DNA Nanostructure Sequence-Dependent Binding ... - ACS Publications

Subscriber access provided by University of Colorado Boulder

Article

DNA nanostructure sequence-dependent binding of organophosphates Yingning Gao, Samson Or, Aaron Toop, and Ian Wheeldon Langmuir, Just Accepted Manuscript • DOI: 10.1021/acs.langmuir.6b03131 • Publication Date (Web): 06 Feb 2017 Downloaded from http://pubs.acs.org on February 8, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Langmuir is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

DNA nanostructure sequence-dependent binding of organophosphates. Yingning Gao, Samson Or, Aaron Toop and Ian Wheeldon* The Department of Chemical and Environmental Engineering, University of California, Riverside, California 92521, United States

ABSTRACT

Understanding the molecular interactions between small molecules and double stranded DNA has important implications on the design and development of DNA and DNA-protein nanomaterials. Such materials can be assembled into a vast array of 1-, 2-, and 3D structures that contain a range of chemical and physical features where small molecules can bind via intercalation, groove binding, and electrostatics. In this work, we use a series of simulationguided binding assays and spectroscopy techniques to investigate the binding of selected organophosphtates, methyl parathion, paraoxon, their common enzyme hydrolysis product pnitrophenol, and double stranded DNA fragments and DNA DX tiles, a basic building block of DNA-based materials. Docking simulations suggested that the binding strength of each compound was DNA sequence-dependent, with dissociation constants in the micromolar range. Microscalethermophoresis and fluorescence binding assays confirmed sequence dependent binding and that paraoxon bound to DNA with Kd’s between ~10 and 300 µM, while methyl

ACS Paragon Plus Environment

1

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 31

parathion bound with Kd’s between ~10 and 100 µM. p-nitrophenol also bound to DNA but with affinities up to 650 µM. Changes in biding affinity were due to changes in binding mode as revealed by circular dichroism spectroscopy. Based on these results, two DNA DX tiles were constructed and analyzed, revealing tighter binding to the studied compounds. Taken together, the results presented here add to our fundamental understanding of the molecular interactions of these compounds with biological materials and opens new possibilities in DNA-based sensors, DNA-based matrices for organophosphate extraction, and enzyme-DNA technologies for organophosphate hydrolysis.

INTRODUCTION The design of rigid, hybridized DNA structures and DNA-nanoparticle interactions have enabled materials technologies with precise control over molecular-level features.1 The double crossover DNA tile (DX tile) and its derivatives along with single-stranded DNA folding strategies such as DNA origami and DNA bricks have been used to create a wide range of new functional materials including optically active metamaterials,2-3 spatially controlled protein and enzyme nanostructures,4-7 dynamic and self-assembling structures,8-9 and active drug delivery systems,10 among others. The success of these materials stems from programmable assembly through Watson-Crick base-pairing and the predictable structure of double helix DNA. Accompanying these characteristics are complex chemical and physical interactions with the surrounding environment that can be leveraged for additional functionality. Small molecule binding to double stranded DNA is well known. Binding can occur in the major and minor grooves, between base pairs by intercalation, and by electrostatic interactions


2

Page 3 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

with the negatively charged phosphate backbone. These binding mechanisms form the basis of many different biotechnologies. For example, common molecular biology techniques use DNA intercalators and groove binding fluorophores as imaging agents. Various anticancer drugs and antibiotics are known to intercalate and/or bind in the major and minor grooves of B-form DNA and function by disrupting DNA replication.11-12 Synthetic polyamines are minor groove binders, have been designed to bind in a DNA sequence-dependent manner, and are used to regulate gene expression by blocking transcription.13 Polymer synthesis exploits aniline binding to DNA templates producing nanowires with controlled designs.14 Electrochemical sensing of small molecules based on DNA binding events is well established.15-17 Finally, single stranded nucleic acid aptamers can be engineered to bind protein and small molecule targets.18-20 In our own research, we have used enzyme substrate-DNA interactions to alter enzyme kinetics and enhance enzyme catalysis. By conjugating small DNA fragments and DNA tiles to enzymes with substrates that have micromolar strength binding to the DNA, local substrate concentrations can be increased.21-23 As a result, enzyme efficiency and substrate-enzyme association are enhanced. We have also demonstrated that interactions between enzyme substrates and multienzyme DNA-scaffolds can affect enzyme activity.24 In other examples, DNA nanostructures and long DNA fragments have been shown to increase active site turnover by controlling the environment in close proximity to the enzyme and active site.25-26 In this context, we are interested in understanding organophosphate binding to double stranded (ds) DNA and rigid DNA nanostructure building blocks. We are also motivated to understand organophosphate-DNA binding for biosensor development, potential mechanisms of toxicity due to prolonged organophosphate exposure, and applications in analytical chemistry. Here, we use a set of spectroscopy techniques and binding assays to investigate organophosphate binding to


3

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 31

dsDNA and rigid dsDNA tiles. Guided by molecular docking simulations, we use microscale thermophoresis to identify DNA-sequence dependent binding of model nerve agents, methyl parathion, paraoxon, and their common enzymatic hydrolysis product p-nitrophenol (Scheme 1). Competitive binding assays with a known small molecule intercalator and circular dichroism (CD) spectroscopy were used to further investigate DNA-sequence dependence. The combined results where used to design DNA tiles with low micromolar affinity to paraoxon.

Scheme 1. Enzymatic hydrolysis of model organophosphate nerve agents methyl parathion and paraoxon by phosphotriestase or similar enzyme.

