Double Gene Targeting Multiplex Polymerase ... - ACS Publications

Article pubs.acs.org/JAFC

Double Gene Targeting Multiplex Polymerase Chain Reaction− Restriction Fragment Length Polymorphism Assay Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products M. A. Motalib Hossain,† Md. Eaqub Ali,*,†,‡ Sharifah Bee Abd Hamid,† Asing,† Shuhaimi Mustafa,§ Mohd Nasir Mohd Desa,§ and I. S. M. Zaidul∥ †

Nanotechnology and Catalysis Research Centre (NANOCAT) and ‡Centre for Research in Biotechnology for Agriculture (CEBAR), University of Malaya, Kuala Lumpur 50603, Malaysia § Institute of Halal Products Research, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia ∥ Deparment of Pharmaceutical Technology, Faculty of Pharmacy, International Islamic University, Kuantan 25200, Pahang, Malaysia S Supporting Information *

ABSTRACT: Beef, buffalo, and pork adulteration in the food chain is an emerging and sensitive issue. Current molecular techniques to authenticate these species depend on polymerase chain reaction (PCR) assays involving long and single targets which break down under natural decomposition and/or processing treatments. This novel multiplex polymerase chain reaction− restriction fragment length polymorphism assay targeted two different gene sites for each of the bovine, buffalo, and porcine materials. This authentication ensured better security, first through a complementation approach because it is highly unlikely that both sites will be missing under compromised states, and second through molecular fingerprints. Mitochondrial cytochrome b and ND5 genes were targeted, and all targets (73, 90, 106, 120, 138, and 146 bp) were stable under extreme boiling and autoclaving treatments. Target specificity and authenticity were ensured through cross-amplification reaction and restriction digestion of PCR products with AluI, EciI, FatI, and CviKI-1 enzymes. A survey of Malaysian frankfurter products revealed rampant substitution of beef with buffalo but purity in porcine materials. KEYWORDS: double gene-targets, multiplex PCR-RFLP, molecular fingerprints, species-specific identification

■

INTRODUCTION

Authentication of food components using physical attributes is either impossible or extremely difficult because of the loss of morphological biomarkers during processing and packaging.12,13 In this regard, molecular techniques have shown great success. 1 Although the protein- and lipid-based biomarkers are less effective because of their susceptibility to denaturation and/or modification under processing conditions,14 DNA biomarkers involving mitochondrial DNA have shown great success because of their abundant presence in multiple copies in most cells along with intraspecies conserved and interspecies polymorphic fingerprints.13,15,16 Polymerase chain reaction (PCR)-based detection schemes are amazing because they amplify specific DNA targets even from single or a few copies to easily detectable quantities under complex matrices, eliminating sample scarcity and saving purification cost and time.6,17 The species-specific PCR restriction fragment length polymorphism (PCR-RFLP) assays are especially interesting because they offer the opportunity to authenticate a product by restrictive digestion of the amplified PCR products using one or more restriction enzymes (REs).6 Using the sequence variation that exists within a defined region of DNA, the differentiation of even closely related species is

Authentication of animal species in food products is an emerging issue having implications for health, religion, culture, and fair economic practices.1,2 The recent food scandals involving animal species is not limited to the inclusion of horse meat and pork in beef products;3,4 pork and rat meat in lamb products;5 and monkey, dog, and cat meat in exotic dishes.6 These issues are highly alarming because most of these animal adulterants are potential carriers of infecting zoonoses and strictly prohibited by several religious, cultural, and regulatory laws. Beef and buffalo are economically and culturally important meat having the top rate of consumption in most parts of the world. Religious, cultural, and geographical restrictions and preferences over the consumption of beef, buffalo, and pork are huge, and social outcry over their adulteration and consumption have taken place from time to time.7,8 While Egyptians prefer buffalo because of their cultural preferences, some Europeans and Indians avoid beef because of the fear of bovine spongiform encephalopathy (BSE) and religious requirements.9 On the other hand, pork is totally unacceptable to the Muslim, Jewish and select Christian dominations despite its popularity in Western countries.10,11 Thus, the social, religious, health, and business interests in beef, buffalo, and pork are enormous, and there should be a trustworthy but lowcost method for their discrimination in the food chain. © 2016 American Chemical Society

Received: Revised: Accepted: Published: 6343

May 17, 2016 July 15, 2016 July 18, 2016 July 18, 2016 DOI: 10.1021/acs.jafc.6b02224 J. Agric. Food Chem. 2016, 64, 6343−6354

Article

Journal of Agricultural and Food Chemistry possible using a PCR-RFLP assay.18 Such assays have been successfully applied to discriminate closely related species such as cattle, yak, and buffalo;19 cattle−buffalo and sheep−goat;20 swine and wild boar;21 and various fish species.22 However, these methods are mostly based on single and long-length DNA targets which break down under natural or environmental decomposition and food processing treatments, making them less trustworthy and inconclusive for forensic investigation.23,24 To the best of our knowledge, no RFLP authentication has been reported for mPCR products wherein multiple amplified products do exist. In this regard, multiplex PCR-RFLP (mPCRRFLP) assay, especially the double gene targeting one with short amplicon targets, would be especially useful and trustworthy for the simultaneous detection of beef, buffalo, and pork products in various food products. Because of the presence of more than one target for the same species, the detection of the missing target would be complemented by a second target because it is highly unlikely that both targets would be broken down under the state of decomposition. To address this issue, we report for the first time a double gene targeting PCR-RFLP assay with short amplicon targets for the discriminatory authentication of bovine, buffalo, and porcine materials in frankfurter formulation, a popular food item widely consumed across the globe.

■

Table 1. Formulation of Model Frankfurter frankfurter (≥70 g/piece) ingredients minced meat soy protein starch/breadcrumb chopped onion chopped ginger cumin powder garlic power black pepper tomato paste butter saltc othersb,c

beef a

45 7.5 6.5 2.5 0.15 0.75 0.5 0.23 2.0 2.5 SA SA

buffalo a

45 7.5 6.5 2.5 0.15 0.75 0.5 0.23 2.0 2.5 SA SA

pork 45a 7.5 6.5 2.5 0.15 0.75 0.5 0.23 2.0 2.5 SA SA

a To prepare ≥70 g frankfurter specimens, 10%, 1%, and 0.1% of beef, buffalo, and pork were mixed with a balanced amount of respective minced meat. bFlavoring agents and enhancers. cSA, suitable amounts.

