.

4.3.11. Microsomal Stability Assay. This assay was performed by Zhongshan Pharmass Corporation, Guangzhou, China. First, 10 μM compounds were incubated with 0.5 mg/mL rat liver microsomes (RLM was purchased from Research Institute for Liver Diseases (Shanghai) Co. Ltd.). Testerone was used as control. NADPH was maintained at 1 mM in 1000 μL reaction volume. The reaction was then evaluated at 0, 3, 8, 15, 40 and 60 min and was terminated by the addition of acetonitrile. Samples were centrifuged for 10 min at 12000 rpm and supernatant analyzed using HPLC-MS/MS. Percentage parent remaining was calculated considering percent parent area at 0 min as 100%.

4.3.12. Pharmacokinetics Analysis. Pharmacokinetic properties of 23, 26 and 27 were analyzed by Medicilon Corporation, Shanghai, China. 12 Sprague & Dawley rats were provided by Shanghai Super -B&K laboratory animal Corp.Ltd. They were fasted overnight and allowed free access to water before administration. All procedures involving animals were in accordance with the Regulations of Experiment Animal Administration issued by the State Committee of Science and Technology of China. 23, 26 and 27 were dissolved with DMSO: PEG400: 20%HP-β-CD (5:40:55, v:v:v) as stock solution (0.4 mg/mL, iv; 1 mg/mL, oral). The stock solution was orally administrated to 3 SD rats at the dose of 10 mg/kg and intravenous administrated to 3 SD rats at a single dose of 2 mg/kg. Blood was collected from the jugular vein before administration and at 0.25, 0.5, 1, 2,


Page 50 of 64

Page 51 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4, 6, 8 and 24 h after dosing for the oral group. Blood was collected from the jugular vein before administration and at 0.083, 0.25, 0.5, 1, 2, 4, 6, 8 and 24 h after dosing for the intravenous group. About 200 µL blood samples were collected into heparinized tubes and then immediately centrifuged at 8000 rpm per min for 6 min. The plasma obtained was stored at -80 ˚C until analysis.

4.3.13. In vivo Efficacy Studies in 22Rv1 Xenograft Model in Mice. Four-week-old male mice (strain: C.B-17/IcrHsd-Prkdcscid) were purchased from Envigo, Inc and used for establishment of xenograft tumors. Each mouse was inoculated subcutaneously at the dorsal flank on both sides of the mice with 22Rv1 tumor cells (2 × 106 cells) in a mixture of 100 µL PBS and Matrigel (1:1). When the tumor volume was approximately 100 mm3, the mice were randomized, divided into groups (six mice per group), and then treated with 27 or vehicle via intraperitoneal injection (i.p., 5 mg/kg) or oral gavage (p.o, 50 mg/kg) for five times per week (5 days treatment, then 2 days break). All compounds were dissolved in 15% Cremophor EL, Calbiochem, 82.5% PBS and 2.5% DMSO. Tumor growth was monitored by calipers, and volume was calculated with the equation V = π/6 (length × width2). Body weight during the course of the study was also monitored. Tumor growth inhibition (TGI) was calculated using the equation TGI = [1 − (T − T0)/(C − C0)] × 100, wherein T and T0 are the mean tumor volumes on a specific experimental day and on the first day of treatment, respectively, for the test groups; and likewise C and C0 are the mean tumor volumes for the vehicle group. The procedures were approved by the Institutional Animal Care and Use Committee of the University of California, Davis.



ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jmedchem.xxxxxxx. Table S1, Figure S1-S4, Statistics of the data sets and structure refinement, the cocrystal structure of compound 27 in complex with RORγ LDB, superposition of the crystal structures, ITC titration curves for the binding of 23 (A), 26 (B) and 27 (C) to the RORγ LBD, and metabolic stability of 23, 26, 27 in rat liver microsomes at 10 μM, H and 13C NMR spectra of the synthesized compounds (PDF) and molecular formula

1

strings for compounds with associated biological data (CSV).