MATERIALS AND METHODS Chemicals. Methyl parathion, paraoxon and p-nitrophenol were purchased from SigmaAldrich (St. Louis, MO). Diethyl hydrogen phosphate was purchased from Ark Pharm, Inc. (Libertyville, IL). All other buffers, salts, and solutions were purchased from Sigma-Aldrich (St. Louis, MO). Substrate–DNA docking simulations. AutoDock 4.2 simulation software27 was used to predict interactions between selected organophosphates, hydrolysis products, and double stranded DNA. Structures files of double stranded DNA were created using the 3D-Dart webserver28, with polar hydrogen atoms and Kollman charges assigned in AutoDock. Small


4

Page 5 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

molecules structures were obtained from the online ChemSpider database,29 with hydrogen atoms and Gasteiger charges assigned by VEGA ZZ. Small molecule torsional bonds were allowed to rotate during simulations within a 60 × 60 × 100 grid with points separated of 0.375 Å. The Lamarckian 4 genetic algorithm (LGA) was used as search method. Each LGA job consisted of 30 runs, using initial population of 150 individuals, with 2.5 × 106 energy evaluations, a maximum number of 2.7 × 104 iterations, a mutation rate of 0.02, a crossover rate of 0.80. After docking, all docking poses were clustered into groups and the pose with the lowest binding energy for each small molecule was reported. Microscale thermophoresis (MST). DNA-ligand binding interactions were experimentally measured by microscale thermophoresis (MST) using a NanoTemper Monolith NT.115 instrument (NanoTemper Technologies, München, Germany). DNA binding assays were conducted with 8 nM Cy5-labeled DNA incubated with varying ligand concentrations in MST buffer (50 mM Tris-HCl, 150 mM NaCl, 10 mM MgCl2, 0,05% Tween-20). Two-percent DMSO was added to the buffer when investigating methyl parathion. Using standard-treatment capillaries, labelled DNA fluorescence was acquired at 680 nm with excitation at 650 nm. The thermophoretic mobility of DNA is altered with ligand binding enabling correlation between binding and changes in fluorescence via the Hill’s equation as follows (Eq. 1)30:

⁄

=

(1)

Where h is the Hill coefficient, Kd is the dissociation constant, [L] is the ligand concentration, [BL] is the concentration of bound ligand, and [Bo] is the concentration of binding sites. All data were acquired in triplicate. Methylene blue displacement assay. DNA-ligand binding interactions were also quantified by a methylene blue (MB) displacement assay.31 Fluorescence measurements were performed at


5

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 31

ambient temperature using a BioTek Synergy™ 4 Hybrid Microplate Reader. DNA–methylene blue complexes were prepared in sodium phosphate buffer (50 mM TRIS-HCl, pH 7.4), were excited at 615 nm, and fluorescent emissions were measured between 650-750 nm. Ligand titration to DNA–methylene blue solutions can result in displaced methylene blue causing an increase in fluorescence intensity as MB fluorescence is quenched when bound to DNA. Using a modified Benesi-Hildebrand analysis an apparent ligand dissociation constant can be determined by Eq. 2.32

=

+

(2)

Where F0 and F represent the fluorescence signals of DNA–methylene in the absence and presence of ligands, [DNA–MB]0 and [L]0 represent the initial concentrations of DNA–MB and ligand, respectively. α is the instrument constant, Q is the quantum yield for DNA-ligand, and Kd is the DNA-ligand dissociation constant of the DNA–ligand. Plots of 1/(F-F0) vs 1/[ligand]0 yield Kd. A minimum of three replicates were conducted for each organophosphate and hydrolysis product. Circular Dichroism (CD) spectroscopy. CD spectra were obtained on a Jasco J-815 Circular Dichroism Spectrometer. Substrate solutions were prepared in sodium phosphate buffer (50 mM TRIS-HCl, pH 7.4) and CD spectra were acquired from samples in a 1 mm pathlength quartz cuvette. CD spectra were first acquired with DNA solutions followed by the addition of ligand up to 10 mM in concentration. New spectra were acquired after the solutions reached equilibrium. All data were acquired in triplicate. DNA tile assembly. Tiles were assembled from ssDNA listed in Table S1 at 200 µM in TAE– Mg2+ buffer (40 mM Tris-acetic acid, pH 8.0, 2 mM EDTA-Na2, and 12.5 mM magnesium


6

Page 7 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

acetate). The DNA strands were mixed and heated to 95°C for 5 minutes, cooled to 65°C for 20 minutes, 50°C for 20 minutes, 37°C for 20 minutes, and room temperature for 30 minutes.

RESULTS AND DISCUSSION To rapidly explore organophosphate binding to double stranded DNA (dsDNA) we created a 50-member in silico library of 10 base pair (bp) DNA structures with randomly generated sequences as targets for ligand binding in docking simulations. The simulations were accomplished with the AutoDock software suite available from the Scripps Institute, which is designed to predict how small molecules interact with known 3D structures (see Material and Methods and autodock.scipps.edu). Docking results of methyl parathion and paraoxon, as well as paraoxon’s phosphotriesterase (PTE) hydrolysis products p-nitrophenol and diethyl hydrogen phosphate, are shown in Figure 1. The docking predictions suggested that methyl parathion and paraoxon bind to dsDNA with micromolar affinity and that binding strength varies with DNA sequence. Methyl parathion binding was predicted with a range of Kd values from 30 to 500 µM, while paraoxon was predicted to bind with a Kd range between 15 and 170 µM. Docking of pnitrophenol suggested weaker binding than the organophosphates, with a Kd range from 200 to 2150 µM. The diethyl hydrogen phosphate hydrolysis product of paraoxon was predicted to have very weak interactions with DNA with Kd up to 10 mM. Predicted binding poses of paraoxon, methyl parathion, and p-nitrophenol on DNA1 are shown in Figure 2 and the predicted binding with DNA2 and DNA3 are shown in Figure S1.


