Discovery and Modification of in Vivo Active Nrf2 Activators with 1,2,4

Subscriber access provided by UB + Fachbibliothek Chemie | (FU-Bibliothekssystem)

Article

Discovery and Modification of in vivo active Nrf2 Activators with 1, 2, 4oxadiazole Core: Hits Identification and Structure-Activity Relationship Study Lili Xu, Junfeng Zhu, Xiaoli Xu, Jie Zhu, Li Li, Meiyang Xi, Zhengyu Jiang, Mingye Zhang, Fang Liu, Mengchen Lu, Qichao Bao, Chao Zhang, Jinlian Wei, Xiaojin Zhang, Qi-Dong You, and Haopeng Sun J. Med. Chem., Just Accepted Manuscript • Publication Date (Web): 25 Jun 2015 Downloaded from http://pubs.acs.org on June 25, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Medicinal Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

175x147mm (300 x 300 DPI)

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

173x74mm (300 x 300 DPI)


Page 2 of 64

Page 3 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


104x28mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

127x42mm (300 x 300 DPI)


Page 4 of 64

Page 5 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


220x60mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

154x137mm (300 x 300 DPI)


Page 6 of 64

Page 7 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


888x260mm (72 x 72 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

101x82mm (300 x 300 DPI)


Page 8 of 64

Page 9 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


101x62mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

127x61mm (300 x 300 DPI)


Page 10 of 64

Page 11 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


127x76mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

127x91mm (300 x 300 DPI)


Page 12 of 64

Page 13 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


169x88mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

169x97mm (300 x 300 DPI)


Page 14 of 64

Page 15 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


142x33mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

276x131mm (300 x 300 DPI)


Page 16 of 64

Page 17 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


69x62mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 64

Discovery and Modification of in vivo active Nrf2 Activators with 1, 2, 4-oxadiazole Core: Hits Identification and Structure-Activity Relationship Study

Li-Li Xu, a,b Jun-Feng Zhu, a,b Xiao-Li Xu, a,b Jie Zhu, a,b Li Li, a,b Mei-Yang Xi, a,b Zheng-Yu Jiang, a,b Ming-Ye Zhang, a,b Fang Liu, a,b Meng-chen Lu, a,b Qi-Chao Bao, a,b

Chao Zhang,a,b Jin-Lian Wei,a,b Xiao-Jin Zhang,

a,b,d

Qi-Dong You,

a,b,e,*

and

Hao-Peng Sun, a,b,c,*

a

Jiangsu Key Laboratory of Drug Design and Optimization, China Pharmaceutical

University, Nanjing, 210009, China b

State Key Laboratory of Natural Medicines, China Pharmaceutical University,

Nanjing 210009, China c

Department of Medicinal Chemistry, School of Pharmacy, China Pharmaceutical

University, Nanjing, 210009, China d

Department of Organic Chemistry, School of Science, China Pharmaceutical

University, Nanjing, 210009, China e

National Engineering and Research Center for Target Drugs, Jiangsu Hengrui

Medicine Co. Ltd., Lianyungang, 222000, China

Corresponding author: Hao-peng Sun: Fax & Tel: +86-25-83271216, E-mail: [email protected]; Qi-dong You: Fax & Tel: +86-25-83271351, E-mail: [email protected].

Abstract Induction of phase II antioxidant enzymes by activation of Nrf2/ARE pathway has been recognized as a promising strategy for the regulation of oxidative stress-related diseases. Herein we report our effort on the discovery and optimization of Nrf2 activators with 1,2,4-oxadiazole core. Screening of in-house collection containing 7500 compounds by ARE-luciferase reporter assay revealed a moderate Nrf2 activator, 1. Aimed at obtaining more derivatives efficiently, molecular similarity search by the 1


Page 19 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


combination of 2D fingerprint-based and 3D shape-based search was applied to virtually screening the Chemdiv collection. Three derivatives with the same core were identified to have better inductivity of Nrf2 than 1. The best hit 4 was selected as starting point for structurally optimization, leading to a much more potent derivative 32. It in vitro up-regulated gene and protein level of Nrf2 as well as its downstream markers such as NQO1, GCLM and HO-1. It remarkably suppressed inflammation in the in vivo LPS-challenged mouse model. Our results provide a new chemotype as Nrf2-ARE activators, which deserve further optimization with the aim to obtain active anti-inflammatory agents through Nrf2-ARE pathway.

Introduction Nuclear factor erythroid 2 p45-related factor 2 (Nrf2), a basic-leucine zipper (b-ZIP) transcription factor normally located in the cytoplasm of cells, regulates the transcription of protective genes by interacting with a cis-acting element (antioxidant response element, 5’-GTGACnnnGC-3’) / (Electrophile Response Element) (ARE/EpRE) in their promoters to ameliorate oxidative and environmental stresses.1 When cells are exposed to inflammatory stimulus or environmental stress, such as toxicant, oxidation and electrophilic attack, Nrf2 detaches from its endogenous inhibitory partner Kelch-like ECH-associated protein 1 (Keap1), subsequently translocates to the nucleus and binds to the antioxidant response element (ARE) of target genes, results in transcriptional induction and chemoprotection effects.2 As a result, The Keap1-Nrf2 protein-protein interaction (PPI) is recognized as the major regulatory pattern of cytoprotective gene expression against oxidative and/or electrophilic stresses.3 Keap1 shepherds Nrf2 toward the polyubiquitination and degradation machinery of the cell before it translocates into the nucleus, leading to negatively regulation of Nrf2 transcriptional function.4 In addition to Keap1, several protein kinases have been confirmed to activate Nrf2, thus are considered to be the regulatory nodes in the Nrf2 related pathways.5 Nrf2 can regulate almost all of the relevant antioxidants and cytoprotective genes such as NAD(P)H/quinone oxidoreductase 1(NQO1), heme oxygenase-1 (HO-1), 2



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 64

glutamate-cysteine ligase modifier subunit (GCLM), γ-glutamyl cysteine synthase, glutathione peroxidase (GPx), glutathione S-transferases (GSTs), and several members of the glutathione S-transferase family which express the ARE in their promoter.6-8 As a result, activation of Nrf2 is considered to be an efficient strategy to protect the cells from abnormal stimulus or chemical attacks, which are usually existed in the chronic and degenerative syndromes, such as uncontrolled inflammation, carcinogenesis, and Alzheimer’s disease.9 So far, many compounds have shown Nrf2 inductive activities. Dimethyl fumarate (DMF), a very simple compound, can covalently bind to Cys151 of Keap1 and upregulate the activity of Nrf2. It has been approved for the treatment of Multiple Sclerosis by FDA in 2013.10 Bardoxolone methyl (also named as CDDO-Me), is considered to act with the similar mechanism to dimethyl fumarate,11 though that notion has recently been challenged.12 Other natural products including curcumin,13 sulforaphane (SFN),14 chalcone,15 resveratrol16 and caffeic acid phenethyl ester (CAPE)17 also exhibit chemopreventive effects through activating Nrf2 related pathway. Additionally, small molecules directly targeting Keap1-Nrf2 PPI have been disclosed by many groups. These compounds, either peptides18 or synthetic compounds such as cpd16,19 (SRS)-5,20 are proposed to block the binding of Keap1 to the ETGE or DLG motifs of Nrf2. They provide a novel strategy for the development of highly efficient Nrf2 activators as chemopreventive agents (Figure 1). Our laboratory has previously reported several small compounds as Nrf2 activators,21, 22 which provide promising chemotypes for the development of active chemopreventive agents (Figure 1).

3


Page 21 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Active Nrf2 activators from different publications.

Herein we report our effort on the discovery of new Nrf2 activators with 1,2,4-oxadiazole core. Compound 1 was firstly identified from screening of a collection of 7500 compounds by ARE-luciferase reporter assay. To obtain more derivatives efficiently, molecular similarity search by the combination of 2D fingerprint-based and 3D shape-based search was applied to virtually screening the Chemdiv collection. The resulted compound 4, which was more potent than 1, was selected as starting point for optimization. Compound 32, which was much more potent than 4, was revealed from the structure-activity relationship (SAR) study. Pharmacological study showed the compound in vitro up-regulated gene and protein level of Nrf2 as well as its downstream markers such as NQO1, GCLM and HO-1. It also remarkably suppressed inflammation in the in vivo LPS-challenged mouse model. Therefore, our results provide a new chemotype as Nrf2-ARE activators, which 4



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 64

deserve further optimization with the aim to obtain potent anti-inflammatory agents through Nrf2-ARE pathway.

Results 1. Hits identification from virtual screening (VS) using shape-based similarity search. Virtual screening. The initial compound 1 was screened out from an in-house collection containing 7500 compounds by using ARE-luciferase reporter assay in HepG2-ARE-C8 cells. It exhibited a mild inductivity, with 4.10 ± 0.35 fold and 5.47 ± 0.14 fold upregulation of the ARE level at 20 µM and 50 µM, respectively. To obtain more activators efficiently, compound 1 was used as the template for the subsequent molecular similarity search to identify potential hits from Chemdiv collection. 2D molecular fingerprint FCFC_6 method (‘Find Similar Molecules by Fingerprints’ module in Discovery Studio 3.0) was first used for its high efficiency in the screening of large compound database. The tanimoto coefficient was set as 0.7. 37104 hits were screened out to have the similarity to compound 1, however, the data only suggested a similarity of chemical structure and atom connectivity in the 2D level between the reference molecule and the hits, while the 3D conformational similarity can not be evaluated by this method. Therefore, we subsequently performed a shape-based 3D similarity search (‘Search 3D database’ using molecular shape in Discovery Studio 3.0). The best 50 hits were output for the manual selection. 12 hits were retained and purchased from Topscience (http://www.tsbiochem.com/). Their Nrf2 inductivity was then evaluated by the ARE-luciferase reporter assay. Finally, 3 hits with 1, 2, 4-oxadiazole core (2~4, Figure 2B) were confirmed to have improved Nrf2 inductivity compared to the template molecule 1. The screening strategy was summarized in Figure 2A.

5


Page 23 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. (A) The screening strategy combining 2D and 3D molecular similarity search. (B) The structure of the four Nrf2 activators with 1,2,4-oxadiazole core (Compound 1~4).

Hit compounds exhibited ARE inductivity in luciferase reporter assay. The ARE inductivity from luciferase reporter assay shows the compound 2~4 can dose-dependently induce the ARE response, with much higher potency than the positive compound tBHQ. Compared to tBHQ which showed 5.27-fold induction at 80 µM, the most potent compound 4 significantly increased the level of ARE to 12.41-fold at 40 µM (Figure 4A). To avoid false positive data, we also determined the luminescent signal of the hits themselves using the same experimental condition to luciferase reporter assay. No luminescent signals of the compounds were determined, indicating that the inductivity of the Nrf2-ARE pathway was due to the real activities of the hits. Next we observed the cell toxicity of 2~4 using MTT assay. The three compounds had no obvious anti-proliferative effects on HCT116 cells (Figure S1). Interestingly, compound 4 exhibited a dose-dependently proliferative inductivity, remarkably at a high concentration of 40 µM. This may be attributed to its cell protective effect through the activation of Nrf2 signaling. These observations indicated a potential safety tolerance in the usage of the compounds.

Table 1. The Nrf2 inductivity of the hit compounds in luciferase reporter assay Cpd.

Nrf2 inductivity (µM)a 0.02

0.2

2

20

40

80

160 6



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 64

1

1.18±0.12

1.22±0.10

1.47±0.14

3.31±0.49

4.05±0.49

5.88±0.61

6.00±0.81

2

1.46±0.13

1.83±0.11

3.17±0.55

3.88±0.76

5.96±0.31

5.48±0.65

8.36±0.99

3

1.18±0.10

1.12±0.08

4.48±1.42

5.65±1.29

7.34±0.11

7.67±1.34

11.70±2.75

4

1.09±0.06

1.50±0.01

3.35±0.28

7.61±0.24

12.41±0.54

12.13±0.20

8.73±0.57

tBHQ

1.18±0.08

1.25±0.01

1.24±0.04

1.41±0.07

2.14±0.10

5.27±0.41

8.46±1.37

a

The inductivity of the compound is calculated compared to the blank control, and data are presented as

mean ± SEM of three separate experiments;

Compound 4 upregulates Nrf2-ARE pathway in both gene and protein level. According to above results, the expression of Nrf2 and several phase II enzymes including HO-1 and NQO1 were further determined in the compound 4 treated HCT116 cells. The compound maximized the expression of HO-1 and NQO1 at 4 h and 6 h, respectively, while induction of Nrf2 reached a stable state after 2 h (Figure 3A). Additionally, 4 dose-dependently enhanced the expression of Nrf2 and NQO1 (Figure 3B) after 6 h treating with 4 in the HCT116 cells, these data indicated that compound 4 can induce the expression of Nrf2 and its downstream proteins in the cell-based level. The semi-quantification of the western blot of compound 4 was provided in Figure S2.

Figure 3. (A) Time-dependent expression of HO-1, NQO-1 and Nrf2 affected by the compound 4. After treatment with 4 (10 µM), cell lysates were prepared from HCT116 cells and subjected to Western blot analysis. (B) Dose-dependent expression of NQO-1 and Nrf2 affected by the compound 4. After treatment with 4 for 6 hours, cell lysates were prepared from HCT116 cells and subjected to western blot analysis.