Accession Code Coordinates for compound 27 in complex with RORγ (C455E) have been deposited into the Protein Data Bank with accession code 6J1L. Authors will release the atomic coordinates and experimental data upon article publication. AUTHOR INFORMATION Corresponding Author *E-mail: [email protected]. Phone: +86-20-32093612. Author Contributions Y.Z., X.W., and X.X. contributed equally.

#

ORCID Yong Xu: 0000-0003-3601-0246 Yan Zhang: 0000-0001-5527-6360 Notes The authors declare no competing financial interest.


Page 52 of 64

Page 53 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ACKNOWLEDGEMENTS We gratefully acknowledge financial support from the Key International Cooperation Projects of the Chinese Academy of Sciences (grant 154144KYSB20180044 and 154144KYSB20180063), the National Science & Technology Major Project “Key New Drug Creation and Manufacturing Program”, China (grant 2018ZX09711002), the “Personalized Medicines − Molecular Signature-based Drug Discovery and Development”, Strategic Priority Research Program of the Chinese Academy of Sciences (grant XDA12020363), the National Natural Science Foundation of China (grant 81673357 and 21602222), the Chinese National Programs for Key Research and Development (grant 2016YFB0201701), Guangdong Provincial Key Laboratory of Biocomputing (grant 2016B030301007) and Guangzhou Regenerative Medicine and Health Guangdong Laboratory (grant 2018GZR110105016). This study was supported in part by Prostate Cancer Foundation Challenge Award (2016) and US Department of Defense (W81XWH-16-1-0583) and NIH (R01CA206222). The authors also gratefully acknowledge support from the Guangzhou Branch of the Supercomputing Center of Chinese Academy of Sciences.

ABBREVIATIONS RORγ, retinoic acid receptor-related orphan receptor γ; LBD, ligand binding domain; SAR, structure activity relationship; TSA, thermal shift assay; PCa, prostate cancer; CRPC, castration-resistant prostate cancer; PSA, prostatic specific antigen



References (1) Siegel, R.; Ma, J. M.; Zou, Z. H.; Jemal, A. Cancer statistics, 2014. Ca-Cancer J Clin 2014, 64, 9-29. (2) Ferlay, J.; Steliarova-Foucher, E.; Lortet-Tieulent, J.; Rosso, S.; Coebergh, J. W.; Comber, H.; Forman, D.; Bray, F. Cancer incidence and mortality patterns in Europe: estimates for 40 countries in 2012. Eur J Cancer 2013, 49, 1374-1403. (3) Baselga, J.; Bhardwaj, N.; Cantley, L. C.; DeMatteo, R.; DuBois, R. N.; Foti, M.; Gapstur, S. M.; Hahn, W. C.; Helman, L. J.; Jensen, R. A.; Paskett, E. D.; Lawrence, T. S.; Lutzker, S. G.; Szabo, E. AACR cancer progress report 2015. Clin Cancer Res 2015, 21, S1-128. (4) Huggins, C.; Stevens, R. E.; Hodges, C. V. Studies on prostatic cancer II. The effects of castration on advanced carcinoma of the prostate gland. Arch Surg 1941, 43, 209-223. (5) O'Donnell, A.; Judson, I.; Dowsett, M.; Raynaud, F.; Dearnaley, D.; Mason, M.; Harland, S.; Robbins, A.; Halbert, G.; Nutley, B.; Jarman, M. Hormonal impact of the 17alpha-hydroxylase/C(17,20)-lyase inhibitor abiraterone acetate (CB7630) in patients with prostate cancer. Br J Cancer 2004, 90, 2317-2325. (6) Attard, G.; Reid, A. H.; Yap, T. A.; Raynaud, F.; Dowsett, M.; Settatree, S.; Barrett, M.; Parker, C.; Martins, V.; Folkerd, E.; Clark, J.; Cooper, C. S.; Kaye, S. B.; Dearnaley, D.; Lee, G.; de Bono, J. S. Phase I clinical trial of a selective inhibitor of CYP17, abiraterone acetate, confirms that castration-resistant prostate cancer commonly remains hormone driven. J Clin Oncol 2008, 26, 4563-4571.