7

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 31

Figure 1. Predicted organophosphate-DNA binding. (Top) AutoDock 4.2 predicted dissociations constants (Kd) of methyl parathion, paraoxon, p-nitrophenol, and diethyl hydrogen phosphate for 50 unique 10 base pair (bp), double stranded DNA (dsDNA) sequences. (Bottom) Sequences and properties of three DNA oligos and dsDNA fragments used to experimentally validate organophosphate binding. The predicted Kd values of sequences DNA1, -2, and -3 are shown in red, blue, and green, respectively.


8

Page 9 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 2. Predicted binding of methyl parathion, paraoxon, and p-nitrophenol on the double stranded DNA fragment DNA1. DNA1 sequence is (CAGGTTGCAG)2, methyl parathion is colored red, paraoxon is colored blue, and p-nitrophenol is colored yellow. The predicted binding constant for methyl parathion, paraoxon, and p-nitrophenol were found to be 58, 12, and 182 µM, respectively.

While the docking simulations predicted DNA sequence-dependent binding for each compound, the predictions required experimental validation. As such, three DNA sequences were selected for experimental validation including DNA1, -2, and -3 (Figure 1). These sequences were selected to provide a range of predicted binding strengths towards paraoxon, including predicted weak binding and sequences that were predicted to have binding in the low µM range. Sequences with a range of GC content were also selected so that we could explore potential relationships between GC content and binding strength (40, 50, and 60%, for DNA3, -2, and -1, respectively). Single stranded sequences that were predicted to form strong secondary structures were excluded and the selected sequences were concatenated to produce 20 bp dsDNA structures with melting temperatures more than 20 °C above the experimental conditions necessary for validation. Our previous work in understanding small molecule-DNA binding suggests that there is no correlation between dsDNA length in the 20 – 100 bp range and binding strength.21 As such, this study focused on DNA sequence-dependence with 20 bp double stranded fragments for the reasons described above. To validate the predicted DNA-sequence dependent binding, DNA1, -2, and -3 were used as binding targets for methyl parathion, paraoxon, and p-nitrophenol. The binding of diethyl hydrogenphosphate was not investigated because it was predicted to have very weak binding with Kd values in the mM range and preliminary experiments indicated no observable binding.


9

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 31

MST binding assays for paraoxon, p-nitrophenol, and methyl parathion followed the AutoDock predicted trends. Methyl parathion binding was strongest towards DNA1 followed closely by DNA3, with DNA2 exhibiting the weakest interactions (Figure 3; DNA1, Kd = 20±2 µM; DNA3, Kd = 25±2 µM; DNA2, Kd = 90±4 µM; MST data provided in Figure S2). A similar trend was observed with paraoxon. MST analysis revealed that DNA1 interactions with paraoxon were the strongest with a Kd of 59±6 µM, DNA3 resulted in weaker binding (Kd = 136±3 µM), and DNA2 interactions were the weakest producing a Kd of 287±14 µM. p-nitrophenol, the common hydrolysis product of paraoxon and methyl parathion, also showed DNA sequence-dependent binding, but generally had weaker interactions then either of the parent organophosphate compounds. In the case of p-nitrophenol, DNA1 resulted in a Kd of 229±23 µM, DNA2 showed a Kd of 368±20 µM, and DNA3 had a Kd of 654±50 µM. In all cases, the binding strength trends predicted by AutoDock were replicated in the MST experiments, the specific Kd values were also found to be similar. A comparison of the predicted and MST determined dissociation constants is provided in Table S2.

Figure 3. Microscalethermophoresis (MST) binding assays of organophosphates methyl parathion, paraoxon, and their hydrolysis product, p-nitrophenol to 20 base pair double stranded (ds) DNA fragments. DNA1 has 60% GC content, CAGGTTGCAGCAGGTTGCAG; DNA2 has 50% GC content,


10

Page 11 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

GAATCTTCGGGAATCTTCGG; and DNA3 has 40% GC content, CCTAAAAGAGCCTAAAAGAG. Assays were conducted with 8 nM Cy5-labeled dsDNA incubated with varying ligand concentrations in buffer containing 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 10 mM MgCl2, 0,05% Tween-20. Cy5 fluorescence was acquired at 680 nm with excitation at 650 nm.

A second binding assay was explored to confirm the observed DNA-sequence dependent binding found in the MST experiments. Methylene blue (MB) is a phenothiazinium dye that interacts with DNA primarily by intercalation and by groove binding.33-34 MB fluorescence is quenched upon DNA binding, and can therefore be used in competitive binding assays to identify potential small molecule binders that intercalate or that bind in the major or minor grooves. If MB fluorescence increases upon the addition of the target small molecule to solutions of DNA-bound MB then the change in fluorescence can be related to the release of MB as a consequence of small molecule binding. Titrations of methyl parathion, paraoxon, and pnitrophenol in to solutions of DNA-bound MB confirmed micromolar range binding in a DNAsequence dependent manner (Figures 4 and S3). Methyl parathion exhibited apparent Kd’s of 8.4±0.6, 27±2.4, and 17±1.7 µM in MB-binding assays, while paraoxon had apparent Kd’s of 7.5±0.7, 27±2.6, and 13±1.4 µM for DNA1, -2, and -3, respectively. Again, p-nitrophenol showed weaker binding than its parent compounds with Kd’s of 45±5, 60±5, and 61±6 µM for DNA1, -2, and -3.


11

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 31

Figure 4. Methylene blue-DNA binding assay with methyl parathion, paraoxon, and p-nitrophenol. The apparent dissociation constant (Kd,app) of each species was determine using the equation where the slope of 1/(F-F0) vs. 1/[Substrate] is equal to the apparent Kd (Kd,app). Assays were conducted in 50 mM, pH 7.4 at room temperature with MB fluorescence measured from 650 – 750 nm with excitation at 615 nm.