To confirm the above results, we further measured the transcription of Nrf2 and antioxidant genes GCLM, HO-1 and NQO1 using quantitative RT-PCR (qRT-PCR). 7


Page 25 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For the time-course studies, we determined the expression of these genes at 0, 1, 2, 4, 6, 16, 24 h after treated with 10 µM of 4 in HCT116 cells. The compound significantly increased the Nrf2 expression in a time-dependent manner (Figure 4A), with about 5-fold increase at 4 h. It also remarkably induced the expression of GCLM, HO-1 with the maximum capacity at 6 h (about 2.5-fold and 2.4-fold respectively). But in the case of NQO1, 4 did not show obvious inductivity, with only about 1.5-fold at all the time-points. It was partly because that the constitutive expression of NQO1 in HCT116 cells was at a high level. The gene expression of Nrf2, GCLM and NQO1 were measured at 4 h after treatment with various concentrations (0, 1, 5, 10, 20, 40 µM) of compound 4 in HCT116 cells (Figure 4B). The compound significantly increased the Nrf2, GCLM, HO-1 gene expression in a dose-dependent manner, with about 3.4-fold, 3.8-fold and 7.0-fold increase in the expression at the highest concentration, respectively. While for NQO1, the induction fold was not so remarkable, with only about 2.0-fold at the concentration of 40 µM. These data were in accordance with the protein expression level of NQO1.

Figure 4. (A) Time-dependent increase in Nrf2 and Nrf2-regulated genes after treatment with compound 4. HCT116 cells were treated with compound 4 (10 µM) at various time points. Nrf2,HO-1， GCLM and NQO1 were determined using β-actin as loading control. Values shown are mean ± SD (n = 3). (B) Expression of Nrf2-regulated genes after treatment with compound 4. HCT116 cells were treated with 4 under the indicated concentrations at 4 h. Nrf2, HO-1，GCLM and NQO1 were determined using β-actin as loading control. Values shown are mean ± SD (n = 3).

2. Preliminary SAR of derivatives containing 1, 2, 4-oxadiazole core. 8



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 64

Design and synthesis of the derivatives. Considering that compound 4 exhibited the most potent inductivity in the initial hits from VS, we next selected this compound as the starting point for SAR study. Firstly, the indole ring A was firstly converted into other aromatic rings such as naphthalene (5) and benzene (6) to evaluate whether this group was important for the ARE inductivity. Secondly, the function of methyl groups on benzo[d]imidazole ring C of 4 was analyzed by removing it, resulting in compound 7 and 8. Finally, ring A of compound 4 was replaced by various substituted phenyl groups and other aromatic rings, leading to target compounds 9~41. Derivatives were synthesized using the route summarized in scheme 1. Briefly, 1H-benzo[d]imidazole-5-carbonitrile (43) was cyclized from 3,4-diaminobenzonitrile (42) refluxed in formic acid with a high yield (94%). The nitrile group of 43 was reacted with H2NOH·HCl and converted into (Z)-hydroxylcarboximidamide (44) in ethanol with a yield of 50%. Target compounds 7-37 were obtained through the cyclization reaction of 44 with varied substituted benzoic acid in DMF under the condition of 110 °C. Compound 38~41 were synthesized from 44 cyclized with 2-naphthoic acid, picolinic acid or quinoline-2-carboxylic acid, respectively. Methylation of 1H-benzo[d]imidazole using CH3I in DMF resulted in the target compound 5 and 6.

Scheme 1. Synthetic route of the 1, 2, 4-oxadiazole derivatives.

Reagents and conditions: (a) 5N HCl, HCOOH, reflux, 4h, 94%; (b) K2CO3, EtOH, H2NOH·HCl, 9


Page 27 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


reflux, 12h, 50%; (c) CDI, DMF, 110 °C, 12~18 h; (d): DMF, NaOMe, CH3I, rt, 4h.

SAR study. ARE inductivities of all the synthesized derivatives were evaluated by luciferase reporter assay in HepG2-ARE-C8 cells. When the indole (ring A) of compound 4 was replaced by naphthalen-2-yl (5), the ARE inductivity was reduced, especially at a high concentration. But when the indole was substituted by phenyl ring (6), a more potent inductivity was observed, indicating that mono rings with smaller steric effect was preferable at this position. However, the activity of 6 remarkably reduced at high concentrations, which may be attributed to its poor solubility. As a result, we tried to improve the solubility by removing the methyl group at benzo[d]imidazole ring C of 4. The resulted compound 7 did not show obvious activity improvement compared to 4, but compound 8, whose methyl group was removed from 6, exhibited remarkably enhanced inductivity. The result suggested that this methyl group was not the determinant for the activity of this series of compounds. Based on the results, we started further optimization of 8 by introducing various substituted phenyl groups to replace ring A. Compounds with electron-donating group at different positions of the phenyl ring, such as -OCH3 (9~14), -OH (15~17) and -CH3 (27~29), show reduced Nrf2-ARE inductivity more or less. Additionally, the stronger electron-donating ability of the group was, the more poor activity of the compound was, for example, we can see the Nrf2-ARE inductivity of compound -OCH3 (11) ≈ -OH (17) < -CH3 (29). The results indicated that electron donating groups were not preferable. Oppositely, the electron-withdrawing group, such as -NO2 (18~20), -CF3 (24~26), can improve the activity. It was observed that the Nrf2-ARE inductivity was increased accompanied by the electron-withdrawing ability of the substituents. For example, the activity of 20 (-NO2) was better than that of 26 (-CF3). Besides, the substituted position also impacted on the Nrf2-ARE inductivity. Compound with o-substitution was slightly better than p-substitution (e.g. 18 vs 20, 24 vs 26), while m-substitution caused obviously decreased activity (e.g. 19, 25). However, -CN was an exception (21~23), only p-substitution maintained moderate activity, o-substitution and 10



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 64

m-substitution completely led to the loss of the inductivity. We infer that this group may bring some critical penalty when the compound binds to its target, or lead to the mechanical change. Similar manner was also observed in the halogen substituted compounds (30~32). The stronger electron-withdrawing ability of the halogen atom was, the better Nrf2-ARE inductivity of the compound was, for example, the Nrf2-ARE inductivity of compound -F (32) > -Cl (31) > -Br (30). Among these compounds, 32 showed a stable and dose-dependent inductivity of Nrf2-ARE. We propose a hypothesis to explain this phenomenon: the microenvironment of inflammatory condition is prone to contain negative charged contents or materials such as free radical and unsaturated chemical groups. If the electron density of a compound is high, then it may be repulsive by the environment, leading to reduced binding affinity to the target or issue. The scaffold of our compounds is consisted of phenyl and heterocycles, which are electron enriched structure, therefore, electron-donating groups undoubtedly will further enhance the electron density of the compounds, so they are not preferred. Oppositely, the electron-withdrawing groups can help disperse the electron density to the whole skeleton, making the physicochemical property more proper for the inflammatory microenvironment, thus improve the Nrf2-ARE inductivity. To examine the influence of the size of the groups on the activity, -Et (33), -n-propyl (34), -n-butyl (35), -n-pentyl (36), phenyl (37), naphthalen-2-yl (38), pyridine (39, 40), quinoline (41) derivatives were designed and synthesized. The activity of -n-butyl > -n-propyl > -Et indicated that group with large size was preferred, and the best size was four-carbon group, larger size caused decreased activity (e.g. 35 vs 36). However, -CH3 compounds (27~29) showed the different manner, and that could be explained by that inductive effect of methyl played a more important role than size effect in affecting the Nrf2-ARE inductivity. When the substituent was replaced by aromatic rings, the activity decreased more or less. We inferred that the aromatic rings increased the electron density, leading to the repulsion of the compound by inflammatory microenvironment, and that was similar to the conclusion that electron-withdrawing groups enhanced the activity. 11


Page 29 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In summary, the SAR can be described as: 1) For ring C, the -NH- of indole ring is not necessary to be methylated; 2) For ring A, phenyl exhibits more potent Nrf2-ARE inductivity than naphthyl; 3) For the substituents at phenyl ring, electron-donating groups are not preferable to the ARE inductivity, while electron-withdrawing groups can enhance the activity; 4) Halogens with strong electron-withdrawing ability can increase the activity; 5) Flexible alkyl chains are more preferable than rigid aromatic rings, while heterocycles have no more advantages than phenyl ring.

Table 2. The Nrf2 inductivity of all the derivatives in luciferase reporter assay

ARE inductivity in luciferase reporter assay (µM)a,b Cpd.

R1

R2 0.02

0.2

2

20

40

4

-

-

1.09±0.06

1.50±0.01

3.35±0.28

7.61±0.24

12.41±0.54

12.13±0.20

8.73±0.57

5

naphthalen-2-yl

CH3

1.44±0.26

1.40±0.20

1.43±0.25

1.39±0.13

1.45±0.06

1.37±0.18

2.44±0.43

6

phenyl

CH3

2.03±0.51

3.41±0.42

18.20±1.46

17.38±1.39

8.41±0.11

3.33±0.32

1.75±0.14

7

1H-indol-6-yl

H

1.22±0.06

1.50±0.24

1.77±0.29

10.24±1.73

10.96±0.62

11.59±0.36

8.88±1.14

8

phenyl

H

1.49±0.20

4.72±0.26

14.17±2.24

21.42±1.48

23.73±1.80

3.19±0.71

4.46±0.54

9

2-methoxyphenyl

H

1.24±0.08

1.39±0.08

1.62±0.06

5.96±0.30

10.70±0.18

8.46±0.68

5.85±0.15

10

3-methoxyphenyl

H

1.79±0.24

1.95±0.10

3.16±0.56

12.37±1.86

14.42±0.36

12.41±1.12

8.38±1.18

11

4-methoxyphenyl

H

1.43±0.03

2.72±0.27

3.27±0.17

9.84±0.79

13.03±0.17

4.92±0.31

5.52±0.51

12

2,4-dimethoxyphenyl

H

1.25±0.12

1.59±0.21

2.84±0.45

8.57±1.56

11.61±0.22

4.35±0.55

1.46±0.59

13

2,5-dimethoxyphenyl

H

1.70±0.38

2.96±0.11

3.21±0.40

4.48±1.29

4.24±1.24

3.70±0.49

5.20±1.05

14

3,4,5-trimethoxyphenyl

H

1.31±0.10

2.24±0.31

2.41±0.36

3.23±0.12

3.24±0.25

13.94±0.48

22.49±1.72

15

2-hydroxyphenyl

H

1.72±0.01

1.54±0.17

1.53±0.06

2.67±0.21

2.75±0.12

1.34±0.03

1.17±0.10

16

3-hydroxyphenyl

H

1.68±0.17

1.71±0.10

2.44±0.18

8.62±1.30

4.18±0.39

4.05±0.13

3.93±1.08

17

4-hydroxyphenyl

H

1.56±0.18

1.65±0.23

2.19±0.07

6.23±0.43

8.67±1.23

8.81±1.02

7.35±0.71

18

2-nitrophenyl

H

1.73±0.13

3.76±0.44

12.07±1.22

36.61±1.70

53.62±3.26

42.65±3.42

38.35±1.57

19

3-nitrophenyl

H

1.43±0.01

1.56±0.16

4.74±0.27

11.60±0.98

21.83±2.58

16.50±1.33

11.54±1.29

20

4-nitrophenyl

H

1.64±0.06

2.02±0.14

6.59±0.29

15.63±0.28

36.73±0.44

30.62±0.12

38.26±2.25

21

2-cyanophenyl

H

1.36±0.05

1.48±0.21

2.46±1.44

1.33±0.17

1.32±0.05

1.39±0.05

2.09±0.16

22

3-cyanophenyl

H

1.26±0.13

1.36±0.04

1.42±0.11

0.87±0.13

0.91±0.01

3.16±1.40

8.05±2.27

23

4-cyanophenyl

H

1.22±0.03

1.25±0.08

1.35±0.14

8.12±0.88

11.94±1.36

10.04±1.59

12.71±0.82

24

2-(trifluoromethyl)phenyl

H

1.23±0.22

2.28±0.20

9.01±0.61

19.08±1.26

24.24±0.73

17.92±0.76

3.73±0.74

25


H

2.56±0.01

8.04±1.61

13.92±0.23

10.53±1.91

5.65±0.21

3.45±0.21

2.94±0.30

26


H

1.35±0.29

2.85±0.73

6.91±0.26

17.73±1.29

21.63±0.99

6.56±1.67

1.13±0.12

80

160

12



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 64

27

2-methylphenyl

H

1.40±0.06

1.59±0.02

3.52±0.91

10.95±1.32

10.84±0.92

18.47±1.62

7.85±0.35

28

3-methylphenyl

H

1.44±0.11

1.94±0.17

4.84±0.37

14.22±0.23

10.38±0.80

17.28±1.03

8.99±1.57

29

4-methylphenyl

H

2.11±0.12

3.29±0.25

7.78±0.98

20.64±1.46

16.55±1.35

12.74±1.16

9.22±0.61

30

4-bromophenyl

H

1.31±0.23

2.36±0.16

12.67±1.45

13.41±0.72

3.44±1.51

2.75±0.15

2.49±0.16

31

4-chlorophenyl

H

2.03±0.27

2.79±0.28

7.25±1.17

15.49±1.03

18.52±0.98

14.14±0.49

14.25±0.88

32

4-fluorophenyl

H

1.57±0.29

2.49±0.67

10.23±0.66

27.28±1.26

40.81±0.22

44.40±0.89

45.27±0.38

33

4-ethylphenyl

H

1.37±0.12

1.75±0.59

2.56±0.20

9.34±0.57

5.88±0.33

4.82±0.17

3.69±0.08

34

4-n-propylphenyl

H

1.48±0.05

1.73±0.04

2.25±0.20

6.07±0.56

6.16±0.40

7.79±0.29

10.02±0.55

35

4-n-butylphenyl

H

1.55±0.27

2.08±0.25

10.86±0.48

30.80±1.14

37.61±0.88

14.78±0.06

11.99±1.37

36

4-n-amylphenyl

H

1.33±0.13

1.35±0.16

3.42±0.16

11.63±0.92

18.88±1.25

12.78±0.47

14.54±0.55

37

(1,1'-biphenyl)-4-yl

H

1.18±0.16

1.54±0.10

1.52±0.15

2.00±0.06

10.73±0.33

14.98±0.68

11.03±0.75

38

naphthalen-2-yl

H

1.42±0.05

1.23±0.03

3.47±0.36

6.72±0.46

7.57±0.34

13.45±1.03

16.18±0.48

39

pyridin-2-yl

H

1.06±0.04

3.42±0.51

5.09±0.50

9.49±0.45

7.51±0.30

2.65±0.22

2.55±0.12

40

pyridin-4-yl

H

1.91±0.15

2.54±0.10

4.27±0.55

4.36±0.75

4.95±0.77

5.99±1.62

10.63±0.28

41

quinolin-2-yl

H

1.61±0.11

2.04±0.16

4.35±0.65

20.54±2.21

16.95±0.29

6.61±0.64

7.09±1.37

dimethyl fumarate (DMF)

0.82 ±0.04

1.00 ± 0.07

1.10 ± 0.08

1.65 ± 0.35

2.97 ± 0.45

ND

ND

tBHQ

1.18±0.08

1.25±0.01

1.24±0.04

1.41±0.07

2.14±0.10

5.27±0.41

8.46±1.37

a

The inductivity of the compound is calculated compared to the blank control, and data are presented as

mean ± SEM of three separate experiments. b

All the compounds did not show any antiproliferative effect at the concentration of 80 µM.