Ethanolic wash buffer was used to remove the contaminants, and the purified DNA was eluted in an elution buffer. A 100 mg sample was taken for the extraction of DNA from wheat (Triticum aestivum), onion (Allium cepa), garlic (Allium sativum), ginger (Zingiber officinale), and pepper (Capsicum annuum) using DNeasy Plant Mini Kit (QIAGEN GmgH, Hilden, Germany) following the manufacturer’s instruction. NucleoSpin Food DNA kit (Macherey-Nagel GmbH & Co. KG, Duren, Germany) was used to extract DNA from food products (frankfurters) (200 mg). The concentration and purity of all extracted DNA were determined using an ultraviolet−visilbe (UV− VIS) spectrophotometer instrument (NanoPhotometer Pearl, Implen GmbH, Germany) based on the absorbance value at 260 nm and absorbance ratio at A260/A280, respectively.28 Design of Species-Specific Primers. Six sets of oligonucleotide primers specific to the cytb and ND5 genes of cow, buffalo, and pig species were designed following a standardized procedure published in our earlier report.25 The designed primers and target amplicon sequences are presented in Table 2. The specificity of the designed primers was ensured by three different testing systems. First, the basic local alignment algorithm search tool (BLAST) against nonredundant nucleotide sequences identified the target species as well as the dissimilarity index value with other species in the NCBI database. Second, the primers were aligned against 29 different nontarget species, of which 17 were land animal, 8 were fish, and 4 were plant species. All sequences were aligned using the MEGA 5 software to identify the conserved and variable sequences to evaluate the presence of mismatched bases. The designed primers were purchased from the First Base Laboratories Sdn. Bhd. The final species-specificity was confirmed in a practical PCR experiment through a cross-amplification reaction in the presence of the target and 27 different nontarget species. Multiplex PCR Assay. Prior to the optimization of the mPCR assay, simplex PCR assay was performed for each of the target species with individual set of primers as described in our earlier report.25 The simplex PCR was performed in a 25 μL reaction mixture comprising 5 μL of 5X GoTaq Flexi Buffer, 0.2 mM each of dNTP, 2.5 mM MgCl2, 0.625 U GoTaq Flexi DNA Polymerase (Promega, Madison, WI, United States), 0.4 μM of each primer and 2 μL (20 ng/μL) of DNA template. For negative control, template DNA was replaced by distilled water. In the simplex PCR, 0.4 μL universal eukaryotic primers (forward primer: AGGATCCATTGGAGGGCAAGT and reverse primer: TCCAACTACGAGCTTTTTAACTGCA) that targeted 99 bp site of eukaryotic 18S rRNA gene29 was added as positive control for eukaryotes. All PCRs were performed in an ABI 96 Well Verity Thermal Cycler (Applied Biosystems, Foster City, CA, United States) with an initial denaturation at 95 °C for 3 min followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30−35 s, extension at 72 °C for 40 s and the final extension at 72 °C for 5 min.

MATERIALS AND METHODS

Meat Sample Collection. Authentic muscle tissues of cow (Bos taurus), buffalo (Bubalus bubalis), goat (Capra hiscus), lamb (Ovis aries), chicken (Gallus gallus), duck (Anas platyrhychos), pigeon (Columba livia), quail (Coturnix coturnix), cod (Gadus morhua), salmon (Salmo salar), pangas (Pangasius pangasius), tuna (Thunnus orientalis), tilapia (Oreochromis niloticus), rohu (Labeo rohita), frog (Rana kunyuensis), and turtle (Cuora amboinensis) were purchased in triplicate on three different days from various wet markets and supermarkets (Pasar Borong Selangor, Serdang, Pudu Wet Market, Kuala Lumpur and Tesco, Petaling Jaya, Selangor). Pork (Sus scrofa) was purchased in triplicate from three different vendors from a Chinese wet market located at Seri Kambangan in the Selangor state of Malaysia. Three different animals of dog (Canis lupus familiariz), cat (Felis catus), rat (Rattus rattus) and monkey (Macaca fascicularis) species were killed by Dewan Bandaraya Kuala Lumpur (DBKL) as part of population control and Wildlife Malaysia for other purposes, and muscle tissues were collected following institutional and national laws.24 All samples were transported under ice chilling and stored at −20 °C prior to DNA extraction.25 Preparation of Frankfurter. Model beef, buffalo, and pork frankfurters were made in the laboratory following Razzak et al.26 (Table 1). The prepared frankfurters were deliberately contaminated by spiking of 1%, 0.5%, and 0.1% of buffalo and pork, beef and pork, and beef and buffalo meat, respectively. As-prepared 0.1% contaminated frankfurters were autoclaved at 121 °C under 15 psi pressure for 2.5 h.27 To authenticate the four PCR products of beef and buffalo (Cocytb, CoND5, Bucytb, and BuND5) by RFLP analysis, beef and buffalo frankfurters were adulterated by spiking buffalo and beef, respectively, and were heat-treated by boiling at 98 °C for 90 min and autoclaving at 121 °C under 15 psi pressure for 2.5 h. Porcine frankfurters were also boiled at 98 °C for 90 min and autoclaved at 121 °C under 15 psi pressure for 2.5 h, and RFLP analysis was performed in a separate assay. All samples were stored at −20 °C until DNA extraction. DNA Extraction. Total DNA from meat and fish samples was extracted using Yeastern Genomic DNA Mini Kit (Yeastern Biotech Co., Ltd., Taipei, Taiwan).6 Briefly, 20 mg of muscle tissue was ground and homogenized with a micro pestle followed by the addition of lysis buffer and proteinase K. The mixture was incubated at 60 °C for cell lysis and protein degradation. The spin column technique was used for the attachment of DNA to the glass fiber matrix during centrifugation. 6344

DOI: 10.1021/acs.jafc.6b02224 J. Agric. Food Chem. 2016, 64, 6343−6354

Article

Journal of Agricultural and Food Chemistry Table 2. Sequences of Primers Used in This Study target gene

sequence (5′−3′)

amplicon size (bp)

Cocytb

name

cow (Bos taurus)

species

Cytb

120

CoND5

cow (Bos taurus)

ND5

Bucytb

buffalo (Bubalus bubalis)

Cytb

BuND5

buffalo (Bubalus bubalis)

ND5

Pocytb

pork (Sus scrofa)

Cytb

PoND5

pork (Sus scrofa)

ND5

forward: CGGCACAAATTTAGTCGAAT reverse: TGGACTATGGCAATTGCTATG forward: GGTTTCATTTTAGCAATAGCATGG reverse: GTCCAATCAAGGGTATGTTTGAG forward: GGGTTCTAGCCCTAGTTCTCTCT reverse: ATGGCCGGAACATCATACTT forward: TCGCCTAGCTTCTTACACAAAC reverse: TGGTTTGTGACTGTGATGGAT forward: TATCCCTTATATCGGAACAGACCTC reverse: GCAGGAATAGGAGATGTACGG forward: GATTCCTAACCCACTCAAACG reverse: GGTATGTTTGGGCATTCATTG