The binding strength trend of each compound was consistent across experimental techniques and docking predictions. For both methyl parathion and paraoxon, DNA1 was predicted to be the strongest binder followed, in order of binding strength, by DNA3 and DNA2. Both the MST and MB-competition experiments were in agreement, with binding strength orders of DNA1>DNA3>DNA2. The results for p-nitrophenol binding were also consistent across experiments and simulations with DNA1, -2, and -3 having the strongest to weakest interactions, respectively. Given that the techniques are based on different phenomena and require different experimental or simulated conditions (e.g., buffer salt concentration and solvent composition, see Materials and Methods), the Kd values are in good agreement (Table S2). It is important to note that the MB-DNA competitive binding assay coupled with the Benesi-Hildebrand analysis results in an apparent Kd (Kd,app; Figure 4). As such, it is appropriate to consider the MST data presented in Figure 3 as a more accurate quantification of the dissociation constants (Kd). The MB-DNA assay results provide an orthogonal measure of the binding strength trend, which was found to be consistent across all measurements and predictions.


12

Page 13 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

To investigate the effects of DNA sequence on potential binding modes, we analyzed organophosphate-DNA binding by CD spectroscopy. CD spectra of DNA1, -2, and -3 in the presence and absence of methyl parathion, paraoxon, p-nitrophenol, and diethyl hydrogen phosphate are shown in Figure 5. In the absence of small molecules, the spectra are representative of B-form DNA. The positive CD peak at ~275 nm results from base pair stacking and the negative band at ~245 nm is due to right-handed helicity of the structure.35-36 Two minor peaks at ~210 and ~220 nm are also observed. The 210 nm peak arises from β-N-glycosidic linkage between nitrogenous bases and deoxyribose sugars and the 220 nm peak stems from hydrogen bonding between the nitrogenous bases of opposite strands.37 Small molecule intercalation can produce two distinct effects: (i) decreased CD signal at 245 and 275 nm due to weakened base pair π- π stacking and disrupted helical structure;38-40 and, (ii) induced CD at ~210 nm resulting from specific intercalator-DNA electronic interactions.41 The first case is observed with methyl parathion, the 245 and 275 nm peaks are reduced when observing DNA1 and -3 in the presence of methyl parathion. With DNA2, only the 275 nm peak is reduced suggesting weak binding that disrupts base stacking but does not significantly disrupt helicity. In the case of paraoxon, base stacking and helicity are not disturbed, but an induced CD signal appears at ~210 nm. Previous studies have shown that induced CD with intercalation is dependent on the angular orientation of the small molecule relative to the base-pair dyad axis: positive CD is induced when the intercalator is oriented parallel to the dyad axis (see Figure 5a paraoxon with DNA2), while a perpendicular orientation yields a negative induced CD (see Figure 5a paraoxon with DNA1 and -3).42 Induced CD is also observed with p-nitrophenol (DNA1, -2, and-3), and in the case of DNA1 reduced signal at 245 and 275 nm suggests disrupted base pair stacking and helicity.


13

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 31

It is important to note that changes in CD signal at 245 and 275 nm can also result from supramolecular DNA coiling induced by small molecules binding the in major groove. Such behavior has been shown with DNA-binding ruthenium-based metal-organic complexes,43-44 but is not expected with p-nitrophenol or methyl parathion as peaks reductions are minimal and the MB binding assays are supportive of intercalation. However, minor groove and electrostatic binding are still possible, but because they may not disrupt base pair stacking or helicity are not observable by CD analysis.45 In this context, docking predictions can be informative and, in the case of the organophosphates studied here, suggested that groove binding contributes to the overall interactions of DNA (Figure 2 and S1). The CD spectroscopy analysis of organophosphate-DNA complexes supports a conclusion of DNA-sequence dependent binding. Experimental assays (Figures 3 and 4) and docking predictions (Figures 1 and 2) suggest that methyl parathion interacts strongly with DNA1, followed by DNA3 and -2. Correspondingly, the largest changes in CD signal resulted from DNA1-methyl parathion interactions, followed by DNA3 and -2. Similarly, induced CD with paraoxon was minimal with DNA2 (the weakest binding target) and induced CD with pnitrophenol was strongest with DNA1 (the strongest binding sequence). In the case of the paraoxon PTE hydrolysis product diethyl hydrogen phosphate, MST binding assays and docking predictions suggest very weak binding. CD analysis supports this conclusion, as B-form DNA characteristics are lost in the presence of diethyl hydrogenphosphate (Figure 5b). In all cases the 275 nm peak is red-shifted and CD signal is substantially reduced. In the absence of measurable binding, the observed changes in CD spectra suggest a loss of DNA structure preventing groove binding or intercalation.


14

Page 15 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 5. Circular dichroism (CD) analysis of organophosphate-DNA binding. (A) CD spectra of DNA1, -2, and -3 with methyl parathion, paraoxon, and p-nitrophenol. (B) CD spectra of DNA1, -2, and -3 with diethyl hydrogen phosphate. Spectra were acquired in 50 mM TRIS-HCl buffered solution, pH 7.4 at room temperature. Spectra in the absence of binding ligand are shown in black, while spectra in the presence of methyl parathion (green), paraoxon (red), p-nitrophenol (blue), and diethyl hydrogen phosphate (pink) are colored.

Given the sequence dependent binding of the studied organophosphate to dsDNA, we designed two DNA DX tiles to investigate potential binding to the DNA nanostructure building block. Tiles T1 and T2 where designed based on previously published DNA nanostructure designs with arbitrary DNA sequence (Table S1).21 Tiles were assembled by heating a mixture of single stranded oligomers to 95 °C and cooling stepwise to room temperature over 1.5 hours (see Materials and Methods). Tile assembly was confirmed by gel electrophoresis, which showed a single DNA band after assembly (Figure S4).