Page 54 of 64

Page 55 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(7) Tran, C.; Ouk, S.; Clegg, N. J.; Chen, Y.; Watson, P. A.; Arora, V.; Wongvipat, J.; Smith-Jones, P. M.; Yoo, D.; Kwon, A.; Wasielewska, T.; Welsbie, D.; Chen, C. D.; Higano, C. S.; Beer, T. M.; Hung, D. T.; Scher, H. I.; Jung, M. E.; Sawyers, C. L. Development of a second-generation antiandrogen for treatment of advanced prostate cancer. Science 2009, 324, 787-790. (8) Scher, H. I.; Beer, T. M.; Higano, C. S.; Anand, A.; Taplin, M. E.; Efstathiou, E.; Rathkopf, D.; Shelkey, J.; Yu, E. Y.; Alumkal, J.; Hung, D.; Hirmand, M.; Seely, L.; Morris, M. J.; Danila, D. C.; Humm, J.; Larson, S.; Fleisher, M.; Sawyers, C. L.; Fdn, P. C. Antitumour activity of MDV3100 in castration-resistant prostate cancer: a phase 1-2 study. Lancet 2010, 375, 1437-1446. (9) Scher, H. I.; Fizazi, K.; Saad, F.; Taplin, M. E.; Sternberg, C. N.; Miller, K.; de Wit, R.; Mulders, P.; Chi, K. N.; Shore, N. D.; Armstrong, A. J.; Flaig, T. W.; Flechon, A.; Mainwaring, P.; Fleming, M.; Hainsworth, J. D.; Hirmand, M.; Selby, B.; Seely, L.; de Bono, J. S.; Investigators, A. Increased survival with enzalutamide in prostate cancer after chemotherapy. N Engl J Med 2012, 367, 1187-1197. (10)Ryan, C. J.; Smith, M. R.; de Bono, J. S.; Molina, A.; Logothetis, C. J.; de Souza, P.; Fizazi, K.; Mainwaring, P.; Piulats, J. M.; Ng, S.; Carles, J.; Mulders, P. F.; Basch, E.; Small, E. J.; Saad, F.; Schrijvers, D.; Van Poppel, H.; Mukherjee, S. D.; Suttmann, H.; Gerritsen, W. R.; Flaig, T. W.; George, D. J.; Yu, E. Y.; Efstathiou, E.; Pantuck, A.; Winquist, E.; Higano, C. S.; Taplin, M. E.; Park, Y.; Kheoh, T.; Griffin, T.; Scher, H. I.; Rathkopf, D. E.; Investigators, C.-A.-. Abiraterone in metastatic prostate cancer without previous chemotherapy. N Engl J Med 2013, 368, 138-148.