PCR products were visualized in 2% agarose gel stained with Florosafe DNA stain (First Base Laboratories Sdn. Bhd., Selangor, Malaysia) under a gel documentation system (AlphaImager HP, Alpha Innotech Corp., California, United States) (data not shown). After optimizing simplex PCR assays for individual species, duplex, triplex, tetraplex and finally hexaplex PCR systems were developed as given in Tables 3 and

dNTP (mM)

MgCl2 (mM)

tag pol (unit)

primer (μM)

duplex and triplex tetraplex multiplex

0.2 0.25 0.25

2.5 3.5 4.0

0.94 1.0 1.25

0.2−0.4 0.16−0.4 0.12−0.6

a

Table 4. Cycling Parameters of PCR Reactions 35 cycles (40 cycles for multiplex) initial denaturation

duplex and 95 °C for triplex 3 min tetraplex 95 °C for 3 min multiplex 95 °C for 5 min

final extension

denaturation

annealing

extension

95 °C for 30 s 95 °C for 40 s 95 °C for 50 s

60 °C for 45 s 60 °C for 60 s 60 °C for 90 s

72 °C for 72 °C for 45 s 5 min 72 °C for 72 °C for 50 s 5 min 72 °C for 72 °C for 50 s 7 min

138 146 73

target

restriction enzyme

amplicon size (bp)

fragment size (bp)

Cocytb CoND5 Bucytb BuND5 Pocytb PoND5

EciI FatI FatI AluI CviKI-1 FatI

120 106 90 138 146 73

75, 45 87, 19 50, 40 130, 8 80, 45, 21 52, 21

down and incubated at 37 °C with EciI and AluI and 55 °C with FatI in a shaking water bath for 60 min. Finally, the digestion reaction was stopped by heating the reaction mixtures at 65 °C for EciI and 80 °C for AluI and FatI for 20 min. The tetraplex PCR products of Cocytb, CoND5, Bucytb, and BuND5 were digested simultaneously in a 25 μL reaction mixture containing 16 μL of unpurified PCR product, 2.5 μL of digestion buffer, 1.5 μL of AluI, 2.5 μL of EciI, and 2.5 μL of FatI. The reaction was mixed by gentle shaking, spun down, and incubated in a shaking water bath first at 37 °C for 60 min and then at 55 °C for 60 min. Enzymatic digestion was stopped by heating the mixture at 80 °C for 20 min in a water bath. The digests were separated in an automated QIAxcel Advanced Capillary Electrophoresis System (QIAGEN GmbH, Hilden, Germany) using a QIAxel DNA HighResolution Kit (QIAGEN GmbH, Hilden, Germany). RFLP Analysis of Pork PCR Products. Pork Pocytb and PoND5 PCR products were digested with CviKI-1 and FatI restriction endonucleases (New England Biolab, Ipswich, MA, United States) in a separate reaction tube of 25 μL reaction volume comprising 1 μg of unpurified PCR product, 1× digestion buffer supplied with the enzyme, 1U of each enzyme, and a required amount of sterilized distilled water. The reaction mixtures were mixed gently and spun down followed by incubation at 37 °C for CviKI-1 and 55 °C for FatI in a shaking water bath for 60 min to digest the targets properly. Postdigested reaction was inactivated by heating the mixtures for 20 min at 80 °C for FatI while no inactivation was required for CviKI-1 enzyme.

In all PCR experiments, 5 μL of 5X GoTaq Flexi Buffer was used.

PCR reaction

90

Table 5. Restriction Digests of the PCR Products

Table 3. Concentration of PCR Componentsa PCR

106

4. Because of the poor resolution of agarose gel, multiplex PCR products were separated and visualized in an automated QIAxcel Advanced Capillary Electrophoresis System (QIAGEN GmbH, Hilden, Germany). Enzymatic Digestion and RFLP Analysis. The sequences of the amplified PCR products were retrieved from NCBI and a publicly available NEBcutter version 2.0 software (http://tools.neb.com/ NEBcutter) was used to select the specific and appropriate restriction endonucleases for all the PCR amplicons prior to test the mPCRRFLP assay to ensure distinctive RFLP patterns for all targets. The restriction patterns of the PCR amplicons of beef, buffalo, and pork mitochondrial cytb and ND5 genes are given in Table 5. RFLP Analysis of Beef and Buffalo PCR Products. The simplex PCR products of beef cytb and buffalo ND5 genes were digested with EciI and AluI restriction endonucleases (New England Biolab, Ipswich, MA, United States), respectively. On the other hand, beef ND5 and buffalo cytb products were digested with FatI. The total volume of each digestion reaction was 25 μL, which was composed of 1 μg of unpurified PCR product, 1× digestion buffer (supplied with the enzyme), 1U of each enzyme, and a balanced amount of sterilized distilled water. The reaction mixtures were gently mixed and spun

■

RESULTS AND DISCUSSION Quality and Quantity of Extracted DNA. Total genomic DNA was extracted from pure, admixed, and meat products (beef, buffalo, and pork frankfurters) under raw and processed (boiled and autoclaved) states. All specimens were made on three different dates by three independent analysts as documented in our earlier report.13 The concentration and purity of the extracted DNA were determined at ≥100 ng/μL based on absorbance at 260 nm and absorbance ratio at 260/ 280 nm, and the lower concentrations were prepared by serial dilution using deionized and nuclease free distilled water because spectrophotometric measurements at low concentrations were not reproducible. The 260/280 nm absorbance of 6345


Article

Journal of Agricultural and Food Chemistry

Figure 1. Specificity test of the developed mPCR assay. In the gel images of panels a and b, lane M, DNA ladder; lane N, negative template control; and lane 1, mPCR products of cytb and ND5 of beef, buffalo, and pork. In panel a, lanes 2, 3 and 4, PCR products of cytb and ND5 of beef, buffalo, and pork, respectively; lanes 5−15, PCR products from goat, lamb, dog, cat, rabbit, monkey, donkey, chicken, duck, pigeon, and quail, respectively. In image b, lanes 2−15, PCR products from rat, salmon, tuna, cod, tilapia, rohu, pangas, frog, turtle, wheat, onion, garlic, ginger, and pepper, respectively.

even a single base mismatch at the 3′ end often interferes with PCR efficiency and/or results in amplification failure.6 Considering this pitfall, this report critically evaluated the mismatched bases in the primer annealing regions. In this study, six pairs of primers (two pairs of each species) were designed targeting cytb and ND5 genes of cow, buffalo, and pig species to develop a double gene targeted mPCR assay with short length of amplicons (Table 2). The designed primer sequences were aligned in silico against the similar regions of 29 nontarget species including 17 terrestrial animal, 8 fish, and 4 plant species, as cited in Design of Species-Specific Primers. Complete sequence matching was found only with cow, buffalo, and pig species, and 3−20 nucleotide (12.5−80%) mismatches

all of the samples was 1.7−2.0, which indicated good quality DNA in all specimens.28 The amount of DNA extracted from animal and fish muscle tissue (20 mg) was 74−152 ng/μL, from plant species (100 mg) was 46−134 ng/μL, and from frankfurter (200 mg) was 33−57 ng/μL. PCR Specificity. Species-specific PCR assay is a simple and low-cost technique that could be performed in most laboratories; it is often conclusive, and has been widely used for meat speciation. Currently, simplex19,23 and multiplex PCR assays24,29 have been proposed for the authentication of common meat in the food chain, and the development of effective primers always plays a key role in the successful identification of authentic species.25 Studies demonstrate that 6346