15

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 31

MST analysis revealed that paraoxon bound more strongly to the tile than to the dsDNA fragments, with Kd’s of 3.3±0.3 µM to T1 and 1.4±0.8 µM to T2 (Figure 6a). Similarly, pnitrophenol had stronger interactions with both tiles in comparison to dsDNA binding (T1, Kd = 172±20 µM; T2, Kd = 95±9 µM; Figure 6b). Given the tight binding of both paraoxon and pnitrophenol to T1 and T2, CD analysis was conducted to investigate potential binding modes (Figures 6c,d). Induced CD and changes in dichroic spectra observed with paraoxon binding to T1 where similar to those observed with DNA1 and -3. In the case of T2, paraoxon also showed induced CD at ~210 nm as well as helical disruption and weakened base pair π-π stacking as suggested by the reduction in signal at 275 and 245 nm, respectively. Interestingly, p-nitrophenol binding to T1 and T2 induced a positive CD signal at ~210 nm, suggesting a change in binding orientation in comparison to p-nitrophenol binding to the dsDNA fragments DNA1, -2, and -3. It is possible that stronger binding in the DX tiles in comparison to dsDNA fragments is due to differences in the molecular structure of the DNA. DX tiles are rigid structures of two attached double helices, a configuration that may increase the number of binding sites and/or the strength of binding through intercalation. More detailed studies on the mechanisms of binding in DX tiles and other DNA nanostructures is on-going.


16

Page 17 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 6. Paraoxon and p-nitrophenol binding to DNA DX tiles. (A,B) Microscale thermophoresis analysis of paraoxon and p-nitrophenol binding to tiles T1 and T2. (C, D) CD analysis of the binding modes.

Taken together, the results presented here demonstrate DNA sequence-dependent binding of selected organophosphates to both dsDNA fragments and small dsDNA nanostructures. The primary

mechanism

of

organophosphate

toxicity

is

by

the

rapid

inhibition

of

acetylcholinesterase, as such it is likely that such compounds have limited interactions with DNA in vivo. However, the finding presented here are of fundamental interest and are important in the development of sensing technologies that seek to analyze organophosphates and their hydrolysis products in both fluid and cellular biological samples. A series of previous studies has identified and characterized organophosphate pesticide binding to peptide and peptidolipid structures. Rationally designed peptides that mimick the HisGlu-Ser catalytic triad of acetylcholinesterase bind paraoxon with millimolar affinity (Kd’s ranged from ~2-30 mM).46 When the same tripeptide was incorporated into β-sheet forming peptides, paraoxon binding was observed, inducing β-sheet formation in peptides with the motif


17

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 31

His-Glu-Ser and inducing fiber and hydrogel formation with the Glu-Ser-His motif.47 In addition, paraoxon interactions with a C18H35(stearoyl)-Phe-Trp-Ser-His-Glu peptidolipid layer have also been characterized. Interestingly, only paraoxon was shown to interact with the surface peptidolipid layer, while the enzyme hydrolysis products p-nitrophenol and diethyl hydrogen phosphate did not. The organophosphate-peptide interactions described above were studied as a potential matrix from solid-phase extraction of pesticides. Given the relatively tight binding (µM for DNA and mM for peptides) and sequence-dependent binding of paraoxon and methyl parathion to dsDNA, solid-phase extraction matrices is a potential application for rationally designed DNA nanostructures as well. Moreover, we anticipate that DNA-organophosphate interactions can be leveraged to create sensors with specific small molecule binding48-50 as well as enzyme-DNA nanostructures that enhanced organophosphate hydrolysis.21,22 With respect to enzyme-DNA nanostructures, we have previously shown that dsDNA conjugated to an enzyme can enhance catalysis.21,

22, 24

The mechanism of enhancement is

through an increase in local substrate concentration when the enzyme’s substrate has µM range binding interactions with the conjugated DNA. The result of increased local substrate concentration is an increase in substrate on-rate and a decrease in apparent Michaelis constant, thus enhancing the reaction rate at low bulk substrate concentrations.21 The previously reported examples demonstrating this effect were with model peroxidase and NAD+ co-factor-dependent enzymes, but based on the organophosphate binding interactions described here we anticipate similar results with phosphotriesterase hydrolysis of organophosphates that have binding interaction in phosphotriesterase-DNA nanostructures. It is important to note that the studies presented here focused on the analysis of organophosphate binding to dsDNA and dsDNA nanostructures (e.g., DX tiles). This is in


18

Page 19 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

contrast to nucleic acid aptamers engineered through SELEX or other aptamer engineering methods.20 The aptamer methods focus on discovering single stranded nucleic acids that bind to proteins or small molecules of interest. Such aptamers, such as one created to bind a derivative of the organophosphate soman,18 would also be useful in sensing and catalysis applications similar to those described in this work.

CONCLUSION The field of DNA nanotechnology and DNA-based nanomaterials has proven effective in creating new protein-DNA structures, spatial organization at the nanoscale, and dynamic nanoscale systems. The chemical and physical features of DNA that make these new technologies possible are also responsible for a wealth of interactions with small molecules including intercalation between base pairs, major and minor groove binding, and electrostatic interactions with the negatively charged phosphate backbone. In this work, we demonstrate that the model organophosphate compounds methyl parathion and paraoxon, as well as their common hydrolysis product p-nitrophenol have sequence-dependent binding interactions with DNA. Predicted sequence-dependent binding by docking simulations was experimentally verified with microscale thermophoresis and a methylene blue competitive binding assay. CD analysis demonstrated that changes in DNA sequence produce different binding modes. Both methyl parathion and paraoxon exhibited low micromolar dissociation constant with dsDNA fragments, while p-nitrophenol showed weaker binding but still in the micromolar range. Strong interactions with a basic building block of DNA nanoscale materials, the DNA DX tile, were also observed with paraoxon and p-nitrophenol. The identification of organophosphate-DNA binding adds to the fundamental understanding of the molecular interactions of these compounds with biological