(11) James, N. D.; de Bono, J. S.; Spears, M. R.; Clarke, N. W.; Mason, M. D.; Dearnaley, D. P.; Ritchie, A. W. S.; Amos, C. L.; Gilson, C.; Jones, R. J.; Matheson, D.; Millman, R.; Attard, G.; Chowdhury, S.; Cross, W. R.; Gillessen, S.; Parker, C. C.; Russell, J. M.; Berthold, D. R.; Brawley, C.; Adab, F.; Aung, S.; Birtle, A. J.; Bowen, J.; Brock, S.; Chakraborti, P.; Ferguson, C.; Gale, J.; Gray, E.; Hingorani, M.; Hoskin, P. J.; Lester, J. F.; Malik, Z. I.; McKinna, F.; McPhail, N.; Money-Kyrle, J.; O'Sullivan, J.; Parikh, O.; Protheroe, A.; Robinson, A.; Srihari, N. N.; Thomas, C.; Wagstaff, J.; Wylie, J.; Zarkar, A.; Parmar, M. K. B.; Sydes, M. R.; Investigators, S. Abiraterone for prostate cancer not previously treated with hormone therapy. N Engl J Med 2017, 377, 338-351. (12)de Bono, J. S.; Logothetis, C. J.; Molina, A.; Fizazi, K.; North, S.; Chu, L.; Chi, K. N.; Jones, R. J.; Goodman, O. B., Jr.; Saad, F.; Staffurth, J. N.; Mainwaring, P.; Harland, S.; Flaig, T. W.; Hutson, T. E.; Cheng, T.; Patterson, H.; Hainsworth, J. D.; Ryan, C. J.; Sternberg, C. N.; Ellard, S. L.; Flechon, A.; Saleh, M.; Scholz, M.; Efstathiou, E.; Zivi, A.; Bianchini, D.; Loriot, Y.; Chieffo, N.; Kheoh, T.; Haqq, C. M.; Scher, H. I.; Investigators, C.-A.-. Abiraterone and increased survival in metastatic prostate cancer. N Engl J Med 2011, 364, 1995-2005. (13)Beer, T. M.; Armstrong, A. J.; Rathkopf, D. E.; Loriot, Y.; Sternberg, C. N.; Higano, C. S.; Iversen, P.; Bhattacharya, S.; Carles, J.; Chowdhury, S.; Davis, I. D.; de Bono, J. S.; Evans, C. P.; Fizazi, K.; Joshua, A. M.; Kim, C. S.; Kimura, G.; Mainwaring, P.; Mansbach, H.; Miller, K.; Noonberg, S. B.; Perabo, F.; Phung, D.; Saad, F.; Scher, H. I.; Taplin, M. E.; Venner, P. M.; Tombal, B.; Investigators, P.


Page 56 of 64

Page 57 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Enzalutamide in metastatic prostate cancer before chemotherapy. N Engl J Med 2014, 371, 424-433. (14)Antonarakis, E. S.; Lu, C.; Wang, H.; Luber, B.; Nakazawa, M.; Roeser, J. C.; Chen, Y.; Mohammad, T. A.; Chen, Y.; Fedor, H. L.; Lotan, T. L.; Zheng, Q.; De Marzo, A. M.; Isaacs, J. T.; Isaacs, W. B.; Nadal, R.; Paller, C. J.; Denmeade, S. R.; Carducci, M. A.; Eisenberger, M. A.; Luo, J. AR-V7 and resistance to enzalutamide and abiraterone in prostate cancer. N Engl J Med 2014, 371, 1028-1038. (15)Ivanov, II; McKenzie, B. S.; Zhou, L.; Tadokoro, C. E.; Lepelley, A.; Lafaille, J. J.; Cua, D. J.; Littman, D. R. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell 2006, 126, 1121-1133. (16)Dhar, T. G. M.; Zhao, Q.; Markby, D. W. Targeting the nuclear hormone receptor RORγt for the treatment of autoimmune and inflammatory disorders. In Annu Rep Med Chem, 2013; Vol. 48, pp 169-182. (17)Carcache, D. A.; Vulpetti, A.; Kallen, J.; Mattes, H.; Orain, D.; Stringer, R.; Vangrevelinghe, E.; Wolf, R. M.; Kaupmann, K.; Ottl, J.; Dawson, J.; Cooke, N. G.; Hoegenauer, K.; Billich, A.; Wagner, J.; Guntermann, C.; Hintermann, S. Optimizing a weakly binding fragment into a potent RORγt inverse agonist with efficacy in an in vivo inflammation model. J Med Chem 2018, 61, 6724-6735. (18)Kono, M.; Ochida, A.; Oda, T.; Imada, T.; Banno, Y.; Taya, N.; Masada, S.; Kawamoto, T.; Yonemori, K.; Nara, Y.; Fukase, Y.; Yukawa, T.; Tokuhara, H.; Skene, R.; Sang, B. C.; Hoffman, I. D.; Snell, G. P.; Uga, K.; Shibata, A.; Igaki, K.;