Article


Figure 2. Gel image (a) and the electropherograms (b−d) of mPCR for the detection of double gene-targeted beef, buffalo, and pork in deliberately adulterated model beef, buffalo, and pork frankfurters under raw and processed states. In the gel image, M, Ladder; lanes 1−3, m-PCR of beef frankfurter spiked with 1%, 0.5%, and 0.1% of buffalo and pork, respectively, under raw state; lanes 5−7, mPCR of buffalo frankfurter spiked with 1%, 0.5%, and 0.1% of beef and pork, respectively, under raw state; lanes 9−11, mPCR of pork frankfurter spiked with 1%, 0.5%, and 0.1% of beef and buffalo, respectively, under raw state; lanes 4, 8, and 12, mPCR of heat-treated (autoclaved for 2.5 h) 0.1% adulterated beef, buffalo, and pork frankfurter, respectively; lane N, negative control. The corresponding electroferograms of lane 4, 8, and 12 are shown labeled as b, c, and d, respectively.

were found with other species. The pairwise distance was also computed using the neighbor-joining method;30 the lowest distance (0.144) was observed between the cow and goat species, and the highest (1.993) was found between the cow and wheat species (data not shown). These indicated adequate genetic distances among the studied species, eliminating the probability of any cross-target detection.12 Moreover, the analysis of phylogenetic tree demonstrated similar findings, supporting the results of other in silico tests (data not shown). Finally, the theoretical results were experimentally validated by an authentic PCR test against the target and 27 different nontarget species using 20 ng of DNA extracted from all of the tested samples. Specific PCR products [106, 138, and 73 bp (ND5 of beef, buffalo, and pork) and 120, 90, and 146 bp (cytb of beef, buffalo, and pork)] were found only from beef, buffalo, and pork, and such a product was absent from the other samples (goat, lamb, dog, cat, rabbit, monkey, donkey, chicken, duck, pigeon, quail, rat, salmon, tuna, cod, tilapia, rohu, pangas, frog, turtle, wheat, onion, garlic, ginger, and pepper). On the other hand, the use of the universal eukaryotic primers which amplified 99 bp product from all species reflected the presence

of good quality DNA in all tubes, eliminating the possibility of any false-negative detection (Figures 1SM−6SM). After confirmation of the simplex PCR, the mPCR system was developed step by step through the duplex, triplex, and tetraplex and hexaplex (multiplex) PCR systems. The novel mPCR system clearly amplified targeted products (73, 90, 106, 120, 138, and 146 bp) from beef, buffalo, and pork samples, and no cross-amplifications were observed in any nontarget species (Figure 1), confirming that the developed mPCR assay was highly specific for the discriminatory detection of beef, buffalo, and pork. Earlier, several simplex7,8,14,31 and multiplex PCR32−34and PCR-RFLP18,35,20assays were proposed for the authetication of beef, buffalo, and pork. However, all of those were based on single gene target and longer amplicons (>150 bp) which are broken down under harsh food processing treatments, leading to the amplification failure or truncated PCR products, incurring extra cost and compromising reliability.36 In this study, we have developed double gene targeted mPCR assay involving short length of the targets (73−146 bp) which are thermodynamically more stable than those of the longer targets. 6347


Article


Figure 3. RFLP analysis of simplex and mPCR products before (lanes 1, 3, 5, 7, and 9) and after (lanes 2, 4, 6, 8, and 10) restriction digestion. In the gel image, lanes 1 and 2, cytb of buffalo; lanes 3 and 4, ND5 of beef; lanes 5 and 6, cytb of beef; lanes 7 and 8, ND5 of buffalo; and lanes 9 and 10, mPCR of cytb and ND5 of beef and buffalo. Corresponding electropherograms are shown with labels. 6348


Article


Figure 4. PCR-RFLP analysis of mPCR products of deliberately adulterated raw and heat-treated (boiled and autoclaved) beef (lanes 1−6) and buffalo (lanes 7−12) frankfurters. In gel image, lanes 1 and 2, buffalo-adulterated raw beef frankfurter before and after digestion, respectively; lanes 3 and 4, buffalo-adulterated boiled (98 °C for 90 min) beef frankfurter before and after digestion, respectively; lanes 5 and 6, buffalo-adulterated autoclaved (121 °C and 15 psi pressure for 2.5 h) beef frankfurter before and after digestion, respectively; lanes 7 and 8, beef-adulterated raw buffalo frankfurter before and after digestion, respectively; lanes 9 and 10, beef-adulterated boiled (98 °C for 90 min) buffalo frankfurter before and after digestion, respectively; lanes 11 and 12, beef-adulterated autoclaved (121 °C and 15 psi pressure for 2.5 h) buffalo frankfurter before and after digestion, respectively.

amplicon lengths between 73 and 146 bp; additionally, double gene sites were used as targets for each species to complement a potential missing target. Therefore, this novel mPCR assay offered better reliability but equivalent sensitivity compared to those of other published reports. Authentication by RFLP. Species-specific PCR assay is often conclusive,24 but it has yet to be considered a definitive analytical method because of certain “hard-to-control” features of the amplification process.23,39 For example, it sometimes produces artifacts due to contamination by alien DNA at a minute scale,39,40 but these ambiguities or doubts could be eliminated by the verification of the amplified product through at least one of three different methods, namely, PCR-RFLP assay, probe hybridization, and target product sequencing.41 Probe hybridization is an attractive technique because it can detect multiple species in a single experimental run through the use of multiple labeled probes,42 but this procedure requires purified DNA and is also laborious, expensive, and timeconsuming.6 In contrast, DNA sequencing is a more efficient and reliable tool, but it requires an expensive laboratory setup and is often not suitable for the analysis of processed food under complex matrices43,44 because of the coextraction of the food ingredients that often bring errors into the final results.45 In contrast, the PCR-RFLP assay can overcome all of these limitations and has been widely used to authenticate the original PCR product amplified from a particular gene fragment.46,47 It comprises the generations of a specific fragment profile through restriction digestion with one or two endonucleases. A carefully selected restriction endonuclease cleaves the PCR product at specific recognition sites, producing a set of DNA fragments of different lengths that could be separated and visualized by gel electrophoresis;48 thus, it distinguishes the artificial PCR product from the original through the analysis of the restriction fingerprints.40,49 In this study, the tetraplex PCR products of beef and buffalo were digested simultaneously with three restriction enzymes as cited in Materials and Methods, and clear fingerprints were obtained for each of the four different targets (Figure 3 and Table 5). First, each target was digested separately with an appropriate RE (Table 5) to study its individual restriction patterns in order to eliminate any ambiguities that may arise from the final tetraplex PCR products that were the mixture of

