Anal. Chem. 1997, 69, 4894-4898
DNA Typing of Human Leukocyte Antigen Sequence Polymorphisms by Peptide Nucleic Acid Probes and MALDI-TOF Mass Spectrometry Ping Jiang-Baucom and James E. Girard*
Department of Chemistry, American University, 4400 Massachusetts Avenue, Washington, D.C. 20016 John Butler
Gene Trace Systems, Inc., 333 Ravenswood Avenue, Menlo Park, California 94025 Phillip Belgrader
Armed Forces DNA Identification Laboratory, Armed Forces Institute of Pathology, Rockville, Maryland 20850
A novel analytical method using PNA probes detected by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOFMS) was applied to type sequence polymorphisms within the human leukocyte antigen (HLA), DQA locus. Streptavidin-coated magnetic beads were used to immobilize biotinylated DNA. PNA probes representing possible alleles were then prepared for the immobilized DNA hybridization. The nonspecific PNA probes were removed with stringent washes. The PNA/DNA/beads conjugate was analyzed by MALDITOFMS. The genotype of the DNA was determined by the detected molecular masses of the released PNA probes. Reproducible and accurate genotyping was achieved by this analytical method. DNA identification, or typing, has broad applications in forensic analysis, paternity testing, diagnostic medicine, and plant and animal sciences.1 Current PCR-based methods utilize slab gel electrophoresis, plate readers, or reverse dot blot hybridization detection platforms. Even though those methods have been extensively tested, validated, and used in forensic testing,2 they remain labor intensive and difficult to automate for large-scale testing. Large-scale DNA polymorphism detection requires the development of new techniques which are fast, cost effective, and easily automated. One method which has shown promise is matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOFMS). Although MALDI has been very successful in the analysis of proteins and peptides, it has been less successful in the analysis of DNA fragments. Current DNA sequencing by MALDI-TOFMS allows only a 100 base DNA sequence to be analyzed with acceptable mass accuracy, while gel electrophoresis can analyze sequence ladders as long as 800 bases.3 Cations (sodium and/or potassium) in the DNA samples form adducts with the molecular ion, causing peak broadening and reduction of resolution, sensitivity, and accuracy of the (1) Weedn, V. W.; Roby, R. K. Arch. Pathol. Lab. Med. 1993, 117, 486-491. (2) Blake, E.; Mihalovich, J.; Higuchi, R.; Walsh, P. W.; Erlich, H. J. Forensic Sci. 1992, 37, 700-726. (3) Monforte, J. A.; Becker, C. H. Nat. Med. 1997, 3, 360-362.
4894 Analytical Chemistry, Vol. 69, No. 23, December 1, 1997
molecular weight information.4-6 DNA samples and matrices usually have to be purified by HPLC and/or cation-exchange resin7-9 before being subjected to MALDI analysis. Because of these problems, current research in DNA sequencing4,10-15 by MALDI-TOFMS is limited and provides considerable challenges (an order of magnitude increase is needed in both mass range and sensitivity) that must be met before the method will be competitive with existing techniques.6 To overcome these problems, solid phase hybridization methods, such as the primer oligo base extension (PROBE) reaction16 and genetic bit analysis (GBA),17 have been exploited. This study utilizes another solid phase hybridization-based method18 in which peptide nucleic acids (PNAs) and MALDI-TOFMS are used for DNA typing. PNAs are a new class of biomolecules which are DNA mimics.19 PNA molecules retain the same Watson-Crick base (4) Nordhoff, E.; Karas, M.; Cramer, R.; Hahner, S.; Hillenkamp, K. J. Mass Spectrom. 1995, 30, 99-112. (5) Nordhoff, E.; Kirpekar, F.; Karas, M.; Cramer, R.; Hahner, S.; Hillenkamp, F.; Kristiansen, K.; Roepstorff, P.; Lezius, A. Nucleic Acids Res. 1994, 22, 2460-2465. (6) Fitzgerald, M. C.; Smith, L. M. Annu. Rev. Biophys. Biomol. Struct. 