Nakamura, Y.; Nakagawa, H.; Tsuchimori, N.; Yamasaki, M.; Shirai, J.; Yamamoto, S. Discovery

of

[

cis-3-({(5

R)-5-[(7-Fluoro-1,1-dimethyl-2,3-dihydro-1

H-inden-5-yl)carbamoyl]-2-methoxy-7,8-dihydro-1,6-naphthyridin-6(5 H)-yl}carbonyl)cyclobutyl]acetic acid (TAK-828F) as a potent, selective, and orally available novel retinoic acid receptor-related orphan receptor γt inverse agonist. J Med Chem 2018, 61, 2973-2988. (19)Narjes, F.; Xue, Y.; von Berg, S.; Malmberg, J.; Llinas, A.; Olsson, R. I.; Jirholt, J.; Grindebacke, H.; Leffler, A.; Hossain, N.; Lepisto, M.; Thunberg, L.; Leek, H.; Aagaard, A.; McPheat, J.; Hansson, E. L.; Back, E.; Tangefjord, S.; Chen, R.; Xiong, Y.; Hongbin, G.; Hansson, T. G. Potent and orally bioavailable inverse agonists of RORγt resulting from structure-based design. J Med Chem 2018, 61, 7796-7813. (20)Schnute, M. E.; Wennerstal, M.; Alley, J.; Bengtsson, M.; Blinn, J. R.; Bolten, C. W.; Braden, T.; Bonn, T.; Carlsson, B.; Caspers, N.; Chen, M.; Choi, C.; Collis, L. P.; Crouse, K.; Farnegardh, M.; Fennell, K. F.; Fish, S.; Flick, A. C.; Goos-Nilsson, A.; Gullberg, H.; Harris, P. K.; Heasley, S. E.; Hegen, M.; Hromockyj, A. E.; Hu, X.; Husman, B.; Janosik, T.; Jones, P.; Kaila, N.; Kallin, E.; Kauppi, B.; Kiefer, J. R.; Knafels, J.; Koehler, K.; Kruger, L.; Kurumbail, R. G.; Kyne, R. E., Jr.; Li, W.; Lofstedt, J.; Long, S. A.; Menard, C. A.; Mente, S.; Messing, D.; Meyers, M. J.; Napierata, L.; Noteberg, D.; Nuhant, P.; Pelc, M. J.; Prinsen, M. J.; Rhonnstad, P.; Backstrom-Rydin, E.; Sandberg, J.; Sandstrom, M.; Shah, F.; Sjoberg, M.; Sundell, A.; Taylor, A. P.; Thorarensen, A.; Trujillo, J. I.; Trzupek, J. D.; Unwalla, R.; Vajdos, F. F.; Weinberg, R. A.; Wood, D. C.; Xing, L.; Zamaratski, E.; Zapf, C. W.; Zhao, Y.;


Page 58 of 64

Page 59 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Wilhelmsson,

A.;

Berstein,

G.

Discovery

N-(3-(1-isobutyrylpiperidin-4-yl)-1-methyl-4-(trifluoromethyl)-1

of

3-CyanoH-pyrrolo[2,3-

b]pyridin-5-yl)benzamide: a potent, selective, and orally bioavailable retinoic acid receptor-related orphan receptor c2 inverse agonist. J Med Chem 2018, 61, 10415-10439. (21)Doerks, T. C., R. R.; Schultz, J.; Ponting, C. P.; Bork, P. Systematic identification of novel protein domain families associated with nuclear functions. Genome Res 2002, 12, 47-56. (22)Mitro, N.; Vargas, L.; Romeo, R.; Koder, A.; Saez, E. T0901317 is a potent PXR ligand: implications for the biology ascribed to LXR. FEBS Lett 2007, 581, 1721-1726. (23)Houck, K. A.; Borchert, K. M.; Hepler, C. D.; Thomas, J. S.; Bramlett, K. S.; Michael, L. F.; Burris, T. P. T0901317 is a dual LXR/FXR agonist. Mol Genet Metab 2004, 83, 184-187. (24)Kumar, N.; Solt, L. A.; Conkright, J. J.; Wang, Y.; Istrate, M. A.; Busby, S. A.; Garcia-Ordonez, R. D.; Burris, T. P.; Griffin, P. R. The benzenesulfoamide T0901317 [N-(2,2,2-trifluoroethyl)-N-[4-[2,2,2-trifluoro-1-hydroxy-1-(trifluoromethyl)ethy l]phenyl]-benzenesulfonamide] is a novel retinoic acid receptor-related orphan receptor-alpha/gamma inverse agonist. Mol Pharmacol 2010, 77, 228-236. (25)Kumar, N.; Lyda, B.; Chang, M. R.; Lauer, J. L.; Solt, L. A.; Burris, T. P.; Kamenecka, T. M.; Griffin, P. R. Identification of SR2211: a potent synthetic RORgamma-selective modulator. ACS Chem Biol 2012, 7, 672-677.