Physicochemical properties of the active compounds. In an effort to identify potential druglike compounds prior to the time-consuming and costly development and optimization of analogues that may ultimately fail in in vivo efficacy experiments, next we determined the physicochemical properties of several compounds which exhibited potent ARE inductivities in luciferase reporter assay. pKa, LogD7.4 and intrinsic aqueous solubility were determined on a Gemini Profiler instrument (pION) by the “goldstandard” Avdeef-Bucher potentiometric titration method.23 Permeability coefficients were determined using a standard parallel artificial membrane permeability assay (PAMPA) on a PAMPA Explorer instrument (pION). Although 18 and 20 showed the most potent activity in luciferase reporter assay, considering that nitro group had high toxic risk, and the compounds were chemically not stable (they were decomposed in the solution after two weeks), the two compounds were not included in the determination. As shown in table 3, the pKa values for all the selected compounds ranged from 3.25~4.22, 7.41~9.67, while the LogD7.4 and intrinsic aqueous solubility varied 13


Page 31 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


obviously. Compound 8 and 24 showed acceptable LogD7.4 value, but their aqueous solubility were poor, with only 12.30 and 14.00 µM, respectively. Halogen substituted compounds 30~32 exhibited much improved solubility. Compound 32 (F-substituted) showed the best physicochemical properties (LogD7.4 3.37, intrinsic solubility 66.90 µM). Introduction of hydrophobic aliphatic chains (36) or rigid aromatic ring (38) led to reduced solubility. Permeability is also an important property reflecting the ability of molecules to diffuse through the cell membrane. Therefore, we determined the permeability of the derivatives by using PAMPA Explorer instrument. Generally, the Pe values of all compounds were less than that of the positive control compound, propranolol. Among these compounds, 32 displayed the best membrane permeability, with the Pe value of 19.56 × 10−6 cm/s, indicating the compound possessed balanced properties between hydrophilicity and hydrophobicity. Other compounds showed much decreased permeability, for example, the Pe value of 31 was only 10.32 × 10−6 cm/s, about a half that of 32. Taken together, compound 32 had potent ARE inductivity and proper physicochemical property, as a result, it was selected for further pharmacological both in vitro and in vivo.

Table 3. Physicochemical properties of the selected compounds.

a

Cpd.

pKa

LogD, pH 7.4

intrinsic solubility, (µM)

Pe, pH 7.4 (10−6 cm/s)a

8

9.67, 3.69

3.66

12.30

5.26

24

9.60, 4.00

4.01

14.00

4.78

30

8.90, 3.25

3.54

35.40

11.16

31

8.68, 3.77

3.71

49.50

10.32

32

9.46, 3.57

3.37

66.90

19.56

36

8.48, 4.25

3.51

37.50

7.75

38

7.41, 4.22

5.56

2.50

ketoprofen (1.93 × 10

−6

cm/s) and propranolol (116.97 × 10

8.64 −6

cm/s) are internal standards in

permeability determinations.

3. Pharmacological results 14



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 64

The effects of compound 32 on Nrf2-ARE pathway. Considering that when Nrf2 is activated, it needs to translocate into the nucleus to exert its transcriptional function, therefore, we first determined the effect of compound 32 (20 µM) on the phosphorylation and nuclei translocation of Nrf2 in HCT116 cells. Nrf2 and phosphorylated Nrf2 (S40) (P-Nrf2) in cytoplasm and in nucleus were determined using western-blot assay with GAPDH (cytoplasm) and Histone (nucleus) as loading control, respectively (Figure 5). The expression of Nrf2 was remarkably reduced in the cytoplasm after 4 h treating with compound 32, while P-Nrf2 (S40) was obviously upregulated. As the phosphorylation of Nrf2 played an important role in the translocation of Nrf2 into the nucleus, the accumulation of P-Nrf2 (S40) indicated that Nrf2 may translocate into the nucleus. It was then confirmed by determination of Nrf2 and P-Nrf2 (S40) in the nucleus. Results showed that Nrf2 and P-Nrf2 (S40) were both upregulated after 4 h treating with compound 32, in consistence with the reduced manner in cytoplasm.

Figure 5. The effect of compound 32 on the phosphorylation and nuclei translocation of Nrf2. HCT116 cells were treated with compound 32 (20 µM) at various time points. Nrf2, phosphorylated Nrf2 (S40) in cytoplasm (left) and in nucleus (right) were determined using GAPDH (cytoplasm) and Histone (nucleus) as loading control.

To further confirm the nucleus translocation of Nrf2 caused by compound 32, immunofluorescence was applied to visualize the translocation manner. The green staining represents Nrf2, blue staining represents nuclei, and merge represents both (Figure 6). The strong fluorescent light in the nucleus, compared to the control, clearly showed that the Nrf2 entered and concentrated in the nucleus in a 15


Page 33 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


dose-dependent manner. The data further support that compound 32 induced the Nrf2 translocation into the nucleus.

Figure 6. Immunofluorescence staining for Nrf2 and nucleus in HCT116 cells: green staining represents Nrf2, blue staining represents nuclei, and merge represents both. Nrf2 and nuclei was labeled with DyLight 488 and DAPI, respectively. Green: Nrf2; Blue: nuclei. Compound 32 (5 µM and 20 µM, respectively) was added and compared to the control group without treating with 32.

We next examined effects of 32 on the expression of NQO1, HO-1 and GCS in HCT116 cells. The compound maximized the expression of HO-1 and NQO1 at 24 h and 8 h, respectively, while induction of GCS reached a stable state after 1 h (Figure 7A). Additionally, 32 dose-dependently enhanced the expression of NQO1 and HO-1 (Figure 7B) after 8 h in the HCT116 cells, indicating the potent Nrf2-ARE inductivity of compound 32 in cell-based level. The semi-quantification of the western blot of compound 32 was provided in Figure S3. 16



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 64

Figure 7. (A) Time-dependent increase of Nrf2-regulated proteins after treatment with compound 32. HCT116 cells were treated with compound 32 (10 µM) at various time points. HO-1, GCS and NQO1 were determined using β-actin as loading control. (B) Expression of Nrf2-regulated proteins after treatment with compound 32 with different concentrations. HCT116 cells were treated with 32 under the indicated concentrations at 8 h. NQO1, GCS and HO-1 were determined using β-actin as loading control.

Next, we measured the effect of 32 on the expression of Nrf2 as well as GCLM, NQO1 and HO-1, three well characterized transcriptional targets of Nrf2, using quantitative RT-PCR (qRT-PCR). We measured the expression of these genes at 4 h (based on the time-dependent assay shown in Figure S4) after treatment with various concentrations (0.1, 1, 10, 20, 40 µM) of 32 in HCT116 cells. We could observe that 32 upregulated the expression of all these genes except HO-1, which was obviously upregulated only at a high concentration (40 µM). The P value (Figure 8) showed that 32-treated groups were significantly different from the non-treated blank control group. These data were consistent with those determined from western-blot analysis, which could confirm that 32 potently activated Nrf2-ARE pathway.

17


Page 35 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8. Expression of Nrf2 and Nrf2-regulated genes after treatment with compound 32. HCT116 cells were treated with 32 at the indicated concentrations for 4 h. The expression of Nrf2, GCLM, NQO-1 and HO-1 were determined using qRT-PCR. Values shown were mean ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, statistically significant difference from the non-treated blank control group.

To further confirm the potency of compound 32 was mediated by Nrf2, we examined the expression of its transcriptional target genes by knockdown Nrf2 through siRNA. After the interference, the gene level of Nrf2 as well as its target gene NQO1, GCLM and HO-1 sharply decreased (Figure 9). When added compound 32, the expression of these gene was upregulated to a comparable level to the blank control. However, compared to the siRNA non-treated group (Figure 9), the Nrf2-ARE inductivity of 32 was obviously decreased under the same concentration (20 µM). Taken together, these results confirmed that 32 activated Nrf2-ARE pathway through induction of Nrf2 followed by upregulating the expression level of its target 18



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 64

genes.

Figure 9. Expression of Nrf2 and Nrf2-regulated genes after treatment with Nrf2 siRNA and compound 32. HCT116 cells were treated with Nrf2 siRNA (50 nM) or Nrf2 siRNA (50 nM) plus 32 (20 µM) for 8 h. The expression of Nrf2, GCLM, NQO-1 and HO-1 genes were quantified using qRT-PCR. Values shown were mean ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, statistically significant difference from the non-treated blank control group.

In vivo anti-inflammatory activity of compound 32. To test the degree to which compound 32 would reduce LPS-inducible inflammatory cytokines, we pretreated C57BL/6 mice with 32 (low dose 10 mg/kg or high dose 80 mg/kg) and then challenged them with LPS (300 µg IP) 48 h after the last dose of compound.24 Age-matched, untreated control mice received only LPS challenge. Dexamethasone (10 mg/kg) was used as positive control. Sera were collected from all groups 5 h post-LPS challenge. We first evaluated the potential toxicity of 32 by detecting body weight of the mice after 3 days treatment. Dexamethasone was used as the positive control for comparison. LPS challenged group exhibited strong toxicity for the body weight decreased obviously (Figure 10), while compound 32 pretreated group (both low dose and high dose group) as well as the Dexamethasone pretreated group had no negative effects. The body weight of the three groups enhanced slightly after 2 days treatment, 19


Page 37 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


with a similar manner to the control group. The results indicated that the potential toxicity of 32 was very limited.

Figure 10. Body weight of C57BL/6 female mice in different groups (n = 10 mice per group). LPS (300 µg/kg) was used as stimulus and Dexamethasone (10 mg/kg) was used as positive control.

Production of proinflamatory cytokines was a critical marker for inflammation diseases, therefore, we detected the cytokine production level in sera of 32-pretreated, LPS-challenged mice by using Elisa method. We observed that both high dose and low dose of compound 32 had significantly and dose-dependently reduced levels of proinflamatory cytokines, including TNF-α and IFN-γ as well as IL-6, IL-12 and IL-17, relative to LPS challenged mice (Figure 11). Furthermore, 32 had shown more potent inhibitory activity against production of these proinflamatory cytokines except TNF-α at the same concentration than the positive control dexamethasone. In general, cytokine reduction in 32-pretreated, LPS-challenged mice was profound, suggesting the compound possessed promising anti-inflammatory activity in vivo.

20



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 64

Figure 11. Quantification of various inflammatory cytokines including TNF-α, IFN-γ, IL-6, IL-12 and IL-17 in the blood serum of C57BL/6 female mice after treatment of different dosages of 32. LPS (300 µg/kg) was used as stimulus and Dexamethasone (10 mg/kg) was used as positive control. Data were shown in Mean ± SD (n = 10 mice per group), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 indicated the statistically significant difference from the non-treated blank control group.

The morphological change in lung of LPS-challenged mice was evaluated (Figure 12). Compared to the untreated mice (Figure 12A), obvious morphological change were observed in LPS-challenged mice (Figure 12B). LPS caused severe edema, leading to the fuzzy margin in the whole tissue. This phenomenon was reversed after the treatment of Dexamethasone (Figure 12C). For compound 32, both low dose (Figure 12D) and high dose (Figure 12E) remarkably resisted the inflammation caused by LPS. Especially in high dose treated mice, a much clearer margin of the lung was observed, indicating edema was quite alleviated by the treatment of 32. In summary, these results supported the conclusion that 32 was in vivo active in resisting LPS-induced inflammation.