Because of the presence of double targets for each species, this novel assay could complement the detection of a missing target because it is highly unlikely that both gene sites would be lost under the states of decomposition. To the best of our knowledge, this is the first report of a double gene targeted mPCR assay for the differential identification of beef, buffalo, and pork. Specificity and Sensitivity under Complex Food Matrices. Common forms of meat adulteration take place in minced meat products such as frankfurters, meatballs, and burgers.25,37 Therefore, we evaluated the performance of the developed mPCR assay for the screening of beef, buffalo, and pork materials in commercial frankfurters which are very popular all over the world.25 To simulate the commercial matrices, beef, buffalo, and pork frankfurters were made in the laboratory and were deliberately adulterated with 10%, 1%, and 0.1% raw meat of two other target species as described in Materials and Methods. The 0.1% spiked frankfurters of three species were autoclaved at 121 °C and 15 psi for 2.5 h to simulate extensive cooking effect.36 The model beef, buffalo, and pork frankfurters, adulterated with 1%, 0.5%, and 0.1% of buffalo and pork, beef and pork, and beef and buffalo, amplified all the six targets (Figure 2; lanes 1−3, 5−7, and 9−11) representing all three target species. The 0.1% adulterated autoclaved frankfurters also positively amplified six targets for beef, buffalo, and pork (lanes 4, 8, and 12), reflecting the sensitivity and discriminatory attributes of the novel PCR assay. Previously, Razzak et al.26 detected 0.1% porcine, canine, feline, monkey, and rat meat under mixed food matrices using a pentaplex PCR assay where the amplicon size ranged from 108 to 172 bp. Safdar et al.29 also reported a 0.1% limit of detection (LOD) for the identification of ovine, caprine, fish, and bovine material using a tetraplex PCR assay involving 119−271 bp amplicons in heat-treated (133 °C at 300 kPa for 20 min) mixed meat. In another report, Safdar et al.38 documented 0.01% LOD for the identification of horse, soybean, poultry and pork with 85−212 bp amplicon targets. However, instead of using processed samples, they used raw meat. Earlier, we have scientifically proven that the stability of the PCR assay under extensive processing atmosphere largely depends on the amplicon sizes; longer targets break down before the shorter ones.6,23 This study has carefully addressed this point and kept 6349


Article


Figure 5. PCR-RFLP analysis of simplex PCR products of pork PoND5 and Pocytb before and after restriction endonuclease digestion. In the gel image, lanes 1 and 2, PCR products of PoND5 before and after digestion; lanes 3 and 4, products of Pocytb before and after digestion, respectively. Corresponding electropherograms are indicated by corresponding labels.

Figure 6. RFLP analysis of pork PoND5 (lanes 1−6) and Pocytb (lanes 7−12) PCR products before (lanes 1, 3, 5, 7, 9, and 11) and after (lanes 2, 4, 6, 8, 10, and 12) restriction digestion. In the gel view, PCR products from raw (lanes 1, 2, 7, and 8), boiled (lanes 3, 4, 9, and 10), and autoclaved (lanes 5, 6, 11, and 12) pork frankfurter; lane M, DNA ladder.

However, 8 bp fragment was not detected because it went beyond the lower limit of instrumental resolution, which was ≤15 bp. Finally, the mPCR products (lane 9) were subjected to RE digestion with the three enzymes (FatI, EciI, and AluI) in a single tube, and this generated molecular fingerprints which were composed of a total of seven fragments (19, 40, 45, 50, 75, 87, and 130) (lane 10). The origins of these products (lane 9) were confirmed by the separate digests of the four targets (lanes 1−8).

four different amplicons (Figure 3). Both buffalo cytb (90 bp) (Figure 3, lane 1) and beef ND5 (106 bp) (Figure 3, lane 3) products were digested by FatI RE, which generated two fragments for each target (50 and 40 bp for buffalo cytb (lane 2) and 87 and 19 bp for beef ND5 (lane 4)). On the other hand, beef cytb (120 bp) (lane 5) was digested by EciI that produced two fragments (75 and 45 bp) (lane 6). In contrast, buffalo ND5 product (lane 7) was digested with AluI, which resulted in another two fragments (130 and 8 bp) (lane 8). 6350


Article

Journal of Agricultural and Food Chemistry Table 6. Screening of Model and Commercial Frankfurters by the Multiplex PCR Assaya adulteration

detected species

sample (frankfurter)

species

%

beef beef beef beef buffalo buffalo buffalo buffalo pork pork pork pork

buffalo and pork buffalo and pork buffalo and pork buffalo and pork beef and pork beef and pork beef and pig beef and pork beef and buffalo beef and buffalo beef and buffalo beef and buffalo

1.0 0.5 0.1 0.1 1.0 0.5 0.1 0.1 1.0 0.5 0.1 0.1

beef pork chicken

− − −

− − −

state

beef

Model Frankfurter raw raw raw autoclaved for 2.5 h raw raw raw autoclaved for 2.5 h raw raw raw autoclaved for 2.5 h Commercial Frankfurter raw raw raw

buffalo

pork

PCR accuracy (%)

9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9

9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9

9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9 9/9

100 100 100 100 100 100 100 100 100 100 100 100

20/20 0/10 0/10

20/20 0/10 0/10

0/20 10/10 0/10

100 100 100

a

The numerator and denominator of each fraction denote the number of positive detection and total number of samples analyzed using the mPCR assay.

boiled (98 °C for 90 min), and autoclaved (121 °C and 15 psi pressure for 2.5 h) atmospheres for differential identification of beef, buffalo, and pork in pure, admixed, and frankfurter formulation. Analysis of Commercial Frankfurters. The motivation of the substitution of an expensive meat with its cheaper counterpart comes with the inclination of a company to have more sales and better profit, and instead of raw meat, adulteration could be skillfully manipulated in processed meat products.11 Because frankfurter is very popular and consumed widely all over the world, we have screened 20 halal branded beef frankfurters in Malaysian markets (Table 6). It would be noteworthy here that no buffalo frankfurter products were found in the Malaysian markets; that is, all were labeled as beef products. However, all the tested beef frankfurters were found as both beef and buffalo positive; this indicated that all beef frankfurter products in Malaysia was buffalo adulterated. We also checked chicken and pork frankfurters, but none of them were beef and buffalo positive; this was probably because the prices of beef and buffalo are higher than those of chicken and pork. Although several PCR assays are proposed for the beef and buffalo differentiation,8,33 none of them were tested under commercial matrices despite having the risk of PCR inhibition by multiple ingredients present in commercial products.52,53 Previous reports analyzed only model meat products such as kabab, patty, and meat block using simplex PCR systems for beef and buffalo, which incurs additional cost and time due to the use of separate assays for each species.15,54 Although several reports were documented for the analysis of meatball, streaky bacon, frankfurter, and burger model products for the identification of pig species,51,55 all of those were simplex PCR assays. On the other hand, the novel mPCR-RFLP assay we reported here for frankfurter analysis was more reliable and confirmatory but less expensive because it discriminated beef, buffalo, and pork with double targets in a single assay platform. Public Health, Social, and Economic Implications of the Study. Beef, buffalo, and pork adulterated meat products have direct implications for public health, religion, culture, and economy. A confirmatory low-cost analytical test involving all