Page 60 of 64

(26)Chang, M. R.; Lyda, B.; Kamenecka, T. M.; Griffin, P. R. Pharmacologic repression of retinoic acid receptor-related orphan nuclear receptor gamma is therapeutic in the collagen-induced arthritis experimental model. Arthritis Rheumatol 2014, 66, 579-588. (27)Wang, Y.; Cai, W.; Zhang, G.; Yang, T.; Liu, Q.; Cheng, Y.; Zhou, L.; Ma, Y.; Cheng, Z.; Lu, S.; Zhao, Y. G.; Zhang, W.; Xiang, Z.; Wang, S.; Yang, L.; Wu, Q.; Orband-Miller, L. A.; Xu, Y.; Zhang, J.; Gao, R.; Huxdorf, M.; Xiang, J. N.; Zhong, Z.; Elliott,

J.

D.;

Leung,

S.;

Lin,

X.

Discovery

of

novel

N-(5-(arylcarbonyl)thiazol-2-yl)amides and N-(5-(arylcarbonyl)thiophen-2-yl)amides as potent RORgammat inhibitors. Bioorg Med Chem 2014, 22, 692-702. (28)Yang, T.; Liu, Q.; Cheng, Y.; Cai, W.; Ma, Y.; Yang, L.; Wu, Q.; Orband-Miller, L. A.; Zhou, L.; Xiang, Z.; Huxdorf, M.; Zhang, W.; Zhang, J.; Xiang, J. N.; Leung, S.; Qiu, Y.; Zhong, Z.; Elliott, J. D.; Lin, X.; Wang, Y. Discovery of tertiary amine and indole derivatives as potent RORgammat inverse agonists. ACS Med Chem Lett 2014, 5, 65-68. (29)Wang, Y.; Cai, W.; Cheng, Y.; Yang, T.; Liu, Q.; Zhang, G.; Meng, Q.; Han, F.; Huang, Y.; Zhou, L.; Xiang, Z.; Zhao, Y. G.; Xu, Y.; Cheng, Z.; Lu, S.; Wu, Q.; Xiang, J. N.; Elliott, J. D.; Leung, S.; Ren, F.; Lin, X. Discovery of biaryl amides as potent, orally bioavailable, and CNS penetrant RORgammat inhibitors. ACS Med Chem Lett 2015, 6, 787-792. (30)Zhang, Y.; Luo, X. Y.; Wu, D. H.; Xu, Y. ROR nuclear receptors: structures, related diseases, and drug discovery. Acta Pharmacol Sin 2015, 36, 71-87.


Page 61 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(31)Qiu, R. M.; Wang, Y. H. Retinoic acid receptor-related orphan receptor γt (RORγt) agonists as potential small molecule therapeutics for cancer immunotherapy. J Med Chem 2018, 61, 5794-5804. (32)Pandya, V. B.; Kumar, S.; Sachchidanand; Sharma, R.; Desai, R. C. Combating autoimmune diseases with retinoic acid receptor-related orphan receptor-γ (RORγ or RORc) inhibitors: hits and misses. J Med Chem 2018, 61, 10976-10995 (33)Fauber, B. P.; Magnuson, S. Modulators of the nuclear receptor retinoic acid receptor-related orphan receptor-γ (RORγ or RORc). J Med Chem 2014, 57, 5871-5892. (34)Arrien Pharmaceuticals. A Phase 1 Study of ARN-6039 (ARN-6039). Clinical Trials, Aug 3, 2017, https://clinicaltrials.gov/ct2/show/NCT03237832 (accessed Dec 24, 2018). (35)AstraZeneca. Study to Determine if AZD0284 is Effective and Safe in Treating Plaque

Psoriasis

(DERMIS).