1995, 24, 117-40. (7) Nordhoff, E.; Ingendoh, A.; Cramer, R.; Overberg, A.; Stahl, B.; Karas, M.; Hillenkamp, F.; Crain, P. F. Rapid Commun. Mass Spectrom. 1992, 771776. (8) Limbach, P. F.; Crain, P. F.; Mccloskey, J. A. J. Am. Soc. Mass Spectrom. 1995, 6, 27-39. (9) Benner, W. H.; Horn, D.; Katz, J.; Jaklevic, J. Rapid Commun. Mass Spectrom. 1995, 9, 537-540. (10) Fitzgerald, M. C.; Shu, L.; Smith, L. M. Rapid Commun. Mass Spectrom. 1993, 7, 895-897. (11) Jacobson, K. B.; Arlinghaus, H. F.; Buchanan, M. V.; Chen, C.-H.; Glish, G. L.; Hettich, R. L.; McLuckey, S. A. Genet. Anal. Tech. Appl. 1991, 8, 223229. (12) Pieles, U.; Zurcher, W.; Schar, M.; Moser, H. E. Nucleic Acids Res. 1993, 21, 3191-3196. (13) Shaler, T. A.; Tan. Y.; Wickham, J. N.; Wu, K. J.; Becker, C. H. Rapid Commun. Mass Spectrom. 1995, 9, 942-947. (14) Keough, T.; Baker, T. R.; Dobson, R. L. M.; Lacey, M. P. Rapid Commun. Mass Spectrom. 1993, 7, 195-200. (15) Zhu, Y. F.; Chung, C. N.; Taranko, N. I.; Allman, S. L.; Martin, S. A.; Haff, L.; Chen, C. H. Rapid Commun. Mass Spectrom. 1996, 10, 383-388. (16) Braun, A.; Little, D. P.; Koster, H. Clin. Chem. 1997, 43, 1151-1158. (17) Nikitorov, T. T.; Rendle, R. B.; Goelet, P.; Rogers, Y.-H.; Kotewicz, M. L.; Anderson, S.; Trainor, G. L.; Knapp, M. R. Nucleic Acids Res. 1994, 22, 4167-4175. (18) Ross, P.; Lee, K.; Belgrader, P. Anal. Chem., in press. S0003-2700(97)00639-2 CCC: $14.00
© 1997 American Chemical Society
pairing rules as regular oligonucleotides but with the following added benefits: (1) greater specificity,20,21 because a PNA/DNA mismatch is more destabilizing than a mismatch in a DNA/DNA duplex, and (2) stronger binding between complementary PNA/ DNA strands than between complementary DNA/DNA strands of the same sequence.19,22 More importantly, PNAs can be analyzed and easily characterized by MALDI-TOFMS.23 The goal of this study is to develop a rapid DQA typing test utilizing an assay recently reported18 which offers the advantages of higher specificity and stronger affinity of PNA/DNA hybrid over DNA/DNA and the easy detection of PNA in MALDITOFMS. In this assay, DNA samples were amplified using biotinylated primers for a sequence of interest by performing a PCR amplification.24 The biotinylated DNA was immobilized (captured) on streptavidin-coated magnetic beads as described elsewhere.18,25 The captured PCR product was denatured to a single strand and served as the target template for the hybridization of allele-specific PNA probes. PNA probes, representing possible alleles at this specific region of gene, were exposed to the immobilized DNA and formed PNA/DNA hybrids. The noncomplementary PNA probes were removed with stringent washes. The hybridized PNA/DNA/beads conjugate was then analyzed directly by MALDI. Since only the PNA was detected in MALDI-TOFMS and each PNA probe has a unique molecular weight, the genotype of the DNA sample was related directly to the molecular weight of the PNA probe. This assay has been applied to distinguish four alleles within the human leukocyte antigen (HLA), DQA locus (HLA-DQA).26 The HLA-DQA DNA typing test (DQA typing), described in detail by Saiki et al.,26 is a PCR-based reverse dot blot method used to determine which of six HLA-DQA alleles (alleles DQA1, DQA2, DQA3, and DQA4 and allele 1 subtypes DQA1.1, DQA1.2, and DQA1.3) are present in a biological sample. Thus, 21 genotypes exist in the general population. Accurate, reproducible results were reported for typing the four main alleles in the HLA-DQA region of DNA samples. METHODS AND MATERIALS MALDI-TOF Mass Spectrometry. A Voyager RP biospectrometry workstation time-of-flight mass spectrometer (PerSeptive