21


Page 39 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 12. Morphological study of the lung of C57BL/6 female mice. Representative pictures of lung from different groups were shown to display the inflammatory effects. (A) Blank control group without treating any stimulus or compounds. (B) Mice challenged with high dose of LPS. (C) Mice treated with Dexamethasone as positive control. (D and E) Mice treated with 10 mg/kg or 80 mg/kg of 32, respectively. LPS (300 µg/kg) was used as stimulus and Dexamethasone (10 mg/kg) was used as positive control.

Next we determined the expression of inflammatory cytokine interleukin 6 (IL-6) in the extractions from the lung tissues of C57BL/6 mice using immunohistochemical staining (Figure 13). IL-6 was stained as brown and the nucleus was blue. Compared to the blank control group (Figure 13A), IL-6 was remarkably upregulated after the stimulation of LPS (Figure 13B, the brown staining). This phenomenon was clearly suppressed by the pretreatment of either dexamethasone (Figure 13C) or compound 32 (Figure 13D and E for low-dose or high-dose of 32, repectively). A dose-dependent manner could be observed for 32 to inhibit the expression of IL-6. High-dose of 32 exhibited even more stronger inhibitory effect than dexamethasone, while low-dose of 22



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 64

32 showed slightly lower effect. The results were in consistence with the determination of cytokine production level in sera.

Figure 13. Immunohistochemical staining of in the IL-6 lung tissue of LPS stimulated C57BL/6 mice. A, the blank control group without LPS stimulation or compound treatment. B, LPS stimulated group. C, Dexamethasone treated group as positive control. D and E, compound 32 treated group with low (10 mg/kg) and high (80 mg/kg) concentration. Brown and blue represent IL-6 and the nucleus respectively.

Finally we evaluated whether the in vivo anti-inflammatory activity of compound 32 was related to its Nrf2 activation. The expression of Nrf2 in the extractions from the lung tissues of C57BL/6 mice was determined using immunofluorescence under laser confocal microscope (Figure 14). Nrf2 was stained as red and the nucleus was blue. Compared to the blank control group, Nrf2 slightly upregulated due to the stimulation of LPS in LPS-single-treated mice, this could be attributed to the self-preservation of C57BL/6 mice. When pretreated with dexamethasone or compound 32 (10 mg/kg for 32-low group and 80 mg/kg for 32-high group), all the groups exhibited remarkably increased level of Nrf2. 32-low group showed comparable level of Nrf2 to that of dexamethasone group, while 32-high group showed even stronger activity than dexamethasone.

23


Page 41 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 14. Immunofluorescence staining for Nrf2 and nucleus in the lung tissue of C57BL/6 mice. Red staining represents Nrf2, blue staining represents nuclei, and merge represents both. In each individual sample, Nrf2 and nuclei were labeled with Rhodamine-labeled rabbit IgG antibody and DAPI, respectively. Dexamethasone (10 mg/kg) was used as positive control. Compound 32-low (10 mg/kg) and 32-high (80 mg/kg) were added and compared to the blank control group without treating with 32.

To further confirm the result, the extractions from the lung tissues of C57BL/6 mice were blotted with the antibodies of Nrf2 and P-Nrf2 (S40) (Figure 15). The data showed that both the proteins were obviously upregulated after the treatment of compound 32 in a dose-dependent manner. These data further confirm that Nrf2 is upregulated due to the inductive activity of compound 32 in vivo.

Figure 15. The effect of compound 32 on the activation of Nrf2 and P-Nrf2 (S40) in the LPS stimulated C57BL/6 mice. The lung tissues were separated from each group of mice (LPS group, control group, low (10 mg/kg) and high (80 mg/kg) concentration of compound 32 treated group) and 24



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 42 of 64

blotted with the antibody of Nrf2 and P-Nrf2 (S40). GAPDH was used as the loading control.

3. Discussion and conclusion It is generally believed that enhancing the Nrf2 inducing response to resist environment stress is a promising strategy for cancer prevention. Additionally, compounds able to induce Nrf2/ARE pathway may have beneficial effects in a number of chronic diseases, including uncontrolled inflammation, diabetes and neurodegenerative diseases. Therefore, it attracts the attention of medicinal chemists to identify potent Nrf2-ARE inducers. With their efforts, various small molecules are revealed to possess potential chemopreventive effects through activating Nrf2 signaling. Some of them have achieved successful clinical trial in treating inflammation related diseases. For example, Tecfidera (dimethyl fumarate, BG-12), which was developed by Biogen Idec, was approved by FDA for the treatment of multiple sclerosis in 2013. To enlarge the scale of Nrf2 activators, we initiated a screening of an in-house compound collection, resulting in the identification of hit compound 4, which can be divided into three parts (ring A, B, C shown in Figure 2). We first determined the function of the methyl group in indole ring C and found it had no effect in ARE inductivity, therefore it was removed from the molecule. Next we paid our attention on ring A. SAR analysis from 37 synthesized derivatives indicated that phenyl exhibits more potent ARE inductivity than naphthyl. Electron-withdrawing substituents groups and halogens can remarkably enhance the activity. Flexible alkyl chains are more preferable than rigid aromatic rings, while heterocycles have no more advantages than phenyl ring. For an ideal lead compound, potent activity is not the only point, good physicochemical properties are also important for its further optimization. Therefore, several derivatives with improved Nrf2 inductivity were selected to determine their physicochemical properties. Compound 32 exhibited good solubility and the best cell permeability among the derivatives, therefore, it was further evaluated for its pharmacological effects. For the in vitro study, we proved that 32 dose-dependently up-regulate expression 25


Page 43 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


level of Nrf2 and its target genes such as NQO1, HO-1 and GCLM in qRT-PCR and western-blot determination. Additionally, Nrf2-ARE induction by 32 was obviously suppressed when Nrf2 was knockdown by siRNA, further confirmed 32 exerted its activity through Nrf2. For the in vivo study, 32 remarkably reduced proinflammtory cytokines in sera including TNF-α, IFN-γ, IL-6, IL-12 and IL-17 without affecting the body weight of C57BL/6 female mice, indicating low toxicity of the compound. The result was consistent with that from MTT assay. Morphological change of lung in LPS-challenged mice was also reversed by 32 with comparable potency to the positive control Dexamethasone. However, there are still several questions about these compounds. For example, which molecular target it affects in regulating Nrf2-ARE pathway? Can the compound exert therapeutic effects in chronic inflammation such as AOM-DSS model? Why electron-withdrawing group on the phenyl ring can improve the activity? These questions need to be answered in further study. In a word, our effort revealed active Nrf2-ARE inducers both in vitro and in vivo with new chemical skeleton. They provided us promising lead compounds and deserve further optimization with the aim to develop potent anti-inflammatory agents.

4.

Experimental Section General Information. All reagents were purchased from commercial sources.

Organic solutions were concentrated in a rotary evaporator (Büchi Rotavapor) below 55 °C under reduced pressure. Reactions were monitored by thin-layer chromatography (TLC) on 0.25 mm silica gel plates (GF254) and visualized under UV light. Melting points were determined with a Melt-Temp II apparatus. IR spectra were recorded on a Nicolet iS10 Avatar FT-IR spectrometer using KBr film. The 1H NMR and 13C NMR spectra were measured on a Bruker AV-300 instrument using deuterated solvents with tetramethylsilane (TMS) as internal standard. ESI-mass and high resolution mass spectra (HRMS) were recorded on a Water Q-Tof micro mass spectrometer. The purity (≥ 95%) of the compounds is verified by the HPLC study performed on Agilent C18 (4.6 mm × 150 mm, 3.5 µm) column using a mixture of 26



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 44 of 64

solvent methanol/water or acetonitrile/water at the flow rate of 0.5 mL/min and peak detection at 254 nm under UV. To avoid potential off-target effects of the screening hits, 1~4 were evaluated that if they belong to pan assay interference compounds (PAINS),25 and no obvious PAINS scaffolds or groups were found in these hits. Synthesis. 1H-benzo[d]imidazole-5-carbonitrile (43). 3,4-diaminobenzonitrile (42, 5.0 g; 37.5 mmol; 1.0 equiv) was dissolved in 5 N aqueous HCl (220.0 mL). After addition of formic acid (20.0 mL), the mixture was heated to reflux for 4 h. After cooling, the mixture was basified by means of aqueous ammonia and stored overnight. The formed precipitate was collected by filtration, washed with water, and used without further purification. Yield: 5.1g (94.0 %). 1H NMR (300 MHz, DMSO) δ 12.47 (s, 1H), 8.34 (s, 1H), 8.03 (s, 1H), 7.62 (d, J = 4.17 Hz, 1H), 7.45 (d, J = 8.34 Hz, 1H). MS m/z: 144.2 [M + H]+. (Z)-N'-hydroxy-1H-benzo[d]imidazole-5-carboximidamide (44). 43 (2.5 g; 17.5 mmol; 1.0 equiv) was dissolved in EtOH (60.0 mL) treated with K2CO3 (4.8 g; 35.0 mmol; 2 equiv) and H2NOH·HCl (2.0 g; 28.8 mmol; 1.6 equiv) and heated to reflux for 12 h. After cooling to room temperature, the mixture was diluted by diethylether. The precipitate was collected by filtration, washed with water, and dried under infrared lamp. The compound was used without further purification. Yield: 1.54 g (50.0 %). 1H NMR (300 MHz, DMSO) δ 13.10 (s, 1H), 10.86 (s, 1H), 8.50 (s, 1H), 8.32 (s, 2H), 8.03 (s, 1H), 7.74 (d, J = 4.23 Hz, 1H), 7.58 (d, J = 4.23 Hz, 1H). MS: 177.3 [M +H]+. 3-(1H-benzo[d]imidazol-6-yl)-5-phenyl-1,2,4-oxadiazole (8). 44 (0.1 g; 0.8 mmol; 1.0 equiv) was dissolved in DMF (3.0 mL) treated with carbonyldiimidazole (0.13 g; 0.8 mmol; 1.0 equiv), and stirred at room temperature for 0.5 h. Then the temperature was increased to 110 °C and stirring was continued for 12~18h. After cooling, the mixture was diluted by means of water and saturated aqueous NaHCO3 solution and extracted with EtOAc (3 × 15 mL). The combined organic layers were dried over Na2SO4 and evaporated. The remains were purified by flash chromatography on silica using a EA gradient. Yield: 0.11 g (46.0 %). White solid; m. p. 234~236 °C. 1H NMR (300 MHz, DMSO) δ 11.51 (s, 1H), 8.36 (s, 1H), 8.21 (d, J = 6.90 Hz, 2H), 7.85 (d, J 27


Page 45 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


= 1.50 Hz, 1H), 7.83~7.67 (m, 3H), 7.57 (d, J = 8.55 Hz, 1H), 7.49 (s, 1H), 6.62 (s, 1H).

13

C NMR (75 MHz, DMSO) δ 175.079, 168.898, 144.107, 133.213, 129.501,

129.501, 127.852, 127.852, 125.347, 120.944, 119.786, 118.396, 112.603, 111.213. IR (cm−1, KBr film): 3414 (−NH), 1610, 1440, 1211, 820, 739. HRMS (ESI): calcd for C15H11N4O [M + H]+ 263.0927, found 263.0929. HPLC (80 % methanol in water): tR = 9.11 min, 96.50 %. Compound 7~37 were synthesized using similar method. 3-(1-methyl-1H-benzo[d]imidazol-6-yl)-5-phenyl-1,2,4-oxadiazole (6). 8 (0.04g, 0.13 mmol, 1.0 equiv) was dissolved in DMF (3.0 mL) treated with NaOMe (0.015g, 0.26 mmol, 2.0 equiv). In an ice-bath, CH3I (0.08g, 0.52 mmol, 4 equiv) was added drop by drop. The mixture was reacted at room temperature for 4 h, then poured to water (20.0 mL) and extracted with EtOAc (3 × 10.0 mL). The combined organic layers were dried over Na2SO4 and evaporated. The remains were purified by flash chromatography on silica using a EA/PE gradient. Yield: 0.006g (15.0 %). Light yellow solid; m. p. 220~221 °C. 1H NMR (300 MHz, DMSO) δ 8.36 (d, J = 6.60 Hz, 2H), 8.23 (d, J = 6.81 Hz, 2H), 8.03 (d, J = 8.22 Hz, 1H), 7.79 (d, J = 8.58 Hz, 1H), 7.75~7.66 (m, 3H), 3.91 (s, 3H). IR (cm−1, KBr film): 1629, 1273, 1099, 1029, 807. HRMS (ESI): calcd for C16H13N4O [M + H]+ 277.1084, found 277.1075. HPLC (80 % methanol in water): tR = 10.37 min, 95.60 %. 3-(1-methyl-1H-benzo[d]imidazol-6-yl)-5-(naphthalen-2-yl)-1,2,4-oxadiazole

(5).

Yield 4.4 %. Light yellow solid; m. p. 220~221 °C. 1H NMR (300 MHz, CDCL3) δ 8.83 (s, 1H), 8.33~8.28 (m, 2H), 8.21 (d, J = 8.31 Hz, 1H), 8.05~8.03 (m, 3H), 7.95 (d, J = 8.52 Hz, 2H), 7.66~7.64 (m, 2H), 3.99 (s, 3H). IR (cm−1, KBr film): 1629, 1262, 1110, 1023, 807. HRMS (ESI): calcd for C20H15N4O [M + H]+ 327.1240, found 327.1248. HPLC (80 % methanol in water): tR = 10.19 min, 95.66 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(1H-indol-6-yl)-1,2,4-oxadiazole (7). Yield 30.8 %. Brown solid; m. p. 249~250 °C. 1H NMR (300 MHz, DMSO) δ 12.79 (s, 1H), 11.68 (s, 1H), 8.45~8.39 (m, 3H), 7.98 (d, J = 0.48 Hz, 1H), 7.81~7.80 (m, 3H), 7.66 (s, 1H), 6.61 (s, 1H). 13C NMR (75 MHz, DMSO) δ 176.527, 168.739, 144.046, 135.339, 131.266, 129.694, 120.946, 118.161, 115.704, 111.850, 101.924. IR (cm−1, KBr film): 28



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 46 of 64

3488, 3416, 1623, 1106, 1083, 805. HRMS (ESI): calcd for C17H12N5O [M + H]+ 302.1036, found 302.1033. HPLC (80 % methanol in water): tR = 6.97 min, 95.57 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(2-methoxyphenyl)-1,2,4-oxadiazole

(9).