19

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 31

materials and opens new possibilities in DNA-based sensors, DNA-based matrices for organophosphate extraction, and enzyme-DNA technologies for organophosphate hydrolysis. ASSOCIATED CONTENT Supporting Information. The Supporting Information is available free of charge on the ACS Publications website. Additional information as noted in the text (PDF) AUTHOR INFORMATION Corresponding Author *E-mail: [email protected] Author Contributions IW, YG, and SO designed experiments and analyzed the data. YG and SO performed the experiments. AT conducted the binding predictions. All authors wrote and edited the manuscript. ACKNOWLEDGMENT This work was supported by HDTRA1-14-1-0045. We thank Louis Lancaster for his help in generating images contained in this manuscript. REFERENCES 1. Jones, M. R.; Seeman, N. C.; Mirkin, C. A., Programmable materials and the nature of the DNA bond. Science 2015, 347 (6224). 2. Kuzyk, A.; Schreiber, R.; Fan, Z. Y.; Pardatscher, G.; Roller, E. M.; Hogele, A.; Simmel, F. C.; Govorov, A. O.; Liedl, T., DNA-based self-assembly of chiral plasmonic nanostructures with tailored optical response. Nature 2012, 483 (7389), 311-314. 3. Pal, S.; Deng, Z. T.; Ding, B. Q.; Yan, H.; Liu, Y., DNA-Origami-Directed SelfAssembly of Discrete Silver-Nanoparticle Architectures. Angew Chem-Int Edit 2010, 49 (15), 2700-2704. 4. Niemeyer, C. M., Semisynthetic DNA-protein conjugates for biosensing and nanofabrication. Angew Chem-Int Edit 2010, 49 (7), 1200-16.


20

Page 21 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

5. Sacca, B.; Meyer, R.; Erkelenz, M.; Kiko, K.; Arndt, A.; Schroeder, H.; Rabe, K. S.; Niemeyer, C. M., Orthogonal protein decoration of DNA origami. Angew Chem-Int Edit 2010, 49 (49), 9378-83. 6. Fu, J. L.; Liu, M. H.; Liu, Y.; Woodbury, N. W.; Yan, H., Interenzyme Substrate Diffusion for an Enzyme Cascade Organized on Spatially Addressable DNA Nanostructures. J Am Chem Soc 2012, 134 (12), 5516-5519. 7. Fu, J. L.; Yang, Y. R.; Johnson-Buck, A.; Liu, M. H.; Liu, Y.; Walter, N. G.; Woodbury, N. W.; Yan, H., Multi-enzyme complexes on DNA scaffolds capable of substrate channelling with an artificial swinging arm. Nat Nanotechnol 2014, 9 (7), 531-536. 8. Qi, H.; Ghodousi, M.; Du, Y.; Grun, C.; Bae, H.; Yin, P.; Khademhosseini, A., DNAdirected self-assembly of shape-controlled hydrogels. Nat Comm 2013, 4. 9. Douglas, S. M.; Bachelet, I.; Church, G. M., A Logic-Gated Nanorobot for Targeted Transport of Molecular Payloads. Science 2012, 335 (6070), 831-834. 10. Jiang, Q.; Song, C.; Nangreave, J.; Liu, X. W.; Lin, L.; Qiu, D. L.; Wang, Z. G.; Zou, G. Z.; Liang, X. J.; Yan, H.; Ding, B. Q., DNA Origami as a Carrier for Circumvention of Drug Resistance. J Am Chem Soc 2012, 134 (32), 13396-13403. 11. Neidle, S., DNA minor-groove recognition by small molecules. Nat Prod Rep 2001, 18 (3), 291-309. 12. Palchaudhuri, R.; Hergenrother, P. J., DNA as a target for anticancer compounds: methods to determine the mode of binding and the mechanism of action. Curr Opin Biotechnol 2007, 18 (6), 497-503. 13. Pascu, G. I.; Hotze, A. C. G.; Sanchez-Cano, C.; Kariuki, B. M.; Hannon, M. J., Dinuclear ruthenium(II) triple-stranded helicates: Luminescent supramolecular cylinders that bind and coil DNA and exhibit activity against cancer cell lines. Angew Chem-Int Edit 2007, 46 (23), 4374-4378. 14. Ma, Y. F.; Zhang, J. M.; Zhang, G. J.; He, H. X., Polyaniline nanowires on Si surfaces fabricated with DNA templates. J Am Chem Soc 2004, 126 (22), 7097-7101. 15. Li, X. H.; Song, H. F.; Nakatani, K.; Kraatz, H. B., Exploiting small molecule binding to DNA for the detection of single-nucleotide mismatches and their base environment. Anal Chem 2007, 79 (6), 2552-2555. 16. Boon, E. M.; Ceres, D. M.; Drummond, T. G.; Hill, M. G.; Barton, J. K., Mutation detection by electrocatalysis at DNA-modified electrodes. Nat Biotechnol 2000, 18 (10), 10961100. 17. Shao, F. W.; Augustyn, K.; Barton, J. K., Sequence dependence of charge transport through DNA domains. J Am Chem Soc 2005, 127 (49), 17445-17452. 18. Bruno, J. G.; Carrillo, M. R.; Cadieux, C. L.; Lenz, D. E.; Cerasoli, D. M.; Phillips, T., DNA Aptamers Developed Against a Soman Derivative Cross-react with the Methylphosphonic Acid Core but Not with Flanking Hydrophobic Groups. J Mol Recognit 2009, 22 (3), 197-204. 19. Ellington, A. D.; Szostak, J. W., In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346 (6287), 818-822. 20. Cho, E. J.; Lee, J. W.; Ellington, A. D., Applications of Aptamers as Sensors. Ann Rev Anal Chem 2009, 2, 241-264. 21. Gao, Y.; Roberts, C. C.; Toop, A.; Chang, C.-e. A.; Wheeldon, I., Mechanisms of Enhanced Catalysis in Enzyme–DNA Nanostructures Revealed through Molecular Simulations and Experimental Analysis. ChemBioChem 2016, 17 (15), 1430-1436.