Biosystem, Framingham, MA) with software version 3.02 was used in a linear mode for all the studies, and it has been described previously.23 Analyses reported here are done using an autosampler run mode with the following parameters: 10 measurements (19) Nielsen, P. E.; Egholm, M.; Berg, R. H.; Buchardt, O. Science 1991, 254, 1497-1500. (20) Egholm, M.; Buchardt, O.; Christenen, L.; Behrens, C.; Freier, S. M.; Driver, D. A.; Berg, R. H.; Kim, S. K.; Norden, B.; Neilsen, P. E. Nature 1993, 365, 566-568. (21) Orum, H.; Neilsen, P. E.; Egholm, M.; Berg, R. H.; Buchardt, O.; Stanley, C. Nucleic Acids Res. 1993, 21, 5332-5336. (22) Buchardt, O.; Egholm, M.; Berg, R. H.; Nielsen, P. E. Trends Biotechnol. 1993, 11, 384-386. (23) Butler, J. M.; Jiang-Baucom, P.; Huang, M.; Belgrader, P.; Girard, J. Anal. Chem. 1996, 68, 3283-3287. (24) AmpliType HLA DQa PCR Amplification and Typing Kit: User’s Guide; Perkin Elmer: Norwalk, CT, 1993. (25) Tang, K.; Fu, D.; Kotter, S.; Cotter, R. J.; Cantor, C. R.; Koster, H. Nucleic Acids Res. 1995, 23, 3126-3131. (26) Saiki, R. K.; Walsh, P. S.; Levenson, C. H.; Erlich, H. A. Proc. Natl. Acad. Sci. U.S.A. 1989, 86, 6230-6234. (27) PNA synthesis on the Expedite 8909 Nucleic acid Synthesis System. PerSeptive Biosystems Manual; PerSeptive Biosystems: Framingham, MA, 1995.
Table 1. Stringency Washing Buffer Compositiona buffer A
buffer B buffer C buffer D a
50 mM Tris-HCl (pH 7.4) 1 mm DTT (dithiothreitol, 99%, from Aldrich) 0.1% BSA (bovine serum albumin, from Life Technologies, 50 mg/mL) 0.1% SDS in buffer A buffer A + 1 M NaCl (2:1 mixture) 1 mM DTT
All buffers made according to ref 26.
Figure 1. Affinity capture assay for DQA typing. (A) Streptavidincoated magnetic beads capture biotynylated DNA in a 1.5 mL tube. A magnet is used to separate the captured DNA; (B) 0.1M NaOH is used to denature captured dsDNA into ssDNA; (C) the captured DNA serves as a template for PNA probe hybridization; (D) stringency washing of bound PNA/DNA/beads conjugate to remove nonspecific PNA probes; (E) detecting the bound PNA probes directly from the beads by MALDI. The detected molecular weight of the PNA probe indicates the DQA type of the DNA sample.
for each sample were taken along a search patten of serpentine movement across the plate extending to the edges. All measurements with a signal/noise ratio of 10 and data intensity between 1000 and 35 000 counts on an arbitrary scale were recorded, with the best three spectra being averaged and reported. Other MALDI conditions are as follows: laser power, 420-450 stopper motor counts; accelerating voltage, 20 000 V; guide wire, 0.3% of accelerating voltage; grid voltage, 70% of accelerating voltage; and 25 scans averaged. Only positive ion mass spectra were examined. External mass calibration was performed using two PNAs of known molecular weight: PNA(2) (MW ) 4870.4) and PNA(4) (MW ) 4035.5). All the masses reported here are corrected molecular masses obtained from protonated molecular weights. All spectra reported here are smoothed by a 19-points SavitskyGolay order. The sinapinic acid (SA) matrix was purchased from Aldrich (Milwaukee, WI) and used without purification. Analytical Chemistry, Vol. 69, No. 23, December 1, 1997
4895
Table 2. List of PNA Probesa probe
sequence (5′f3′)
DQA1 PNA(1)b DQA2 PNA(2)b DQA3 PNA(3) DQA4 PNA(4)
TGAGTTCAGCAAATTTGGAG Gly-CAGCAAATTTGGAG TTCCACAGACTTAGATTTGAC TCCACAGACTTAGATTTG TTCCGCAGATTTAGAAGATT CCGCAGATTTAGAAG TGTTTGCCTGTTCTCAGAC TTTGCCTGTTCTCAG
calcd PNA MW 4469.0
Table 4. Detected Molecular Weights of PNA Probes in Typing of Different Individuals’ DQA Four Types
1,1
4870.4 4111.5 4035.5
a PNAs were designed to mimic DNA probes, which are underlined in DNA probe sequences. Reference 23. b PNA probes were purchased from PerSeptive Biosystem (Framingham, MA).