After the mPCR-RFLP assay under pure states was optimized, it was subsequently optimized and evaluated for the screening of commercial beef and buffalo frankfurters under raw, boiled, and autoclaved states.12 Dummy frankfurters were deliberately adulterated, and their restriction digestion patterns were studied (Figure 4). The digest of all samples (lanes 1, 3, 5, 7, 9, and 11) clearly presented the signature fingerprints of 7 fragments (lanes 2, 4, 6, 8, 10, and 12), reflecting that variations in food processing treatments cannot affect the stability of any of the four biomarkers developed in this study; in other words, this novel mPCR-RFLP assay was sensitive, reliable, and robust for the discriminatory detection of beef and buffalo in processed foods. Simplex PCR products of pork Pocytb and PoND5 were digested individually with CviKI-1 and FatI RE, respectively, because in silico studies demonstrated overlapping fragments with beef and buffalo. Postdigested PoND5 PCR product (73 bp) (Figure 5, lane 1) produced 2 fragments of 52 and 21 bp (Figure 5, lane 2), and Pocytb PCR product (146 bp) (lane 3) generated 3 fragments of 80, 45, and 21 bp (lane 4). Similar products were found from boiled (98 °C for 90 min) and autoclaved (121 °C at 45 psi for 2.5 h) pork frankfurters. The restriction digestion maps of different heat-treated (boiled and autoclaved) samples were similar to those from the raw sample (Figure 6). Previously, Haider et al.1 reported a PCR-RFLP assay with a 710 bp amplicon that was amplified using common primer pairs for the cow, chicken, turkey, sheep, pig, buffalo, camel, and donkey. Girish et al.20 also documented a PCR-RFLP assay with 456 bp amplicon length for the detection of Goat, Sheep, Cattle and Buffalo. Recently, Kumar et al.50 proposed a RFLP pattern with a 609 bp target to discriminate cattle, buffalo, goat, sheep and pig. In addition, Erwanto et al.51 demonstrated a PCR-RFLP technique for a 359 bp product. However, such long targets (359−710 bp) are more prone to break down and thus would definitely lose their applicability for the analysis of processed foods. In contrast, here we reported a double gene site and short amplicon length (≤146 bp) mPCR-RFLP and systematically proved its reliability and sensitivity under raw, 6351


Journal of Agricultural and Food Chemistry three species definitely can help market regulation, preventing or at least reducing adulteration events to a great extent. The short amplicon length and double-gene targeting mPCR-RFLP system that is documented here is greatly reliable for beef, buffalo, and pork identification in a single assay platform because of (1) the alternative targets which can complement the detection of a missing target for each species, (2) the shorter length of the targets which offer better stability even under the state of decomposition, and (3) the opportunity of rechecking the product authenticity by distinctive molecular fingerprints of the RFLP digests using four different restriction enzymes. The use of an internal positive control just eliminated the chances of any false negative detection. Species specificity of all targets was confirmed by cross-checking all the primers against 27 nontarget species. The stability of the assay was further qualified under various cooking treatments, including extensive autoclaving (121 °C and 15 psi pressure for 2.5 h) that breaks down DNA. Finally, it was found sensitive enough to detect all the beef, buffalo, and pork targets in raw and processed frankfurter products with as low as 0.1% adulteration. Thus, the novel assay demonstrated sufficient merits to be used by regulatory bodies for beef, buffalo, and pork authentication even in degraded specimens.

■

■

ABBREVIATIONS USED

■

REFERENCES

Cytb, cytochrome b; ND5, NADH dehydrogenase sub unit 5; DNA, deoxyribonucleic acid; RE, restriction enzyme; PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism; mPCR, multiplex PCR; BLAST, basic local alignment algorithm search tool; NCBI, National Center for Biotechnology Information; bp, base pair