21

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 31

22. Gao, Y. N.; Roberts, C. C.; Zhu, J.; Lin, J. L.; Chang, C. E. A.; Wheeldon, I., Tuning Enzyme Kinetics through Designed Intermolecular Interactions Far from the Active Site. ACS Catal 2015, 5 (4), 2149-2153. 23. Lin, J.-L.; Palomec, L.; Wheeldon, I., Design and Analysis of Enhanced Catalysis in Scaffolded Multienzyme Cascade Reactions. ACS Catal 2014, 505-511. 24. Lin, J.-L.; Wheeldon, I., Kinetic Enhancements in DNA-Enzyme Nanostructures Mimic the Sabatier Principle. ACS Catal 2013, 3 (4), 560-564. 25. Zhao, Z.; Fu, J.; Dhakal, S.; Johnson-Buck, A.; Liu, M.; Zhang, T.; Woodbury, N. W.; Liu, Y.; Walter, N. G.; Yan, H., Nanocaged enzymes with enhanced catalytic activity and increased stability against protease digestion. Nat Commun 2016, 7. 26. Rudiuk, S.; Venancio-Marques, A.; Baigl, D., Enhancement and Modulation of Enzymatic Activity through Higher-Order Structural Changes of Giant DNA-Protein Multibranch Conjugates. Angew Chem-Int Edit 2012, 51 (51), 12694-12698. 27. Morris, G. M.; Huey, R.; Lindstrom, W.; Sanner, M. F.; Belew, R. K.; Goodsell, D. S.; Olson, A. J., AutoDock4 and AutoDockTools4: Automated docking with selective receptor flexibility. J Comput Chem 2009, 30 (16), 2785-2791. 28. van Dijk, M.; Bonvin, A., 3D-DART: a DNA structure modelling server. Nucleic Acids Res 2009, 37, W235-W239. 29. Tarasevich, M. R.; Yaropolov, A. I.; Bogdanovskaya, V. A.; Varfolomeev, S. D., Electrocatalysis of a Cathodic Oxygen Reduction by Laccase. Bioelectroch Bioener 1979, 6 (3), 393-403. 30. Wienken, C. J.; Baaske, P.; Rothbauer, U.; Braun, D.; Duhr, S., Protein-binding assays in biological liquids using microscale thermophoresis. Nat Commun 2010, 1, 100. 31. Shen, H. Y.; Shao, X. L.; Xu, H.; Li, J.; Pan, S. D., In Vitro Study of DNA Interaction with Trichlorobenzenes by Spectroscopic and Voltammetric Techniques. Int J Electrochem Sc 2011, 6 (3), 532-547. 32. Catena, G. C.; Bright, F. V., Thermodynamic study on the effects of .beta.-cyclodextrin inclusion with anilinonaphthalenesulfonates. Anal Chem 1989, 61 (8), 905-909. 33. Bradley, D. F.; stellwagen, N. C.; O'Konski, C. T.; Paulson, C. M., Electric birefringence and dichroism of acridine orange and methylene blue complexes with polynucleotides. Biopolymers 1972, 11 (3), 645-652. 34. Nordén, B.; Tjerneld, F., Structure of methylene blue-DNA complexes studied by linear and circular dichroism spectroscopy. Biopolymers 1982, 21 (9), 1713-1734. 35. Mitsui, Y.; Langridge, R.; Shortle, B. E.; Cantor, C. R.; Grant, R. C.; Kodama, M.; Wells, R. D., Physical and Enzymatic Studies on Poly d(I-C).Poly d(I-C), an Unusual Double-helical DNA. Nature 1970, 228 (5277), 1166-1169. 36. Vorlícková, M.; Sáji, J., Transitions of poly(dI-dC), poly(dI-methyl5dC) and poly(dIbromo5dC) among and within the B-, Z-, A- and X-DNA families of conformations. Nucleic Acids Res 1991, 19 (9), 2343-2347. 37. Agarwal, S.; Jangir, D. K.; Mehrotra, R.; Lohani, N.; Rajeswari, M. R., A Structural Insight into Major Groove Directed Binding of Nitrosourea Derivative Nimustine with DNA: A Spectroscopic Study. Plos One 2014, 9 (8). 38. Li, H.; Bu, X.; Lu, J.; Xu, C.; Wang, X.; Yang, X., Interaction study of ciprofloxacin with human telomeric DNA by spectroscopy and molecular docking. Spectrochim Acta A Mol Biomol Spectrosc 2013, 107, 227-234.