DQA1
DQA typea
1,2 1,3 1,4
4473.7 4466.7 4470.8 4469.0 4469.0 4470.2 4468.5 4469.2 4476.3 4473.1 4474.5 4474.0
0.11 -0.05 0.04 0.00 0.00 0.03 -0.01 0.00 0.16 0.09 0.12 0.11
2,2
Table 3. Sequence Polymorphism of DQA4 Main Types (Alleles) and Designed Sequence-Specific PNA Probes
2,3
sequencea (5′ 3′) allele no. 1 GGTGGCCTGAGTTCAGCAAATTTGGAGGTTTTGACCCGCAGGG
2,4
PNA(1) 2
AGTTGCCTCTGTTCCACAGACTT----AGATTTGACCCGCATT
3
AGTTGCCTCTGTTCCGCAGATTTAGAAGATTTGACCCGCATT
PNA(2)
PNA(3) 4
DQA2
% accub
DQA3
% accu
4862.0 4863.1 4864.4
-0.09 -0.08 -0.23 -0.07 -0.04 -0.29 -0.01 0.01 -0.16
3,3
4109.8 4117.3 4109.0
4095.3 4106.1 4107.4 4116.6 4108.4 4110.3
3,4
-0.02 0.05 0.10
a The underscore indicates the sequence polymorphic site, the dashed line indicates the deletions in the sequence. There are six base mutations and four base deletions in the DNA sample sequence between alleles 1 and 2 which are types by PNA probes; there are seven base mutations in the DNA sample sequence between alleles 1 and 3 which are types by PNA probes; there are five base mutations in the DNA sample sequence between alleles 1 and 4 which are types by PNA probes.
PNA Probes. Designed PNA probes are illustrated in Table 1. Synthesis, purification, and characterization of these PNA probes by HPLC and MALDI were described earlier.23 DNA Sample. Genomic DNA was isolated from whole blood of individuals using the Purgene DNA kit and following the protocol from the manufacturer (Gentra Systems, Inc. Minneapolis, MN). DNA Amplification and HLA-DQA Typing. DNA samples were amplified and typed for their HLA-DQA type using AmpliType HLA-DQA PCR amplification and typing kit24 (Perkin Elmer, Branchburg, NJ) and following the suggested protocol from the manufacturer. The DNA sequence from PCR amplification for this study has a size of 242 and 239 bp for alleles 2 and 4, respectively. Affinity Capture Assay for DQA Typing. Allele-specific PNA probes were designed to mimic allele-specific DNA probes which are currently used in the DQA typing.26 An affinity capture assay, using streptavidin-coated magnetic beads and a magnetic separation workstation (PerSeptive Diagnostics, Cambridge, MA), was performed as previously described with some differences. The assay is illustrated in Figure 1. For immobilization of each sample, 200 µL of streptavidincoated magnetic beads (BioMag streptavidin, PerSeptive Diagnostics, Cambridge, MA), with a concentration of 1 mg/mL, was 4896 Analytical Chemistry, Vol. 69, No. 23, December 1, 1997
4036.6 4034.1 4035.1
0.03 -0.03 -0.01
4036.2 4038.9 4027.6
0.02 0.08 -0.20
4039.6 4033.8 4034.9 4033.7 4031.1 4036.8
0.10 -0.04 -0.01 -0.04 -0.11 0.03
-0.04 0.14 -0.06
-0.39 -0.13 -0.10 0.12 -0.08 -0.03
4,4
GTTTGCCTGTTCTCAGACAATTT----AGATTTGACCCGCATT PNA(4)
% accu
-0.17 -0.15 -0.12 4110.8 4113.4 4115.6
4866.0 4866.6 4859.4 4866.9 4868.5 4856.3 4870.1 4871.0 4862.5
DQA4
% accu
a DQA types were determined by using AmpliType HLA-DQA PCR Amplification and Typing Kit. b Accuracy was calculated as %accu ) (measured molecular weight - calculated molecular weight)/calculated molecular weight) × 100.