Clinical

Trials,

Oct

16,

2017,

https://clinicaltrials.gov/ct2/show/NCT03310320 (accessed Dec 24, 2018). (36)Akros Pharma (subsidiary of Japan Tobacco). Study to Evaluate Safety, Tolerability, Pharmacodynamics & Pharmacokinetics of JTE-451 in Active Plaque Psoriasis

Subjects.

Clinical

Trials,

Jan

12,

2017,

https://clinicaltrials.gov/ct2/show/NCT03018509 (accessed Dec 24, 2018). (37)Reata Pharmaceuticals, Safety and PK/PD of RTA 1701 in Healthy Adults, July 6, 2018, https://clinicaltrials.gov/ct2/show/NCT03579030 (accessed Dec 24, 2018). (38)Vitae Pharmaceuticals, Inc. An Ascending Multiple Dose Study With VTP-43742



Page 62 of 64

in Healthy Volunteers and Psoriatic Patients. Clinical Trials, Sep 21, 2015, https://clinicaltrials.gov/ct2/show/NCT02555709(accessed Dec 24, 2018). (39)Wang, J.; Zou, J. X.; Xue, X.; Cai, D.; Zhang, Y.; Duan, Z.; Xiang, Q.; Yang, J. C.; Louie, M. C.; Borowsky, A. D.; Gao, A. C.; Evans, C. P.; Lam, K. S.; Xu, J.; Kung, H. J.; Evans, R. M.; Xu, Y.; Chen, H. W. ROR-gamma drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer. Nat Med 2016, 22, 488-496. (40)Zhang, Y.; Xue, X.; Jin, X.; Song, Y.; Li, J.; Luo, X.; Song, M.; Yan, W.; Song, H.; Xu, Y. Discovery of 2-oxo-1,2-dihydrobenzo[cd]indole-6-sulfonamide derivatives as new RORgamma inhibitors using virtual screening, synthesis and biological evaluation. Eur J Med Chem 2014, 78, 431-441. (41)Wu, X. S.; Wang, R.; Xing, Y. L.; Xue, X. Q.; Zhang, Y.; Lu, Y. Z.; Song, Y.; Luo, X. Y.; Wu, C.; Zhou, Y. L.; Jiang, J. Q.; Xu, Y. Discovery and structural optimization of 4-(4-(benzyloxy)phenyl)-3,4-dihydropyrimidin-2(1H)-ones as RORc inverse agonists. Acta Pharmacol Sin 2016, 37, 1516-1524. (42)Song, Y.; Xue, X.; Wu, X.; Wang, R.; Xing, Y.; Yan, W.; Zhou, Y.; Qian, C. N.; Zhang,

Y.;

Xu,

Y.

Identification

of

N-phenyl-2-(N-phenylphenylsulfonamido)acetamides as new RORgamma inverse agonists: Virtual screening, structure-based optimization, and biological evaluation. Eur J Med Chem 2016, 116, 13-26. (43)Fauber, B. P.; Rene, O.; de Leon Boenig, G.; Burton, B.; Deng, Y.; Eidenschenk, C.; Everett, C.; Gobbi, A.; Hymowitz, S. G.; Johnson, A. R.; La, H.; Liimatta, M.;