Yield

36.1 %. White solid; m. p. 215~217 °C. 1H NMR (300 MHz, DMSO) δ 8.38 (s, 1H), 8.30 (s, 1H), 8.12~8.09 (m, 1H), 7.95-7.92 (m, 1H), 7.78~7.75 (m, 1H), 7.72~7.66 (m, 1H), 7.33 (d, J = 8.37 Hz, 1H), 7.21~7.17 (t, J = 7.29 Hz, 1H), 3.96 (s, 3H). 13C NMR (75 MHz, DMSO) δ 174.696, 168.209, 158.108, 144.066, 134.630, 131.205, 120.778, 119.919, 116.028, 114.709, 112.830, 112.426, 56.051. IR (cm−1, KBr film): 3415 (−NH), 1603, 1380, 1264, 748. HRMS (ESI): calcd for C16H13N4O2 [M + H]+ 293.1033, found 293.1035. HPLC (80 % methanol in water): tR = 6.04 min, 98.17 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(3-methoxyphenyl)-1,2,4-oxadiazole

(10).

Yield

31.2 %. White solid; m. p. 237~239 °C. 1H NMR (300 MHz, DMSO) δ 8.36 (d, J = 11.67 Hz, 2H), 7.93 (d, J = 8.28 Hz, 1H), 7.78 (d, J = 6.87 Hz, 2H), 7.67 (s, 1H), 7.60~7.55 (t, J = 7.95Hz, 1H), 7.31~7.28(m, J = 4.02 Hz, 1H), 3.88 (s, 3H). IR (cm−1, KBr film): 3415 (−NH), 1566, 1381. HRMS (ESI): calcd for C16H13N4O2 [M + H]+ 293.1033, found 293.1033. HPLC (80 % methanol in water): tR = 8.72 min, 99.74 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(4-methoxyphenyl)-1,2,4-oxadiazole

(11).

Yield

21.3 %. White solid; m. p. 202~203 °C. 1H NMR (300 MHz, DMSO) δ 12.76 (s, 1H), 8.46~8.27 (m, 1H), 8.17 (d, J = 8.85 Hz, 2H), 7.95-7.91 (m, 1H), 7.84~7.81 (m, 1H), 7.21 (d, J = 8.88 Hz, 2H), 3.89 (s, 3H). IR (cm−1, KBr film): 3405 (−NH), 1611, 1112, 1011, 820. HRMS (ESI): calcd for C16H13N4O2 [M + H]+ 293.1033, found 293.1033. HPLC (80 % methanol in water): tR = 7.07 min, 99.73 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(2,4-dimethoxyphenyl)-1,2,4-oxadiazole (12). Yield 31.3 %. White solid; m. p. 159~161 °C. 1H NMR (300 MHz, DMSO) δ 12.80 (s, 1H), 8.37 (s, 1H), 8.29 (s, 1H), 8.09 (d, J = 8.64 Hz, 1H), 7.97~7.91 (m, 1H), 7.78~7.71 (m, 1H), 6.81~6.76 (m, 2H), 3.98 (s, 3H), 3.90 (s, 3H). IR (cm−1, KBr film): 3416 (−NH), 1623, 1110, 1023, 807. HRMS (ESI): calcd for C17H15N4O3 [M + H]+ 323.1139, found 323.1143. HPLC (80 % methanol in water): tR = 5.95 min, 97.34 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(2,5-dimethoxyphenyl)-1,2,4-oxadiazole (13). Yield 19.6 %. White solid; m. p. 167~168 °C. 1H NMR (300 MHz, DMSO) δ 12.82 (s, 1H), 29


Page 47 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


8.47 (s, 1H), 8.39 (s, 1H), 7.98~7.94 (m, 1H), 7.81~7.87 (m, 1H), 7.60 (s, 1H), 7.28 (s, 2H), 3.91 (s, 3H), 3.83 (s, 3H). IR (cm−1, KBr film): 3428 (−NH), 1634, 1122, 1023, 796. HRMS (ESI): calcd for C17H15N4O3 [M + H]+ 323.1139, found 323.1143. HPLC (80 % methanol in water): tR = 5.97 min, 98.51 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(3,4,5-trimethoxyphenyl)-1,2,4-oxadiazole

(14).

Yield 23.8 %. White solid; m. p. 158~160 °C. 1H NMR (300 MHz, DMSO) δ 12.75 (s, 1H), 8.39 (s, 1H), 7.99~7.91 (m, 1H), 7.85~7.72 (m, 1H), 7.47 (s, 2H), 3.94 (s, 6H), 3.79 (s, 3H). 13C NMR (75 MHz, DMSO) δ 174.901, 168.889, 153.317, 153.317, 144.096, 141.515, 121.176, 119.786, 118.501, 105.129, 105.129, 60.208, 56.130, 56.130. IR (cm−1, KBr film): 3469 (−NH), 1510, 1122, 1023, 801. HRMS (ESI): calcd for C18H17N4O4 [M + H]+ 353.1244, found 353.1246. HPLC (80 % methanol in water): tR = 16.90 min, 96.80 %. 2-(3-(1H-benzo[d]imidazol-6-yl)-1,2,4-oxadiazol-5-yl)phenol (15). Yield 22.2 %. White solid; m. p. 291~292 °C. 1H NMR (300 MHz, DMSO) δ 12.24 (s, 1H), 8.37 (d, J = 14.67 Hz, 2H), 8.04~8.01 (m, 1H), 7.97~7.94 (m, 1H), 7.78 (d, J = 8.40 Hz, 1H), 7.56~7.51 (m, 1H), 7.14 (d, J = 8.34 Hz, 1H), 7.07~7.02 (m, 1H). IR (cm−1, KBr film): 3415 (−NH), 1629, 1381, 1239, 754. HRMS (ESI): calcd for C15H11N4O2 [M + H]+ 279.0882, found 279.0891. HPLC (80 % methanol in water): tR = 9.33 min, 99.03 %. 3-(3-(1H-benzo[d]imidazol-6-yl)-1,2,4-oxadiazol-5-yl)phenol (16). Yield 20.3 %. White solid; m. p. >300 °C. 1H NMR (300 MHz, DMSO) δ 11.07 (s, 1H), 8.39 (s, 1H), 8.31 (s, 1H), 7.95~7.92 (m, 1H), 7.77 (d, J = 8.49 Hz, 1H), 7.63~7.57 (m, 2H), 7.49~7.43 (m, 1H), 7.12~7.09(m, 1H). IR (cm−1, KBr film): 3567 (-OH), 3415 (−NH), 1618. HRMS (ESI): calcd for C15H11N4O2 [M + H]+ 279.0882, found 279.0889. HPLC (80 % methanol in water): tR = 5.43 min, 99.37 %. 4-(3-(1H-benzo[d]imidazol-6-yl)-1,2,4-oxadiazol-5-yl)phenol (17). Yield 29.4 %. White solid; m. p. >300 °C. 1H NMR (300 MHz, DMSO) δ 12.74 (s, 1H), 10.53 (s, 1H), 8.38~8.27 (m, 2H), 8.06 (d, J = 8.58 Hz, 2H), 7.93 (s, 1H), 7.80~7.68 (m, 1H), 6.99 (d, J = 8.46 Hz). IR (cm−1, KBr film): 3423 (−NH), 3105 (−OH), 1617, 1102, 1019, 809. HRMS (ESI): calcd for C15H11N4O2 [M + H]+ 279.0877, found 279.0873. HPLC (80 % methanol in water): tR = 4.78 min, 96.20 %. 30



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 48 of 64

3-(1H-benzo[d]imidazol-6-yl)-5-(2-nitrophenyl)-1,2,4-oxadiazole (18). Yield 26.7 %. White solid; m. p. 218~220 °C. 1H NMR (300 MHz, DMSO) δ 12.80 (s, 1H), 8.39 (s, 1H), 8.26~8.20 (m, 3H), 8.02~7.99 (m, 2H), 7.93 (d, J = 11.85 Hz, 1H), 7.78 (d, J = 8.61 Hz 1H). 13C NMR (75 MHz, DMSO) δ 172.136, 168.921, 148.220, 155.223, 144.285, 134.172, 133.791, 131.500, 125.274, 124.843, 120.806, 119.070, 117.482. IR (cm−1, KBr film): 3420 (−NH), 1616, 1104, 1023, 807. HRMS (ESI): calcd for C15H10N5O3 [M + H]+ 308.0788, found 308.0789. HPLC (80 % methanol in water): tR = 4.64 min, 96.15 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(3-nitrophenyl)-1,2,4-oxadiazole (19). Yield 24.1 %. White solid; m. p. 246~248 °C. 1H NMR (300 MHz, DMSO) δ 8.85 (s, 1H), 8.62~8.59 (m, 1H), 8.56~8.54 (m, 1H), 8.37~8.34 (m, 2H), 7.99~7.93 (m, 2H), 7.77 (d, J = 8.40 Hz, 1H). IR (cm−1, KBr film): 3415 (−NH), 1620, 1526, 1350, 732. HRMS (ESI): calcd for C15H10N5O3 [M + H]+ 308.0784, found 308.0780. HPLC (80 % methanol in water): tR = 7.48 min, 99.68 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(4-nitrophenyl)-1,2,4-oxadiazole (20). Yield 31.6 %. White solid; m. p. 197~198 °C. 1H NMR (300 MHz, DMSO) δ 12.79 (s, 1H), 8.40 (s, 5H), 8.29 (s, 1H), 7.92 (d, J = 8.07 Hz), 7.75 (d, J = 8.31 Hz). 13C NMR (75 MHz, DMSO) δ 173.430, 169.160, 149.782, 144.182, 129.311, 129.311, 128.688, 124.487, 124.487, 120.765, 119.241, 117.006, 114.689, 111.677.

IR (cm−1, KBr film): 3429

(−NH), 1568, 1102, 1011, 803. HRMS (ESI): calcd for C15H10N5O3 [M + H]+ 308.0778, found 308.0779. HPLC (80 % methanol in water): tR = 6.89 min, 97.96 %. 2-(3-(1H-benzo[d]imidazol-6-yl)-1,2,4-oxadiazol-5-yl)benzonitrile

(21).

Yield

33.7 %. White solid; m. p. 278~279 °C. 1H NMR (300 MHz, DMSO) δ 8.41~8.35 (m, 3H), 8.19~8.17 (m, 1H), 7.96~7.91 (m, 3H), 7.79 (d, J = 8.40 Hz, 1H). IR (cm−1, KBr film): 3415(−NH), 2189 (-CN), 1655, 1383, 750. HRMS (ESI): calcd for C16H10N5O[M + H]+ 288.0885, found 288.0883. HPLC (80 % methanol in water): tR = 5.12 min, 99.19 %. 3-(3-(1H-benzo[d]imidazol-6-yl)-1,2,4-oxadiazol-5-yl)benzonitrile

(22).

Yield

24.6 %. White solid; m. p. 260~261 °C.1H NMR (300 MHz, DMSO) δ 8.62 (s, 1H), 8.50 (d, J = 7.95 Hz, 1H), 8.38 (s, 1H), 8.33 (s, 1H), 8.20 (d, J = 7.77 Hz, 1H), 31


Page 49 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


7.96-7.85 (m, 2H), 7.77(d, J = 8.37 Hz, 1H). IR (cm−1, KBr film): 3420 (−NH), 2208 (-CN), 1382, 1360, 752. HRMS (ESI): calcd for C16H10N5O [M + H]+ 288.0885, found 288.0875. HPLC (80 % methanol in water): tR = 5.79 min, 98.41 %. 4-(3-(1H-benzo[d]imidazol-6-yl)-1,2,4-oxadiazol-5-yl)benzonitrile

(23).

Yield

43.7 %. White solid; m. p. 284~286 °C. 1H NMR (300 MHz, DMSO) δ 8.44~8.35 (m, 4H), 8.12 (d, J = 8.28 Hz, 2H), 7.94 (d, J = 8.13 Hz, 1H), 7.80 (d, J = 11.22 Hz, 1H). 13

C NMR (75 MHz, DMSO) δ 173.571, 169.160, 133.241, 128.857, 128.444, 127.173,

120.426, 117.885, 115.073. IR (cm−1, KBr film): 3414 (−NH), 1618, 1398, 1102. HRMS (ESI): calcd for C16H10N5O[M + H]+ 288.0885, found 288.0891. HPLC (80 % methanol in water): tR = 5.87 min, 96.49 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(2-(trifluoromethyl)phenyl)-1,2,4-oxadiazole

(24).