Table 5. Mass Accuracy of Measured PNA Probesa probe
calcd mass (Da)
average of measd mass (Da)
RSD
accuracy (%)
PNA(1) PNA(2) PNA(3) PNA(4)
4469.0 4870.4 4111.5 4035.5
4472.2 4865.0 4109.5 4035.4
6.14 8.03 5.44 3.44
0.07 -0.11 -0.05 -0.00
a
Average of at least 30 measurements for each probe.
washed twice with binding and washing buffer (B&W buffer)25 (20 mM Tris-HCL, pH 8.0, 2 mM EDTA, 2 M NaCl) and resuspended in 20 µL of the same buffer. Then, 25-50 µL of biotinylated PCR product was added, and the mixture was reacted at room temperature for 15-30 min. For denaturing, 15 µL of 0.1 M NaOH was added to the immobilized DNA sample, and the mixture was incubated at room temperature for about 5 min. The beads were then washed twice with deionized water to remove NaOH and other impurities. For hybridization, a mixture containing 3 pmol of each PNA probe (10 µM) was added to denatured DNA samples, followed by addition of deionized water to a total volume of 20 µL. The hybridization was allowed to occur at room temperature for about 30 min. Complementary PNA probes hybridized onto the DNA template to form a PNA/DNA/beads conjugate. Noncomplementary probes were removed with stringent washes by using the buffers listed in Table 1 in the following order: Wash at room temperature 2× with buffer A, 2× with buffer B, 2× with buffer C, 1× with buffer D, and 1× with deionized water. Then wash the beads in 1× buffer A at 50 °C
Figure 2. Mass spectra of 10 combinations of the PNA probes for the four primary DQA alleles. (A) An equimolar mixture of the four PNA probes used in this typing assay; (B) an individual with DQA type (2,2); (C) an individual with DQA type (1,1); (D) an individual with DQA type (2,3); (E) an individual with DQA type (4,4); (F) an individual with DQA type (4,4); (F) an individual with DQA type (1,2); (G) an individual with DQA type (1,4); (H) an individual with DQA type (3,4); (I) an individual with DQA type (1,3); (J) an individual with DQA type (2,4); (K) an individual with DQA type (3,3).
for about 15-30 min. Finally, the beads were suspended in 4-5 µL of matrix SA with a concentration of 22 mg/mL in 50% of ACN/ H2O and 0.1% TFA. One microliter of the beads/matrix mixture was placed in the sample well and allowed to air dry. The samples were then subject to MALDI analysis following the methods described earlier in this report. RESULTS AND DISCUSSION HLA-DQA Typing. PNA probes were designed, synthesized, purified, and used as mimics of allele-specific DNA probes for HLA-DQA typing (Table 2).) The synthetic PNA probes were 1518 units long, because PNAs have a higher affinity for DNA hybridization. It is not necessary to prepare PNA probes which have 20-25 nucleotides (a typical length for an oligonucleotide probe).26,27 The sequence and polymorphism of DQA alleles as well as the PNA probe region used to recognize this polymorphism are shown in Table 3. A total of 28 individuals with 10 DQA types from possible combinations of DQA1, DQA2, DQA3, and DQA4 alleles were typed by the affinity capture assay. Each DNA sample was analyzed in triplicate, testing the reproducibility of the method. When the PNA/DNA/beads conjugate was analyzed by MALDI,
Figure 3. Mass spectra of mixed DNA samples. (A) An equimolar mixture of the four PNA probes used in this study; (B) detected PNA probe from one individual with DQA type (2,3); (C) detected PNA probe from another individual with DQA type (1,2); (D) detected PNA probes from a mixed DNA sample from the two individuals in B and C.