(1) Haider, N.; Nabulsi, I.; Al-Safadi, B. Identification of meat species by PCR-RFLP of the mitochondrial COI gene. Meat Sci. 2012, 90, 490−3. (2) Bottero, M. T.; Dalmasso, A. Animal species identification in food products: Evolution of biomolecular methods. Vet. J. 2011, 190, 34− 38. (3) Walker, M. J.; Burns, M.; Burns, D. T. Horse Meat in Beef Products-Species Substitution 2013. J. Assoc of Public Anal. (Online) 2013, 41, 67−106. (4) Russia says wrong animal DNA found in Auchan minced meat. http://www.nst.com.my/news/2015/09/russia-says-wrong-animaldna-found-auchan-minced-meat (accessed January 1, 2016), News Straits Times, 2015. (5) Ali, M. E.; Razzak, M. A.; Hamid, S. B. A. Multiplex PCR in Species Authentication: Probability and ProspectsA Review. Food Analytical Methods 2014, 7, 1933−1949. (6) Rashid, N. R.; Ali, M. E.; Hamid, S. B.; Rahman, M. M.; Razzak, M. A.; Asing; Amin, M. A. A suitable method for the detection of a potential fraud of bringing macaque monkey meat into the food chain. Food Addit. Contam., Part A 2015, 32, 1013−1022. (7) Girish, P.; Haunshi, S.; Vaithiyanathan, S.; Rajitha, R.; Ramakrishna, C. A rapid method for authentication of Buffalo (Bubalus bubalis) meat by Alkaline Lysis method of DNA extraction and species specific polymerase chain reaction. J. Food Sci. Technol. 2013, 50, 141−146. (8) Karabasanavar, N. S.; Singh, S. P.; Umapathi, V.; Girish, P. S.; Shebannavar, S. N.; Kumar, D. Authentication of carabeef (water buffalo, Bubalus bubalis) using highly specific polymerase chain reaction. Eur. Food Res. Technol. 2011, 233, 985−989. (9) Sakaridis, I.; Ganopoulos, I.; Argiriou, A.; Tsaftaris, A. A fast and accurate method for controlling the correct labeling of products containing buffalo meat using High Resolution Melting (HRM) analysis. Meat Sci. 2013, 94, 84−8. (10) Ali, M. E.; Hashim, U.; Mustafa, S.; Man, Y. C.; Dhahi, T. S.; Kashif, M.; Uddin, M. K.; Hamid, S. B. A. Analysis of pork adulteration in commercial meatballs targeting porcine-specific mitochondrial cytochrome b gene by TaqMan probe real-time polymerase chain reaction. Meat Sci. 2012, 91, 454−459. (11) von Bargen, C.; Dojahn, J.; Waidelich, D.; Humpf, H. U.; Brockmeyer, J. New sensitive highperformance liquid chromatography−tandem mass spectrometry method for the detection of horse and pork in halal beef. J. Agric. Food Chem. 2013, 61, 11986−11994. (12) Taboada, L.; Sánchez, A.; Velasco, A.; Santaclara, F. J.; PérezMartín, R. I.; Sotelo, C. G. Identification of Atlantic Cod (Gadus morhua), Ling (Molva molva), and Alaska Pollock (Gadus chalcogrammus) by PCR−ELISA Using Duplex PCR. J. Agric. Food Chem. 2014, 62, 5699−5706. (13) Ali, M. E.; Al Amin, M.; Hamid, S. B. A.; Hossain, M. M.; Mustafa, S. Lab-on-a-chip-based PCR-RFLP assay for the confirmed detection of short-length feline DNA in food. Food Addit. Contam., Part A 2015, 32, 1373−1383. (14) Lopez, I.; Pardo, M. A. Application of relative quantification TaqMan real-time polymerase chain reaction technology for the identification and quantification of Thunnus alalunga and Thunnus albacares. J. Agric. Food Chem. 2005, 53, 4554−4560. (15) Mane, B. G.; Mendiratta, S. K.; Tiwari, A. K. Beef specific polymerase chain reaction assay for authentication of meat and meat products. Food Control 2012, 28, 246−249.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.6b02224. Figure 1SM: Specificity test of the simplex PCR of beef cytb (120 bp)-specific primer pair with DNA of different species (PDF) Figure 2SM: Specificity test of the simplex PCR of beef ND5 (106 bp)-specific primer pair with DNA of different species (PDF) Figure 3SM: Specificity test of the simplex PCR of buffalo cytb (90 bp)-specific primer pair with DNA of different species (PDF) Figure 4SM: Specificity of the simplex PCR of buffalo ND5 (138 bp)-specific primer pair with DNA of different species (PDF) Figure 5SM: Specificity of the simplex PCR of pork cytb (146 bp)-specific primer pair with DNA of different species (PDF) Figure 6SM: Specificity of the simplex PCR of pork ND5 (73 bp)-specific primer pair with DNA of different species (PDF)

■

Article

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]; [email protected]. Tel: +603-7967-6959. Fax: +603-7967-6956. Funding

This work was supported by University of Malaya Research Grant No. GC001-14SBS to M.E.A. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors acknowledge the kind gift of monkey, dog, cat, and rat meat samples from the wildlife Malaysia and Dewan Bandaraya Kuala Lumpur (DBKL). 6352


Article

Journal of Agricultural and Food Chemistry (16) Giusti, A.; Castigliego, L.; Rubino, R.; Gianfaldoni, D.; Guidi, A.; Armani, A. A Conventional Multiplex PCR assay for the detection of toxic Gemfish species (Ruvettus pretiosus and Lepidocybium flavobrunneum): a simple method to combat health frauds. J. Agric. Food Chem. 2016, 64 (4), 960−968. (17) Cook, D.; Pfister, J. A.; Constantino, J. R.; Roper, J. M.; Gardner, D. R.; Welch, K. D.; Hammond, Z. J.; Green, B. T. Development of a PCR-based method for detection of Delphinium species in poisoned cattle. J. Agric. Food Chem. 2015, 63, 1220−1225. (18) Hsieh, Y.-W.; Hwang, D.-F. Molecular phylogenetic relationships of puffer fish inferred from partial sequences of cytochrome b gene and restriction fragment length polymorphism analysis. J. Agric. Food Chem. 2004, 52, 4159−4165. (19) Chen, S.-Y.; Liu, Y.-P.; Yao, Y.-G. Species authentication of commercial beef jerky based on PCR-RFLP analysis of the mitochondrial 12S rRNA gene. J. Genet. Genomics 2010, 37, 763−769. (20) Girish, P. S.; Anjaneyulu, A. S.; Viswas, K. N.; Shivakumar, B. M.; Anand, M.; Patel, M.; Sharma, B. Meat species identification by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of mitochondrial 12S rRNA gene. Meat Sci. 2005, 70, 107−12. (21) Mutalib, S. A.; Nazri, W. S. W.; Shahimi, S.; Yaakob, N.; Sani, N. A.; Abdullah, A.; Babji, A. l. S.; Ghani, M. A. Comparison between pork and wild boar meat (Sus scrofa) by polymerase chain reactionrestriction fragment length polymorphism (PCR-RFLP). Sains Malays. 2012, 41, 199−204. (22) Nebola, M.; Borilova, G.; Kasalova, J. PCR-RFLP analysis of DNA for the differentiation of fish species in seafood samples. Bull. Vet. Inst. Pulawy 2010, 54, 49−53. (23) Focke, F.; Haase, I.; Fischer, M. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction. J. Agric. Food Chem. 2011, 59, 513−520. (24) Ali, M. E.; Asing; Hamid, S. B. A.; Razzak, M. A.; Rashid, N. R. A.; Amin, M. A.; Mustafa, S. A suitable method to detect potential fraud of bringing Malayan box turtle (Cuora amboinensis) meat into the food chain. Food Addit. Contam., Part A 2015, 32, 1223−1233. (25) Ali, M. E.; Razzak, M. A.; Hamid, S. B. A.; Rahman, M. M.; Amin, M. A.; Rashid, N. R. A. Asing, Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods. Food Chem. 2015, 177, 214−224. (26) Razzak, M. A.; Hamid, S. B. A.; Ali, M. E. A lab-on-a-chip-based multiplex platform to detect potential fraud of introducing pig, dog, cat, rat and monkey meat into the food chain. Food Addit. Contam., Part A 2015, 32, 1902−1913. (27) Rahman, M. M.; Ali, M. E.; Abd Hamid, S. B.; Mustafa, S.; Hashim, U.; Hanapi, U. K. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation. Meat Sci. 2014, 97, 404−409. (28) Herrero, B.; Vieites, J. M.; Espiñeira, M. Fast real-time PCR for the detection of crustacean allergen in foods. J. Agric. Food Chem. 2012, 60, 1893−1897. (29) Safdar, M.; Junejo, Y. A multiplex-conventional PCR assay for bovine, ovine, caprine and fish species identification in feedstuffs: Highly sensitive and specific. Food Control 2015, 50, 190−194. (30) Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731−2739. (31) Che Man, Y.; Aida, A.; Raha, A.; Son, R. Identification of pork derivatives in food products by species-specific polymerase chain reaction (PCR) for halal verification. Food Control 2007, 18, 885−889. (32) Rea, S.; Chikuni, K.; Branciari, R.; Sangamayya, R. S.; Ranucci, D.; Avellini, P. Use of duplex polymerase chain reaction (duplex-PCR) technique to identify bovine and water buffalo milk used in making mozzarella cheese. J. Dairy Res. 2001, 68, 689−698. (33) Gupta, R.; Rank, D. N.; Joshi, C. G. Duplex-PCR for Identification and Differentiation of Cattle and Buffalo Processed Meat. J. Adv. Vet. Res. 2011, 1, 13−16.