Page 63 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Lockey, P.; Norman, M.; Ouyang, W.; Wang, W.; Wong, H. Reduction in lipophilicity improved the solubility, plasma-protein binding, and permeability of tertiary sulfonamide RORc inverse agonists. Bioorg Med Chem Lett 2014, 24, 3891-3897. (44)Kallen, J.; Izaac, A.; Be, C.; Arista, L.; Orain, D.; Kaupmann, K.; Guntermann, C.; Hoegenauer, K.; Hintermann, S. Structural states of RORgammat: X-ray elucidation of molecular mechanisms and binding interactions for natural and synthetic compounds. ChemMedChem 2017, 12, 1014-1021. (45)Enyedy, I. J.; Powell, N. A.; Caravella, J.; van Vloten, K.; Chao, J.; Banerjee, D.; Marcotte, D.; Silvian, L.; McKenzie, A.; Hong, V. S.; Fontenot, J. D. Discovery of biaryls as RORgamma inverse agonists by using structure-based design. Bioorg Med Chem Lett 2016, 26, 2459-2463. (46)Zhang, M. F.; Zhang, Y.; Song, M.; Xue, X. Q.; Wang, J. J.; Wang, C.; Zhang, C.; Li, C. C.; Xiang, Q. P.; Zou, L. J.; Wu, X. S.; Wu, C.; Dong, B. J.; Xue, W.; Zhou, Y. L.; Chen, H. W.; Wu, D. H.; Ding, K.; Xu, Y. Structure-based discovery and optimization of benzo[d]isoxazole derivatives as potent and selective BET inhibitors for potential treatment of castration-resistant prostate cancer (CRPC). J Med Chem 2018, 61, 3037-3058. (47)Leslie, A. G.; Powell, H. R. Processing diffraction data with MOSFLM. Evolving Methods for Macromolecular Crystallography 2007, 245, 41-51. (48)Bailey, S. Collaborative Computational Project, Number 4. The CCP4 suite: programs for protein crystallography. Acta Crystallogr Sect D: Biol Crystallogr 1994, 50, 760-763.



(49)Mccoy, A. J.; Grosse-Kunstleve, R. W.; Adams, P. D.; Winn, M. D.; Storoni, L. C.; Read, R. J. Phaser crystallographic software. J Appl Crystallogr 2007, 40, 658-674. (50)Murshudov, G. N.; Skubak, P.; Lebedev, A. A.; Pannu, N. S.; Steiner, R. A.; Nicholls, R. A.; Winn, M. D.; Long, F.; Vagin, A. A. REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallogr Sect D: Biol Crystallogr 2011, 67, 355-367. (51)Emsley, P.; Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallogr Sect D: Biol Crystallogr 2004, 60, 2126-2132. (52)Chen, V. B.; Arendall, W. B.; Headd, J. J.; Keedy, D. A.; Immormino, R. M.; Kapral, G. J.; Murray, L. W.; Richardson, J. S.; Richardson, D. C. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr Sect D: Biol Crystallogr 2010, 66, 12-21. (53)Xiang, Q.; Wang, C.; Zhang, Y.; Xue, X.; Song, M.; Zhang, C.; Li, C.; Wu, C.; Li, K.; Hui, X.; Zhou, Y.; Smaill, J. B.; Patterson, A. V.; Wu, D.; Ding, K.; Xu, Y. Discovery and optimization of 1-(1H-indol-1-yl)ethanone derivatives as CBP/EP300 bromodomain inhibitors for the treatment of castration-resistant prostate cancer. Eur J Med Chem 2018, 147, 238-252. (54)Xue, X.; Zhang, Y.; Wang, C.; Zhang, M.; Xiang, Q.; Wang, J.; Wang, A.; Li, C.; Zhang, C.; Zou, L.; Wang, R.; Wu, S.; Lu, Y.; Chen, H.; Ding, K.; Li, G.; Xu, Y. Benzoxazinone-containing 3,5-dimethylisoxazole derivatives as BET bromodomain inhibitors for treatment of castration-resistant prostate cancer. Eur J Med Chem 2018, 152, 542-559.


Page 64 of 64

Page 65 of 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table of Contents Graphic


Discovery and Characterization of XY101, a Potent, Selective, and

Recommend Documents