22

Page 23 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

39. Mergny, J. L.; Duvalvalentin, G.; Nguyen, C. H.; Perrouault, L.; Faucon, B.; Rougee, M.; Montenaygarestier, T.; Bisagni, E.; Helene, C., TRIPLE HELIX SPECIFIC LIGANDS. Science 1992, 256 (5064), 1681-1684. 40. Jain, S. S.; Polak, M.; Hud, N. V., Controlling nucleic acid secondary structure by intercalation: effects of DNA strand length on coralyne-driven duplex disproportionation. Nucleic Acids Res 2003, 31 (15), 4608-4615. 41. Schipper, P. E.; Nordén, B.; Tjerneld, F., Determination of binding geometry of DNAadduct systems through induced circular dichroism. Chem Phys Lett 1980, 70 (1), 17-21. 42. Lyng, R.; Hard, T.; Norden, B., INDUCED CD OF DNA INTERCALATORS ELECTRIC-DIPOLE ALLOWED TRANSITIONS. Biopolymers 1987, 26 (8), 1327-1345. 43. Pascu, G. I; Hotze, A. C. G.; Sanchez-Cano, C.; Kariuki, B. N.; Hannon, M. J., Dinuclear Ruthenium(II) Triple-Stranded Helicates: Luminescent Supramolecular Cylinders That Bind and Coil DNA and Exhibit Activity against Cancer Cell Lines. Angew Chem-Int Edit 2007, 46 (23), 4374-4378. 44. Linares, F.; Procopio, E. Q.; Galindo, M. A.; Romero, M. A.; Navarro, J. A. R.; Barea, E., Molecular architecture of redox-active half-sandwich Ru(ii) cyclic assemblies. Interactions with biomolecules and anticancer activity. CrystEngComm 2010, 12 (8), 2343-2346. 45. Manna, A.; Chakravorti, S., Modification of a Styryl Dye Binding Mode with Calf Thymus DNA in Vesicular Medium: From Minor Groove to Intercalative. J Phys Chem B 2012, 116 (17), 5226-5233. 46. Mascini, M.; Sergi, M.; Monti, D.; Del Carlo, M.; Compagnone, D., Oligopeptides as Mimic of Acetylcholinesterase: From the Rational Design to the Application in Solid-Phase Extraction for Pesticides. Anal Chem 2008, 80 (23), 9150-9156. 47. Yaakobi, K.; Liebes-Peer, Y.; Kushmaro, A.; Rapaport, H., Designed Amphiphilic betaSheet Peptides as Templates for Paraoxon Adsorption and Detection. Langmuir 2013, 29 (23), 6840-6848. 48. Li, H.; Wang, Z. H.; Wu, B. W.; Liu, X. H.; Xue, Z. H.; Lu, X. Q., Rapid and sensitive detection of methyl-parathion pesticide with an electropolymerized, molecularly imprinted polymer capacitive sensor. Electrochim Acta 2012, 62, 319-326. 49. Wu, B. W.; Hou, L. J.; Du, M.; Zhang, T. T.; Wang, Z. H.; Xue, Z. H.; Lu, X. Q., A molecularly imprinted electrochemical enzymeless sensor based on functionalized gold nanoparticle decorated carbon nanotubes for methyl-parathion detection. RSC Adv 2014, 4 (96), 53701-53710. 50. Wang, J.; Chatrathi, M. P.; Mulchandani, A.; Chen, W., Capillary electrophoresis microchips for separation and detection of organophosphate nerve agents. Anal Chem 2001, 73 (8), 1804-1808.


23

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Scheme 1. Enzymatic hydrolysis of model organophosphate nerve agents methyl parathion and paraoxon by phosphotriestase or similar enzyme.

498x203mm (96 x 96 DPI)


Page 24 of 31

Page 25 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 1. Predicted organophosphate-DNA binding. (Top) AutoDock 4.2 predicted dissociations constants (Kd) of methyl parathion, paraoxon, p-nitrophenol, and diethyl hydrogen phosphate for 50 unique 10 base pair (bp), double stranded DNA (dsDNA) sequences. (Bottom) Sequences and properties of three DNA oligos and dsDNA fragments used to experimentally validate organophosphate binding. The predicted Kd values of sequences DNA1, -2, and -3 are shown in red, blue, and green, respectively. 127x101mm (299 x 299 DPI)


Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2. Predicted binding of methyl parathion, paraoxon, and p-nitrophenol on the double stranded DNA fragment DNA1. DNA1 sequence is (CAGGTTGCAG)2, methyl parathion is colored red, paraoxon is colored blue, and p-nitrophenol is colored yellow. The predicted binding constant for methyl parathion, paraoxon, and p-nitrophenol were found to be 58, 12, and 182 µM, respectively. 32x7mm (300 x 300 DPI)


Page 26 of 31

Page 27 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 3. Microscalethermophoresis (MST) binding assays of organophosphates methyl parathion, paraoxon, and their hydrolysis product, p-nitrophenol to 20 base pair double stranded (ds) DNA fragments. DNA1 has 60% GC content, CAGGTTGCAGCAGGTTGCAG; DNA2 has 50% GC content, GAATCTTCGGGAATCTTCGG; and DNA3 has 40% GC content, CCTAAAAGAGCCTAAAAGAG. Assays were conducted with 8 nM Cy5-labeled dsDNA incubated with varying ligand concentrations in buffer containing 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 10 mM MgCl2, 0,05% Tween-20. Cy5 fluorescence was acquired at 680 nm with excitation at 650 nm. 50x16mm (300 x 300 DPI)


Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4. Methylene blue-DNA binding assay with methyl parathion, paraoxon, and p-nitrophenol. The apparent dissociation constant (Kd,app) of each species was determine using the equation where the slope of 1/(F-F0) vs. 1/[Substrate] is equal to the apparent Kd (Kd,app). Assays were conducted in 50 mM, pH 7.4 at room temperature with MB fluorescence measured from 650 – 750 nm with excitation at 615 nm. 254x79mm (299 x 299 DPI)


Page 28 of 31

Page 29 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 6. Paraoxon and p-nitrophenol binding to DNA DX tiles. (A,B) Microscale thermophoresis analysis of paraoxon and p-nitrophenol binding to tiles T1 and T2. (C, D) CD analysis of the binding modes. 76x76mm (300 x 300 DPI)


Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5. Circular dichroism (CD) analysis of organophosphate-DNA binding. (A) CD spectra of DNA1, -2, and -3 with methyl parathion, paraoxon, and p-nitrophenol. (B) CD spectra of DNA1, -2, and -3 with diethyl hydrogen phosphate. Spectra were acquired in 50 mM TRIS-HCl buffered solution, pH 7.4 at room temperature. Spectra in the absence of binding ligand are shown in black, while spectra in the presence of methyl parathion (green), paraoxon (red), p-nitrophenol (blue), and diethyl hydrogen phosphate (pink) are colored. 60x72mm (300 x 300 DPI)


Page 30 of 31

Page 31 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

TOC graphic 76x35mm (300 x 300 DPI)


DNA Nanostructure Sequence-Dependent Binding ... - ACS Publications

Recommend Documents