Yield 12.2 %. White solid; m. p. 173~174 °C. 1H NMR (300 MHz, DMSO) δ 12.80 (s, 1H), 8.40 (s, 1H), 8.32 (s, 1H), 8.24~8.21 (m, 1H), 8.11~8.09 (m, 1H), 7.99~7.95 (m, 3H), 7.81~7.79 (m, 1H). IR (cm−1, KBr film): 3416 (−NH), 1623, 1128, 1110, 766. HRMS (ESI): calcd for C16H10F3N4O [M + H]+ 331.0801, found 331.0801. HPLC (80 % methanol in water): tR = 18.69 min, 98.60 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(3-(trifluoromethyl)phenyl)-1,2,4-oxadiazole

(25).

Yield 25.1 %. White solid; m. p. 226~227 °C.1H NMR (300 MHz, DMSO) δ 8.52~8.45 (m, 2H), 8.37 (d, J = 12.18 Hz, 2H), 8.13 (d, J = 7.77 Hz, 1H), 7.98~7.90 (m, 2H), 7.78 (d, J = 8.40 Hz, 1H). IR (cm−1, KBr film): 3415 (−NH), 1383, 1333, 1121, 757. HRMS (ESI): calcd for C16H10N4OF3 [M + H]+ 331.0807, found 331.0802. HPLC (80 % methanol in water): tR = 11.51 min, 99.46 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(4-(trifluoromethyl)phenyl)-1,2,4-oxadiazole

(26).

Yield 27.9 %. White solid; m. p. 260~261 °C. 1H NMR (300 MHz, DMSO) δ 12.80 (s, 1H), 8.42~8.34 (m, 4H), 8.05~7.97 (m, 3H), 7.80 (s, 1H). 13C NMR (75 MHz, DMSO) δ 173.788, 169.040, 144.120, 132.675, 132.245, 128.660, 128.660, 127.880, 127.639, 127.015, 126.326, 126.326, 126.277, 125.362, 121.747, 120.682. IR (cm−1, KBr film): 3415 (−NH), 1605, 1128, 1012, 821. HRMS (ESI): calcd for C16H10F3N4O [M + H]+ 331.0801, found 331.0799. HPLC (80 % methanol in water): tR =17.78 min, 97.77 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(o-tolyl)-1,2,4-oxadiazole (27). Yield 40.4 %. White 32



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 50 of 64

solid; m. p. 210~212 °C. 1H NMR (300 MHz, DMSO) δ 8.39 (s, 2H), 8.14 (d, J = 6.99 Hz, 1H), 7.96 (d, J = 1.5 Hz, 1H), 7.82 (d, J = 8.28 Hz, 1H), 7.60~7.58 (m, 1H), 7.52-7.47 (m, 2H).

13

C NMR (75 MHz, DMSO) δ 175.534, 168.526, 144.155,

1140.326, 138.504, 132.513, 131.921, 129.783, 126.540, 122.717, 120.734, 119.819, 116.028, 114.807, 21.378. IR (cm−1, KBr film): 3460 (−NH), 1547, 1386, 1346, 741. HRMS (ESI): calcd for C16H13N4O[M + H]+ 277.1084, found 277.1085. HPLC (80 % methanol in water): tR = 10.35 min, 99.05 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(m-tolyl)-1,2,4-oxadiazole (28). Yield 29.4 %. White solid; m. p. 231~233 °C. 1H NMR (300 MHz, DMSO) δ 8.36 (d, J = 17.10 Hz, 2H), 8.02~7.92 (m, 3H), 7.77 (d, J = 8.28 Hz, 1H), 7.53 (s, 2H), 2.57 (s, 3H). IR (cm−1, KBr film): 3415 (−NH), 1570, 1382, 1347, 1230. HRMS (ESI): calcd for C16H13N4O[M + H]+ 277.1089, found 277.1081. HPLC (80%methanol in water): tR = 10.61 min, 99.41 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(p-tolyl)-1,2,4-oxadiazole (29). Yield 36.5 %. Light yellow solid; m. p. 192~194 °C. 1H NMR (300 MHz, DMSO) δ 12.79 (s, 1H), 8.37 (s, 1H), 8.31 (s, 1H), 8.08 (d, J = 8.16 Hz, 2H), 7.94 (d, J = 8.28 Hz, 1H), 7.76 (d, J = 7.89 Hz, 1H), 7.46 (d, J = 8.01 Hz, 2H), 2.42 (s, 3H). 13C NMR (75 MHz, DMSO) δ 179.868, 173.550, 148.813, 148.339, 134.759, 134.759, 132.534, 132.534, 125.523, 125.482, 124.541, 120.723. IR (cm−1, KBr film): 3417 (−NH), 1611, 1112, 1029, 796. HRMS (ESI): calcd for C16H13N4O [M + H]+ 277.1084, found 277.1081. HPLC (80 % methanol in water): tR =8.97 min, 98.40 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(4-bromophenyl)-1,2,4-oxadiazole

(30).

Yield

34.4 %. White solid; m. p. 244~245 °C. 1H NMR (300 MHz, DMSO) δ 12.79 (s, 1H), 8.40 (s, 1H), 8.33 (s, 1H), 8.16 (d, J = 8.52 Hz, 2H), 7.95 (d, J = 8.82 Hz, 1H), 7.90 (d, J = 8.49 Hz, 2H), 7,78 (d, J = 8.04 Hz, 1H). IR (cm−1, KBr film): 3417 (−NH), 1611, 1098, 1029, 799. HRMS (ESI): calcd for C15H10BrN4O [M + H]+ 341.0033, found 341.0023. HPLC (80 % methanol in water): tR = 17.20 min, 98.30 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(4-chlorophenyl)-1,2,4-oxadiazole

(31).

Yield

23.8 %. White solid; m. p. 263~264 °C. 1H NMR (300 MHz, DMSO) δ 12.79 (s, 1H), 8.51~8.48 (m, 2H), 8.22 (d, J = 8.61 Hz, 2H), 8.11~8.09 (m, 1H), 7.94~7.76 (m, 3H). 33


Page 51 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


13

C NMR (75 MHz, DMSO) δ 175.075, 168.899, 145.221, 144.105, 133.199, 129.489,

129.489, 127.845, 127.845, 123.461, 120.853, 119.960, 118.335, 114.496, 112.632, 111.092. IR (cm−1, KBr film): 3435 (−NH), 1611, 1106, 1021, 805. HRMS (ESI): calcd for C15H10ClN4O [M + H]+ 297.0538, found 297.0535. HPLC (80 % methanol in water): tR = 15.44 min, 97.40 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(4-fluorophenyl)-1,2,4-oxadiazole

(32).

Yield

26.2 %. White solid; m. p. 186~187 °C. 1H NMR (300 MHz, DMSO) δ 12.80 (s, 1H), 8.40 (s, 1H), 8.30~8.27 (m, 3H), 7.95 (d, J = 8.22 Hz, 1H), 7.78 (s, 1H), 7.55~7.49 (m, 2H). 13C NMR (125 MHz, DMSO) δ 174.128, 168.867, 164.780 (d, J = 251.13 Hz), 143.950, 130.581 (d, J = 9.25 Hz), 120.731, 120.150, 119.626, 116.609 (d, J = 22.34 Hz), 115.861, 114.816. IR (cm−1, KBr film): 3419 (−NH), 1620, 1095, 1023, 805. HRMS (ESI): calcd for C15H10FN4O [M + H]+ 281.0833, found 281.0843. HPLC (80 % methanol in water): tR = 7.43 min, 98.88 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(4-ethylphenyl)-1,2,4-oxadiazole (33). Yield 30.8 %. White solid; m. p. 231~234 °C. 1H NMR (300 MHz, DMSO) δ 8.38 (s, 1H), 8.32 (s, 1H), 8.13 (d, J = 8.16 Hz, 2H), 7.95 (d, J = 1.41 Hz, 1H), 7.77 (d, J = 8.43 Hz, 1H), 7.52 (d, J = 8.10 Hz, 2H), 2.74 (q, J = 7.56 Hz, 2H), 1.26~1.21 (t, J = 7.56 Hz, 3H). IR (cm−1, KBr film): 3413 (−NH), 1615, 1381, 987, 810. HRMS (ESI): calcd for C17H15N4O [M + H]+ 291.1246, found 291.1252. HPLC (80 % methanol in water): tR = 14.02 min, 99.47 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(4-propylphenyl)-1,2,4-oxadiazole

(34).

Yield

38.6 %. White solid; m. p. 223~225 °C. 1H NMR (300 MHz, DMSO) δ 8.38 (s, 1H), 8.32 (s, 1H), 8.13 (d, J = 8.19 Hz, 2H), 7.96 (d, J = 1.44 Hz, 1H), 7.77 (d, J = 8.34 Hz, 1H), 7.50 (d, J = 8.22 Hz, 2H), 2.71~2.66 (m, 2H), 1.68~1.61 (m, 2H), 0.94~0.89 (t, J = 7.31 Hz, 3H). IR (cm−1, KBr film): 3415 (−NH), 1614, 1380, 961, 756. HRMS (ESI): calcd for C18H17N4O [M + H]+ 305.1402, found 305.1396 . HPLC (80 % methanol in water): tR = 11.20 min, 95.28 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(4-butylphenyl)-1,2,4-oxadiazole (35). Yield 20.0 %. White solid; m. p. 237~238 °C. 1H NMR (300 MHz, DMSO) δ 12.85 (s, 1H), 8.39 (s, 1H), 8.33 (s, 1H), 8.16~8.11 (m, 2H), 7.96 (d, J = 8.31 Hz, 1H), 7.77~7.74 (m, 1H), 34



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 52 of 64

7.50 (d, J = 8.22 Hz, 2H), 2.71 (t, J = 7.62 Hz, 2H), 1.64~1.57 (m, 2H), 1.37~1.32 (m, 2H), 0.92 (t, J = 7.31 Hz, 3H). 13C NMR (75 MHz, DMSO) δ 175.129, 168.812, 148.253, 145.214, 144.064, 129.345, 129.345, 127.831, 125.249, 120.964, 119.954, 119.795, 114.225, 34.780, 32.603, 21.687, 13.662. IR (cm−1, KBr film): 3429 (−NH), 1617, 1098, 1023, 796. HRMS (ESI): calcd for C19H19N4O [M + H]+ 319.1553, found 319.1551. HPLC (80 % methanol in water): tR = 7.38 min, 95.36 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(4-pentylphenyl)-1,2,4-oxadiazole

(36).

Yield

57.2 %. White solid; m. p. 201~203 °C. 1H NMR (300 MHz, DMSO) δ 12.75 (s, 1H), 8.39 (s, 1H), 8.32 (s, 1H), 8.12 (d, J = 8.07 Hz, 2H), 7.95 (d, J = 1.26 Hz, 1H), 7.78 (d, J = 8.43 Hz, 1H), 7.49 (d, J = 8.10 Hz, 2H), 2.71~2.66 (m, 2H), 1.66~1.59 (m, 2H), 1.30~1.29 (m, 4H), 0.88~0.84 (m, J = 6.65 Hz, 3H ). 13C NMR (75 MHz, DMSO) δ 175.138, 168.850, 148.308, 144.248, 129.380, 127.859, 120.980, 120.735, 119.743, 116.129, 114.820, 35.059. 30.797, 30.161, 21.868, 13.834. IR (cm−1, KBr film): 3418 (−NH), 1613, 1416, 1379, 1347. HRMS (ESI): calcd for C20H21N4O [M + H]+ 333.1715, found 333.1723. HPLC (80 % methanol in water): tR = 19.35 min, 96.47 %. 5-([1,1'-biphenyl]-4-yl)-3-(1H-benzo[d]imidazol-6-yl)-1,2,4-oxadiazole (37). Yield 27.2 %. White solid; m. p. 241~242 °C. 1H NMR (300 MHz, DMSO) δ 12.79 (s, 1H), 8.40~8.28 (m, 4H), 7.99 (d, J = 8.37 Hz, 3H), 7.85~7.72 (m, 3H), 7.54 (t, J = 3.54 Hz, 2H), 7.47 (d, J = 7.26 Hz, 1H). IR (cm−1, KBr film): 3405 (−NH), 1614, 1100, 1023, 810. HRMS (ESI): calcd for C21H15N4O [M + H]+ 339.1249, found 339.1249. HPLC (80 % methanol in water): tR = 3.68 min, 95.90 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(naphthalen-2-yl)-1,2,4-oxadiazole

(38).