(34) He, H.; Hong, X.; Feng, Y.; Wang, Y.; Ying, J.; Liu, Q.; Qian, Y.; Zhou, X.; Wang, D. Application of Quadruple Multiplex PCR Detection for Beef, Duck, Mutton and Pork in Mixed Meat. Journal of Food and Nutrition Research 2015, 3, 392−398. (35) Verkaar, E. L. C.; Nijman, I. J.; Boutaga, K.; Lenstra, J. A. Differentiation of cattle species in beef by PCR-RFLP of mitochondrial and satellite DNA. Meat Sci. 2002, 60, 365−369. (36) Ali, M. E.; Al Amin, M.; Razzak, M. A.; Hamid, S. B. A.; Rahman, M. M.; Rashid, N. A. Short Amplicon-Length PCR Assay Targeting Mitochondrial Cytochrome b Gene for the Detection of Feline Meats in Burger Formulation. Food Anal. Methods 2016, 9, 571−581. (37) Rahman, M. M.; Ali, M. E.; Hamid, S. B. A.; Bhassu, S.; Mustafa, S.; Al Amin, M.; Razzak, M. A. Lab-on-a-Chip PCR-RFLP Assay for the Detection of Canine DNA in Burger Formulations. Food Analytical Methods 2015, 8, 1598−1606. (38) Safdar, M.; Junejo, Y.; Arman, K.; Abasiyanik, M. F. A highly sensitive and specific tetraplex PCR assay for soybean, poultry, horse and pork species identification in sausages: development and validation. Meat Sci. 2014, 98, 296−300. (39) Yang, I.; Kim, Y.-H.; Byun, J.-Y.; Park, S.-R. Use of multiplex polymerase chain reactions to indicate the accuracy of the annealing temperature of thermal cycling. Anal. Biochem. 2005, 338, 192−200. (40) Doosti, A.; Dehkordi, P. G.; Rahimi, E. Molecular assay to fraud identification of meat products. J. Food Sci. Technol. 2014, 51, 148− 152. (41) Maede, D. A strategy for molecular species detection in meat and meat products by PCR-RFLP and DNA sequencing using mitochondrial and chromosomal genetic sequences. Eur. Food Res. Technol. 2006, 224, 209−217. (42) do Nascimento, C.; de Albuquerque, R. F.; Monesi, N.; Candido-Silva, J. A. Alternative method for direct DNA probe labeling and detection using the checkerboard hybridization format. J. Clin Microbiol. 2010, 48, 3039−3040. (43) Girish, P.; Anjaneyulu, A.; Viswas, K.; Anand, M.; Rajkumar, N.; Shivakumar, B.; Bhaskar, S. Sequence analysis of mitochondrial 12S rRNA gene can identify meat species. Meat Sci. 2004, 66, 551−556. (44) Mafra, I.; Ferreira, I. M. P. L. V. O.; Oliveira, M. B. P. P. Food authentication by PCR-based methods. Eur. Food Res. Technol. 2008, 227, 649−665. (45) Albers, C. N.; Jensen, A.; Bælum, J.; Jacobsen, C. S. Inhibition of DNA polymerases used in Q-PCR by structurally different soil-derived humic substances. Geomicrobiol. J. 2013, 30, 675−681. (46) Park, J.-K.; Shin, K.-H.; Shin, S.-C.; Chung, K.-Y.; Chung, E.-R. Identification of meat species using species-specific PCR-RFLP fingerprint of mitochondrial 12S rRNA gene. Korean Journal for Food Science of Animal Resources 2007, 27, 209−215. (47) Sharma, N.; Thind, S.; Girish, P.; Sharma, D. PCR-RFLP of 12S rRNA gene for meat speciation. J. Food Sci. Tech. Mys. 2008, 45, 353− 355. (48) Ballin, N. Z.; Vogensen, F. K.; Karlsson, A. H. Species determination−Can we detect and quantify meat adulteration? Meat Sci. 2009, 83, 165−174. (49) Murugaiah, C.; Noor, Z. M.; Mastakim, M.; Bilung, L. M.; Selamat, J.; Radu, S. Meat species identification and Halal authentication analysis using mitochondrial DNA. Meat Sci. 2009, 83, 57−61. (50) Kumar, D.; Singh, S.; Karabasanavar, N. S.; Singh, R.; Umapathi, V. Authentication of beef, carabeef, chevon, mutton and pork by a PCR-RFLP assay of mitochondrial cytb gene. J. Food Sci. Technol. 2014, 51, 3458−3463. (51) Erwanto, Y.; Abidin, M. Z.; S; Rohman, A. Pig species identification in meatballs using polymerase chain reactionrestriction fragment length polymorphism for Halal authentication. Int. Food Res. J. 2012, 19, 901−906. (52) Bottero, M.; Civera, T.; Anastasio, A.; Turi, R.; Rosati, S. Identification of cow’s milk in “Buffalo” cheese by Duplex Polymersase Chain Reaction. J. Food Prot. 2002, 65, 362−366. 6353


Article

Journal of Agricultural and Food Chemistry (53) Di Pinto, A.; Forte, V.; Conversano, M.; Tantillo, G. Duplex polymerase chain reaction for detection of pork meat in horse meat fresh sausages from Italian retail sources. Food Control 2005, 16, 391− 394. (54) Mane, S. K.; Mendiratta, A. K.; Tiwari; Bhilegaokar, K. N. Detection of Adulteration of Meat and Meat Products with Buffalo Meat Employing Polymerase Chain Reaction Assay. Food Anal. Methods 2012, 5, 296−300. (55) Ali, M. E.; Hashim, U.; Mustafa, S.; Man, Y. B. C. Swine-Specific PCR-RFLP Assay Targeting Mitochondrial Cytochrome B Gene for Semiquantitative Detection of Pork in Commercial Meat Products. Food Anal. Methods 2012, 5, 613−623.

6354


Double Gene Targeting Multiplex Polymerase ... - ACS Publications

Recommend Documents