only the PNA probe was detected by MALDI. The immobilized DNA strand was never detected by MALDI using the positive ion conditions.18,25 The DQA type of an individual was determined from the mass of the PNA probe which was detected by the MALDI analysis. For example, an individual with a DQA type of (1,2) will capture PNA probes (1) and (2); an individual with DQA type of (3,3) will only show PNA probe (3) . The DQA types of each individual were also determined by using AmpliType HLADQA PCR amplification and typing kit.24 The DQA genotypes determined by both methods are in total agreement (Table 4). Mass accuracy in MALDI analysis is within (0.2% for 80% of all four measured PNA probes, with a few of the measured PNA probes having a mass accuracy of (0.4%. The average mass accuracy of all measured PNA probes and their relative standard deviations are reported in Table 5, and all are within an acceptable range for identification of all individuals by detected PNA probes. Even with the accuracy of (0.4%, there can be no misinterpretation of the detected PNA probes, because the two probes with the closest masses are DQA3 (MW ) 4111.5) and DQA4 (MW ) 4035.5) which have a mass difference of 76 Da. With an error of -0.4%, DQA3 will give a mass of 4095 Da and DQA4 a mass of 4051.6 Da. MALDI can easily separate these two ions. When performing the affinity capture assay, a blank sample (same amount of deionized water substituted for DNA) and a nonDQA DNA sample (which was not amplified at the HLA-DQA Analytical Chemistry, Vol. 69, No. 23, December 1, 1997
4897
region) were typed as controls. In both control samples, no captured PNA probe was detected by MALDI. A normal amount of PCR product (25-50 µL), which is the same amount used in DQA typing by the AmpliType kit, was used in this affinity capture assay. The detection sensitivity of MALDITOFMS is suitable for analysis of DNA amplified by PCR. Detected PNA probe peaks in MALDI are sharp and clear and provide unambiguous results (Figure 2). Among the samples tested, approximately 20% of the spectra show a relatively low signal-to-noise ratio (S/N) (Figure 3(I)). The low S/N may be due to the low DNA concentration from PCR amplification, since multiple analyses from the same DNA sample also gave low S/N spectra in MALDI-TOFMS analysis. Since hybridization between DNA and PNA can be completed in less than 30 s,28 the time needed for immobilization and washing can be further examined to shorten assay time. The assay was validated by analyzing multiple samples of the same DNA and by different laboratory personnel performing all steps of the assay. In all cases, the results were reproducible. Typing Mixed DNA Samples. A biological sample found at a crime scene can consist of a mixture of DNA from more than one individual, such as in a rape case. To test whether the current method could be used for the analysis of a mixed DNA sample, DNA samples from two individuals were mixed. The mixed DNA sample was then typed, and it was compared with the DNA from each person that was typed individually. The detection of a mixture depends, in part, on the fact that any one individual can have at most two alleles of a given gene; the presence of more than two alleles in a sample indicates a mixture (Figure 3). A mixture cannot necessarily be detected, however, if the two contributors to a mixture contribute no more than two alleles in total.2 SUMMARY HLA-DQA typing is currently performed using a commercially available kit. This analysis is an allele-specific hybridization assay (28) Hyrup, B.; Nielsen, P. E. Bioorg. Med. Chem. 1996, 4, 5-23. (29) Belgrader, P.; Del Rio, S. A.; Turner, K.; Marino, M. A.; Weaver, K. R.; Williams, P. E. Biotechniques 1995, 19, 426-432. (30) Belgrader, P.; Marino, M. A. Lab. Rob. Autom. 1997, 9, 3-7.
4898
Analytical Chemistry, Vol. 69, No. 23, December 1, 1997
based on annealing a PCR product to a panel of DNA probes immobilized on a membrane strip. This study has demonstrated the feasibility of using allele-specific PNA probes with MALDITOFMS detection for DNA typing. We have applied this method to HLA-DQA genotyping for detection of four alleles: DQA1, DQA2, DQA3, and DQA4. A reproducible, sensitive, and accurate method for detecting the PNA probes was achieved with MALDITOFMS. A novel analytical method was developed to rapidly type individuals for their HLA-DQA four main genotypes. It can also be used to identify whether a DNA sample is a mixture (if more than two alleles are detected). Although only four probes were used in this study, expanding the analyses to include more DQA alleles, suballeles 1.1, 1.2, and 1.3, should not be difficult. Since there is only one base difference between the DQA1 suballeles, more stringent hybridization and wash conditions should be used when performing this assay. Therefore, all alleles in the DQA region can be typed using the current method. Potentially, an automated robotics system29,30 combined with the use of 96 well microtiter plates16 can be used to prepare the DNA samples and perform the affinity capture assay. Multiple samples in 96 well plates can be processed at the same time. Eventually, a very high throughput operation is possible. MALDI-TOFMS can be cost effective when large-scale testing is performed. More importantly, MALDI-TOFMS offers speed for large-scale tests. It should be noted that the PNA probes are more costly than DNA probes. ACKNOWLEDGMENT The authors thank Mike Marino, Jonathan Smith, Lois Tully, and Palo Lecci for their assistance. P.J.B., J.B., and J.E.G. thank the staff of the Armed Forces DNA Identification Laboratory for the use of their facilities and their mass spectrometer. The views stated here are the opinions of the authors and in no way reflect the position of the U.S. Army, U.S. Air Force, or U.S. Department of Defense. Received for review June 18, 1997. Accepted August 25, 1997.X AC970639U X
Abstract published in Advance ACS Abstracts, October 15, 1997.