Yield

29.5 %. White solid; m. p. 238~239 °C. 1H NMR (300 MHz, DMSO) δ 12.79 (s, 1H), 8.90 (s, 1H), 8.39 (s, 2H), 8.25~8.19 (m, 3H), 8.07 (d, J = 7.80 Hz, 1H), 7.99 (d, J = 15.12 Hz, 1H), 7.74~7.67 (m, 3H). 13C NMR (75 MHz, DMSO) δ 175.209, 168.994, 144.128, 134.739, 132.330, 129.78, 129.217, 128.926, 128.926, 128.753, 127.872, 127.383, 123.539, 123.539, 120.714, 119.716, 113.225. IR (cm−1, KBr film): 3115, 1269, 1087, 1023, 805. HRMS (ESI): calcd for C19H13N4O [M + H]+ 313.1084, found 313.1082. HPLC (80 % methanol in water): tR = 20.52 min, 95.87 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(pyridin-2-yl)-1,2,4-oxadiazole (39). Yield 28.6 %. 35


Page 53 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


White solid; m. p. 234~236 °C. 1H NMR (300 MHz, DMSO) δ 12.83 (s, 1H), 8.85 (s, 1H), 8.55~8.44 (m, 3H), 8.29~8.15 (m, 1H), 7.96 (s, 1H), 7.75~7.73 (m, 2H). IR (cm−1, KBr film): 3423 (−NH), 1093, 1023, 807. HRMS (ESI): calcd for C14H10N4O 264.0880, found 264.0877. HPLC (80 % methanol in water): tR = 9.11 min, 96.50 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(pyridin-4-yl)-1,2,4-oxadiazole (40). Yield 14.4 %. White solid; m. p. 249~250 °C. 1H NMR (300MHz, DMSO) δ 12.96 (s, 1H), 8.47 (s, 2H), 8.16 (s, 2H), 7.75 (d, J = 8.25 Hz, 2H), 7.60~7.57 (m, 2H). IR (cm−1, KBr film): 3414, 1104, 1023, 801. HRMS (ESI): calcd for C14H10N5O [M + H]+ 264.0880, found 264.0878. HPLC (80 % methanol in water): tR = 3.81 min, 98.94 %. 3-(1H-benzo[d]imidazol-6-yl)-5-(1H-indol-6-yl)-1,2,4-oxadiazole (41). Yield 19.0 %. White solid; m. p. 213~215 °C. 1H NMR (300 MHz, DMSO) δ 12.81 (s, 1H), 8.73 (d, J = 8.58 Hz, 1H), 8.47~8.42 (m, 3H), 8.27 (d, J = 8.16 Hz, 1H), 8.17 (d, J = 8.13 Hz, 1H), 8.03~7.93 (m, 2H), 7.89~7.79 (m, 2H). 13C NMR (75 MHz, DMSO) δ 174.466, 169.369, 147.193, 144.345, 142.873, 138.274, 131.060, 129.577, 128.899, 128.710, 128.201, 121.640, 120.548, 118.396, 112.835. IR (cm−1, KBr film): 3423 (−NH), 1629, 1110, 1029, 796. HRMS (ESI): calcd for C18H12N5O [M + H]+ 314.1036, found 314.1041. HPLC (80 % methanol in water): tR = 6.77 min, 97.87 %. Pharmacology. Cell culture conditions. HepG2 cells stably transfected with ARE luciferase reporter (HepG2-ARE-C8) were kindly provided by Professor A. N. Tony Kong (Rutgers University, Piscataway, NJ) and Prof. Rong Hu (China Pharmaceutical University). Cells were cultured in DMEM medium (GiBco, USA) with 10% (v/v) fetal bovine serum (FBS, GiBco, USA) in a humidified atmosphere of 5% CO2 and 95% air at 37 °C. HCT116 cells (Cell Bank of Shanghai Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) were cultured in McCoy’s 5A (Sigma-Aldrich, #M4892, USA) supplemented with 10% (v/v) FBS. Compound Dilutions. All compounds were dissolved in DMSO to ten millimoles per liter as a stock solutions and stored at -20℃. Fresh cell-culture medium was used to dilute the stock solutions. MTT analysis. Cytotoxicity was determined by using MTT assay. MTT was 36



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 54 of 64

purchased from Sigma (St. Louis, MO). It was dissolved in phosphate buffered saline (PBS) to a concentration of 5mg/mL as the stock solution and stored at -20 °C. After cells were treated with density gradient of test compounds or DMSO for 24h, 20.0 µL of MTT solution (5mg/mL) was added into each well of 96-well plates for 4 h. Then the solution was removed and 150.0 µL of DMSO was added into each well to dissolve the water-soluble MTT-formazan crystals. The absorbance values（OD value） were recorded at 570 nm by Elx800 Absorbance Microplate Reader (BioTek, Vermont, USA). IC50 = [1-(ODtest-ODblank) / (ODcontrol-ODblank)]*100%. ARE-luciferase activity assay. The experimental procedures were carried out as reported previously.21 HepG2-ARE-C8 cells stably expressing ARE luciferase were seeded onto 96-well plates at a density of 4 × 104 cells / well and incubated overnight before incubation with test compounds. The cells were treated with different concentrations of test compounds, with tBHQ serving as a positive control, with DMSO as a negative control and the luciferase cell culture lysis reagent as a blank. After 12 h of treatment, the medium was removed and 200.0 µL of cold PBS was added into each well. Then the cells were lysed in the luciferase cell culture lysis reagent. After centrifugation, 20.0 µL of the supernatant was used for determining the luciferase activity according to the protocol provided by the manufacturer (Promega, Madison, WI). The luciferase activity was measured by a Luminoskan Ascent (Thermo scientific, USA). The data were obtained in triplicates and expressed as fold induction over control. Inductivity = (RLUtest-RLUblank) / (RLUcontrol-RLUblank) RLU = relative light unit Western Blotting. Anti-NQO1 (sc-271116) antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-β-action (AP0060) and anti-Nrf2 (BS1258) were purchased from Bioworlde (Bioworlde, USA). Anti-HO-1 (#5853S) were bought from Cell Signaling Technology (USA). γ-GCS (sc-22755) antibodies were from Santa Cruz Biotechnology (USA). Rabbit polyclonal phospho-Nrf2 (Ser40) (ab76026) was obtained from Abcam (Cambridge, UK). Anti-GAPDH (#60004-1-1g) 37


Page 55 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mouse polyclonal and anti-Histone H3 rabbit polyclonal (#17168-1-AP) which used as internal reference were bought from Protein tech. Cells were washed once with ice-cold PBS and driven down with 1 mL of 1×trypsin. Cells were centrifuged at 2000 rpm and lysed in 80.0 µL of lysis buffer, which contained 150.0 mM NaCl, 1% NP-40, 50.0 mM Tris-HCl, PH7.5, 1mM NaF, EDTA, DTT, Leu and PMSF for 1 h. Then cells were centrifuged again at 12000 rpm for 20 min at 4 °C. The supernatant was collected, and the protein concentration of the whole cell lysates was determined by the BCA assay with Varioskan flash (Thermo, Waltham, MA) at 562 nm. Samples were stored at -80 °C until use. Nuclear-cytosol extraction kit (KeyGEN, NJ, China) was used to isolate the nuclear and cytosol protein according to the protocol. Then the collected protein was stored at -80 °C until use. The tissues of lung were washed by cold PBS and were milled with 300 µL lysis buffer which was composed of 50 mM TriseHCl, 150 mM NaCl, NP-40, 1 mM EDTA, PMSF, NaF, Leu and DTT for 1 h to obtain total cellular extracts. Then cells centrifuged at 12000 rpm for 20 min at 4 °C and the supernatants were collected. Samples were stored at -80 °C until use. The equal amount of total protein extracts were separated by SDS-PAGE and then were electroblotted onto PVDF membranes (Perkin Elmer, Northwalk, CT, USA). After blocking with 1% BSA for 1 h, membranes were incubated at 37 °C for 1 h and then at 4 °C overnight with a primary antibody. After that, they were treated with a DyLight 800 labeled secondary antibody at 37 °C for 1 h. The membranes were screened through the odyssey infrared imaging System (LI-COR, Lincoln, Nebraska, USA). RNA Extraction and Gene Expression Analysis. Total RNA of HCT116 cells was isolated using TRIzol (Invitrogen). Quantification and purity of RNA samples were assessed by A260 / A280 absorption, and RNA samples with ratios above 1.8 were stored at -80 °C for further analysis. The RNA was reversely transcripted by using PrimeScrptTM RT reagent kit following the manufacturer’s instructions. The following sequence

of

primers

were

used

for

Nrf2

sense

primer:5’38



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

AACCACCCTGAAAGCACGC-3’and

Page 56 of 64

antisense

5’-TGAAATGCCGGAGTCAGAATC-3’,

HO-1

primer: sense

5’-ATGGCCTCCCTGTACCACATC-3’,and

antisense

TGTTGCGCTCAATCTCCTCCT-3’,

NQO-1

primer: primer:5’sense

primer:5’-CGCAGACCTTGTGATATTCCAG-3’and

Antisense

primer:5’-CGTTTCTTCCATCCTTCCAGG-3’,GCLM-1

sense

primer:5’-TTGGAGTTGCACAGCTGGATTC-3’and

antisense

primer:

5’-TGGTTTTACCTGTGCCCACTG-3’.The β-actin was used as internal controls, sense

primer:5’-CCCTAAGGCCAACCGTGAA-3’

primer:5’-CCGCTCATTGCCGATAGTGA-3’.

Quantitative

and

antisense

real-time

RT-PCR

analysis of Nrf2, NQO1, HO-1, and GCLM were performed by using a 7500 Fast Real Time PCR system (Applied Biosystems). The values are expressed as fold of the control. Each cycle consisted of denaturation at 95 ºC for 5 sec and combined annealing and extension at 60 ºC for 30 sec. A total of 40 cycles were performed. qRT-PCR. RNA Extraction and Gene Expression Analysis are evaluated by qRT-PCR. Total RNA was isolated using TRIzol (Invitrogen). Quantitative real-time RT-PCR analyses of Nrf2 (Sense primer: AACCACCCTGAAAGCACGC Antisense primer:

TGAAATGCCGGAGTCAGAATC),

CGCAGACCTTGTGATATTCCAG HO-1

ATGGCCTCCCTGTACCACATC ),

and

(Sense

GCLM

primer: primer:

(Sense

Antisense were

performed

by

primer: primer:

Antisense

TTGGAGTTGCACAGCTGGATTC TGGTTTTACCTGTGCCCACTG)

(Sense

Antisense

CGTTTCTTCCATCCTTCCAGG),

TGTTGCGCTCAATCTCCTCCT

NQO1

primer: primer:

using

a

STEPONE

SYSTERM Fast Real Time PCR system (Applied Biosystems). β-Actin was used for normalization. The values are expressed as fold of the control. Transfection of small interfering RNA (siRNA). Predesigned siRNA against human Nrf2 (Catalog No. 115762) and control scrambled siRNA (Catalog No. 4611) were purchased from Biomics (Biomics, China). HCT116 cells were plated at a density of 7 * 105 cells per 60-mm dish. Cells were transfected with 100 nM siRNA against Nrf2 39


Page 57 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


by using LipofectAMINE 2000 (Invitrogen). After 24 h incubation, fresh medium was added and the cells were cultured for another 48 h. The cells were then treated with 20.0 µM or 10.0 µM compound 32 for an additional 6 h and lysed for qRT-PCR. Immunofluorescence of HCT116 cells. HCT116 cells were grown on coverslips for 24 h and then they were treated with compound of different concentration for 12 h. Cells were then fixed and probed with Nrf2 antibody. DyLight 488 labeled anti-rabbit IgG antibody (Santa Cruz Biotechnology, Santa Cruz, CA) ， then stained with fluorochrome dye DAPI (Santa Cruz Biotechnology, Santa Cruz, CA) to visualize the nuclei and observed under a laser scanning confocal microscope (Olympus Fluoview FV1000, Japan) with a peak excitation wave length of 570 nm and 340 nm. LPS-challenged mice acute inflammation model. Animal studies were conducted according to protocols approved by Institutional Animal Care and Use Committee of China Pharmaceutical University. All animals were appropriately used on a scientifically valid and ethical manner. Female C57BL/6 mice (12~16 weeks) were divided into 5 groups (n = 10) in random: control group, dexamethasone (Sigma-Aldrich, St. Louis #D4902) group (10 mg/kg/day), LPS (Sigma-Aldrich, St. Louis #L4130) group (300 µg/kg/day), compound 32 low-dose (10 mg/kg/day) group and compound 32 high-dose (80 mg/kg/day) group. Compound 32 pretreated animals received a single IP injection (500.0 µL) containing desired dose of compound 32 (day -3; -2; -1). All LPS-challenged mice (blank control, dexamethasone pretreated, compound 32 pretreated) received 300.0 µg IP LPS 24 h after the last dose of dexamethasone, compound 32, respectively (day0). Organs and sera from LPS-challenged groups were collected 5 h post-LPS challenge on day 0. Individual serum samples (n = 10) were placed immediately on ice after collection and were centrifuged at 12000 g before plasma was obtained and frozen at -20 ºC for ELISA test. Plasma were assayed for murine IL-6 (EK0411, IL-6 (m) ELISA kit 1200, Boster, China), IFN-γ (EK0375, IFNγ (m) ELISA kit 1000, Boster, China), IL-17 (EK0431, IL-17 (m) ELISA kit 1200, Boster, China) and IL-12 (EK0422, IL-12 (P70) (m) ELISA kit 1200, Boster, China) using double-sandwich ELISA techniques as previously described.26 40



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 58 of 64

Immunofluorescence of lung tissue of C57BL/6 mice. Four-micron thick sections were washed in 10 % PBS for 15 min, then incubated at 4 °C overnight with Nrf2 primary antibodies (abcam, Cambridge, UK). After washed with PBS, tissues were incubated at 37 °C for 1 h with Rhodamine-labeled secondary sheep anti-rabbit IgG antibody (BOSTER, WH, China), then stained with fluorochrome dye DAPI (Santa Cruz Biotechnology, Santa Cruz, CA) to visualize the nuclei and observed under a laser scanning confocal microscope (Olympus Fluoview FV1000, Japan) with a peak excitation wave length of 570 nm and 340 nm. Immunohistochemistry of lung tissue of C57BL/6 mice. Tissues were prepared from formalin-fixed, paraffin-embedded lung tissue. Stains against IL-6 (R & D system, USA) were performed according to the kit protocol (KeyGEN, NJ, China). Briefly, the slides were deparaffinized. Antigen unmasking was carried out by incubation in 100 °C water bath in 10 mM sodium citrate buffer with 0.1% Tween 20 for 20 min. Slides were incubated with primary antibodies in PBS containing 5% BSA and 10 % goat serum. Biotinylated secondary anti-rabbit antibodies were added and incubated at room temperature for 30 min. Streptavidin-HRP was added, and after 40 min the sections werestained with DAB substrate and counterstained with hematoxylin. Statistical analysis. All results are given as mean ± SD performed in parallel experiments for triplicate. P-values less than 0.05 (p < 0.05) were considered statistically significant. They were undertaken using the GraphPad Prism software (GraphPad Software Inc., Avenida, CA). The 2-tailed, unpaired t-tests were used to test for significant differences between individual means and the one-way ANOVA was used to measure for significant differences across means. Computational calculations. 2D and 3D similarity screening. Hits with similar 2D molecular fingerprints to compound 1 were screened using “Find Similar Molecules by Fingerprints” module in Discovery Studio 3.0 (DS) package. 2D molecular fingerprint FCFC_6 method was applied for the virtual screening of Chemdiv collection (699674 compounds). The tanimoto coefficient was set as 0.7 and other parameters were set as default. 37104 hits were screened out and saved for further 3D similarity searching. Multiple conformations of the hits from 2D searching were 41


Page 59 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


generated by “Build 3D database” module in DS (Number of Conformation = 255, Conformation Method = Best, other parameters were as default). “Create Pharmacophores Manually” module of DS was applied to generate molecular shape model of compound 1, which was used to perform 3D similarity searching by “Search 3D database” module DS (Search Method = best, other parameters were as default). The best 50 hits were output for the manual selection. 12 hits with purity over 95.0 % were retained and purchased from Topscience (http://www.tsbiochem.com/). The structural data of the most potent hit 4, which was the starting point for SAR study, was given as follow, while the data of other three active hits 1~3 were provided in supporting information. 5-(1H-indol-6-yl)-3-(1-methyl-1H-benzo[d]imidazol-6-yl)-1,2,4-oxadiazole (4). m. p. 168~170 °C. Brown solid. 1H NMR (300 MHz, DMSO) δ 11.65 (s, 1H), 8.31~8.16 (m, 3H), 8.03~7.95 (m, 1H), 7.88~7.72 (m, 3H), 7.56 (s, 1H), 6.57 (s, 1H), 3.87 (s, 3H).

13

C NMR (75 MHz, DMSO) δ 176.605, 168.661, 135.329, 131.262, 129.686,

121.220, 120.935, 120.439, 118.396, 118.156, 115.689, 115.635, 111.843, 111.141, 101.922, 30.878. IR (cm−1, KBr film): 3413 (−NH), 1618, 1261, 1097, 800. HRMS (ESI): calcd for C18H14N5O [M + H]+ 316.1198, found 316.1206. HPLC (80 % methanol in water): tR = 4.22 min, 95.88%.

ACKNOWLEDGMENT This work is supported by the project 81230078 (key program), 81202463 (youth foundation), 81173087 and 91129732 of National Natural Science Foundation of China,

2014ZX09507002-005-015,

2013ZX09402102-001-005

and

2010ZX09401-401 of the National Major Science and Technology Project of China (Innovation and Development of New Drugs), Specialized Research Fund for the Doctoral Program of Higher Education (SRFDP, 20130096110002).

ABBREVIATIONS Keap1, Kelch-like ECH-associated protein-1; Nrf2, nuclear factor erythroid 2-related factor 2; ARE, antioxidant response element; PPI, protein-protein interaction; 42



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 60 of 64

NQO1, NAD(P)H/quinone oxidoreductase; HO-1, heme oxygenase-1; GCLM, glutamate-cysteine ligase modifier subunit; GPx, glutathione peroxidase; GSTs, glutathione S-transferases; CDDO-Me, Bardoxolone methyl; SFN, sulforaphane; CAPE, caffeic acid phenethyl ester; VS, virtual screening; SAR, structure-activity relationship; LPS, lipopolysaccharide; DS, discovery studio; PAINS, pan assay interference compounds.

SUPPORTING INFORMATION 1

H NMR,

screening

13

C NMR spectra for representative synthetic compounds and active

hits,

data

of

time-dependent RT-PCR

data

of

compound

32,

Semi-quantification of the western plot of compound 4 and 32, luciferase reporter assay and 3D shape-based similarity of the screening hits are provided in supporting information.

REFERENCES (1) Jaramillo, M. C.; Zhang, D. D. The emerging role of the Nrf2-Keap1 signaling pathway in cancer. Genes Dev. 2013, 27, 2179-2191. (2) DeNicola, G. M.; Karreth, F. A.; Humpton, T. J.; Gopinathan, A.; Wei, C.; Frese, K.; Mangal, D.; Yu, K. H.; Yeo, C. J.; Calhoun, E. S.; Scrimieri, F.; Winter, J. M.; Hruban, R. H.; Iacobuzio-Donahue, C.; Kern, S. E.; Blair, I. A.; Tuveson, D. A. Oncogene-induced Nrf2 transcription promotes ROS detoxification and tumorigenesis. Nature 2011, 475, 106-109. (3) Limonciel, A.; Jennings, P. A review of the evidence that ochratoxin A is an Nrf2 inhibitor: implications for nephrotoxicity and renal carcinogenicity. Toxins 2014, 6, 371-379. (4) Lau, A.; Tian, W.; Whitman, S. A.; Zhang, D. D. The predicted molecular weight of Nrf2: it is what it is not. Antioxid. Redox Signal. 2013, 18, 91-93. (5) Wilson, A. J.; Kerns, J. K.; Callahan, J. F.; Moody, C. J.

Keap calm, and carry on

covalently. J. Med. Chem. 2013, 56, 7463-7476. (6) Kensler, T. W.; Wakabayashi, N.; Biswal, S. Cell survival responses to 43


Page 61 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


environmental stresses via the Keap1-Nrf2-ARE pathway. Annu. Rev. Pharmacol. Toxicol. 2007, 47, 89-116. (7) Suzuki, T.; Motohashi, H.; Yamamoto, M. Toward clinical application of the Keap1-Nrf2 pathway. Trends Pharmacol. Sci. 2013, 34, 340-346. (8) Sporn, M. B.; Liby, K. T. NRF2 and cancer: the good, the bad and the importance of context. Nat. Rev. Cancer 2012, 12, 564-571. (9) Oktem, F.; Yilmaz, H. R.; Ozguner, F.; Olgar, S.; Ayata, A.; Uzare, E.; Uz, E. Methotrexate-induced renal oxidative stress in rats: the role of a novel antioxidant caffeic acid phenethyl ester. Toxicol. Ind. Health 2006, 22, 241-247. (10) Schmidt, T. J.; Ak, M.; Mrowietz, U. Reactivity of dimethyl fumarate and methylhydrogen fumarate towards glutathione and N-acetyl-L-cysteine--preparation of S-substituted thiosuccinic acid esters. Bioorg. Med. Chem. 2007, 15, 333-342. (11) Kaidery, N. A.; Banerjee, R.; Yang, L.; Smirnova, N. A.; Hushpulian, D. M.; Liby, K. T.; Williams, C. R.; Yamamoto, M.; Kensler, T. W.; Ratan, R. R.; Sporn, M. B.; Beal, M. F.; Gazaryan, I. G.; Thomas, B. Targeting Nrf2-mediated gene transcription by extremely potent synthetic triterpenoids attenuate dopaminergic neurotoxicity in the MPTP mouse model of Parkinson's disease. Antioxid. Redox Signal. 2013, 18, 139-157. (12) Takaya, K.; Suzuki, T.; Motohashi, H.; Onodera, K.; Satomi, S.; Kensler, T. W. ; Yamamoto, M. Validation of the multiple sensor mechanism of the Keap1-Nrf2 system. Free Radic. Biol. Med. 2012, 53, 817-827. (13) Wu, J.; Li, Q.; Wang, X.; Yu, S. ; Li, L.; Wu, X.; Chen, Y. ; Zhao, J. ; Zhao, Y. Neuroprotection by curcumin in ischemic brain injury involves the Akt/Nrf2 pathway. PLoS ONE 2013, 8, e59843. (14) Zhang, C.; Su, Z. Y.; Khor, T. O.; Shu, L.; Kong, A. N. Sulforaphane enhances Nrf2 expression in prostate cancer TRAMP C1 cells through epigenetic regulation. Biochem. Pharmacol. 2013, 85, 1398-1404. (15) Kumar, V.; Kumar, v; Hassan, M.; Wu, H.; Thimmulappa, R. K.; Kumar, A.; Sharma, S. K.; Parmar, V. S.; Biswal, S.; Malhotra, S.V. Novel chalcone derivatives as potent Nrf2 activators in mice and human lung epithelial cells. J. Med. Chem. 2011, 44



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 62 of 64

54, 4147-4159. (16) Hao, E.; Lang, F.; Chen, Y.; Zhang, H.; Cong, X.; Shen, X.; Su, G. Resveratrol alleviates endotoxin-induced myocardial toxicity via the Nrf2 transcription factor. PLoS One 2013, 8, e69452. (17) Kim, H.; Kim, W.; Yum, S.; Hong, S.; Oh, J. E.; Lee, J. W.; Kwak, M. K.; Park, E. J.; Na, D. H.; Jung, Y. Caffeic acid phenethyl ester activation of Nrf2 pathway is enhanced under oxidative state: structural analysis and potential as a pathologically targeted therapeutic agent in treatment of colonic inflammation. Free Radic. Biol. Med. 2013, 65, 552-562. (18) Steel, R.; Cowan, J.; Payerne, v.; O'Connell, M. A.; Searcey, M. Anti-inflammatory Effect of a Cell-Penetrating Peptide Targeting the Nrf2/Keap1 Interaction. ACS Med. Chem. Lett. 2012, 3, 407-410. (19) Marcotte, D.; Zeng, W.; Hus, J. C.; McKenzie, A.; Hession, C.; Jin, P.; Bergeron, C.; Lugovskoy, A.; Enyedy, I.; Cuervo, H.; Wang, D.; Atmanene, C.; Roecklin, D.; Vecchi, M.; Vivat, V.; Kraemer, J.; Winkler, D.; Hong, V.; Chao, J.; Lukashev, M.; Silvian, L. Small molecules inhibit the interaction of Nrf2 and the Keap1 Kelch domain through a non-covalent mechanism. Bioorg. Med. Chem. 2013, 21, 4011-4019. (20) Hu, L.; Magesh, S.; Chen, L.; Wang, L.; Lewis, T. A.; Chen, Y.; Khodier, C.; Inoyama, D.; Beamer, L. J.; Emge, T. J.; Shen, J.; Kerrigan, J. E.; Kong, A. N.; Dandapani, S.; Palmer, M.; Schreiber, S. L.; Munoz, B. Discovery of a small-molecule inhibitor and cellular probe of Keap1-Nrf2 protein-protein interaction. Bioorg. Med. Chem. Lett. 2013, 23, 3039-3043. (21) Xi, M. Y.; Jia, J. M.; Sun, H. P.; Sun, Z. Y.; Jiang, J. W.; Wang, Y. J. ; Zhang, M. Y.; Zhu, J. F.; Xu, L. L.; Jiang, Z. Y.; Xue, X.; Ye, M.; Yang, X.; Gao, Y.; Tao, L.; Guo, X. K.; Xu, X. L.; Guo, Q. L.; Zhang, X. J.; Hu, R.; You, Q. D. 3-aroylmethylene-2,3,6,7-tetrahydro-1H-pyrazino[2,1-a]isoquinolin-4(11bH)-ones as potent Nrf2/ARE inducers in human cancer cells and AOM-DSS treated mice.

J.

Med. Chem. 2013, 56, 7925-7938. (22) Jiang, Z. Y.; Lu, M. C.; Xu, L. L.; Yang, T. T.; Xi, M. Y.; Xu, X. L.; Guo, X. K. ; 45


Page 63 of 64

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Zhang, X. J.; You, Q. D.; Sun, H. P. Discovery of Potent Keap1-Nrf2 Protein-Protein Interaction Inhibitor Based on Molecular Binding Determinants Analysis. J. Med. Chem. 2014, 57, 2736-2745. (23) Inoyama, D.; Chen, Y.; Huang, X.; Beamer, L. J.; Kong, A. N.; Hu, L. Optimization of fluorescently labeled Nrf2 peptide probes and the development of a fluorescence polarization assay for the discovery of inhibitors of Keap1-Nrf2 interaction. J. Biomol. Screen. 2012, 17, 435-447. (24) Avdeef, A.; Bucher, J. J. Accurate measurements of the concentration of hydrogen ions with a glass electrode: Calibrations using the Prideaux and other universal buffer solutions and a computer-controlled automatic titrator. Anal. Chem. 1987, 50, 2137-2142. (25) Baell, J. B.; Holloway, G. A. New substructure filters for removal of Pan Assay Interference Compounds (PAINS) from screening libraries and for their exclusion in bioassays. J. Med. Chem. 2010, 53, 2719-2740. (26) Auletta, J. J.; Alabran, J. L.; Kim, B. G ; Meyer, C. J. Letterio, J. J. The Synthetic Triterpenoid, CDDO-Me, Modulates the Proinfl ammatory Response to In Vivo Lipopolysaccharide Challenge. J .Interferon Cytokine Res. 2009, 30, 497-508.

46



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 64 of 64

Table of Contents Graphic

47


Discovery and Modification of in Vivo Active Nrf2 Activators with 1,2,4

Recommend Documents