12532
Biochemistry 2008, 47, 12532–12539
A Distal Tyrosine Residue Is Required for Ligand Discrimination in DevS from Mycobacterium tuberculosis† Erik T. Yukl,‡ Alexandra Ioanoviciu,§ Michiko M. Nakano,‡ Paul R. Ortiz de Montellano,§ and Pierre Moe¨nne-Loccoz*,‡ Department of EnVironmental and Biomolecular Systems, OGI School of Science and Engineering, Oregon Health and Science UniVersity, 20000 NW Walker Road, BeaVerton, Oregon 97006-8921, and Department of Pharmaceutical Chemistry, UniVersity of California, 600 16th Street, San Francisco, California 94158-2517 ReceiVed June 30, 2008; ReVised Manuscript ReceiVed September 18, 2008
ABSTRACT:
DevS is a heme-based sensor kinase required for sensing environmental conditions leading to nonreplicating persistence in Mycobacterium tuberculosis. Kinase activity is observed when the heme is a ferrous five-coordinate high-spin or six-coordinate low-spin CO or NO complex but is strongly inhibited in the oxy complex. Discrimination between these exogenous ligands has been proposed to depend on a specific hydrogen bond network with bound oxygen. Here we report resonance Raman data and autophosphorylation assays of wild-type and Y171F DevS in various heme complexes. The Y171F mutation eliminates ligand discrimination for CO, NO, and O2, resulting in equally inactive complexes. In contrast, the ferrous-deoxy Y171F variant exhibits autokinase activity equivalent to that of the wild type. Raman spectra of the oxy complex of Y171F indicate that the environment of the oxy group is significantly altered from that in the wild type. They also suggest that a solvent molecule in the distal pocket substitutes for the Tyr hydroxyl group to act as a poorer hydrogen bond donor to the oxy group. The wild-type CO and NO complexes exist as a major population in which the CO or NO groups are free of hydrogen bonds, while the Y171F mutation results in a mild increase in the distal pocket polarity. The Y171F mutation has no impact on the proximal environment of the heme, and the activity observed with the five-coordinate ferrous-deoxy wild type is conserved in the Y171F variant. Thus, while the absence of an exogenous ligand in the ferrous-deoxy proteins leads to a moderate kinase activity, interactions between Tyr171 and distal diatomic ligands turn the kinase activity on and off. The Y171F mutation disrupts the on-off switch and renders all states with a distal ligand inactive. This mechanistic model is consistent with Tyr171 being required for distal ligand discrimination, but nonessential for autophosphorylation activity. Mycobacterium tuberculosis (MTB)1 is believed to have latently infected as many as 2 billion people worldwide (1). The success of this pathogen relies in part on its ability to exist within the host in a dormant state known as “nonreplicating persistence” (NRP) for extended periods, with subpopulations phenotypically resistant to current chemotherapies (2). Thus, a detailed understanding of NRP and its initiation process is critical for improving the treatment of TB. NRP is characterized by the induction of a set of 48 genes, the so-called “dormancy regulon”. Included in this set is †
This work was supported by Grants GM74785 (P.M.-L.) and AI074824 (P.R.O.d.M.) from the National Institutes of Health. * To whom correspondence should be addressed. Telephone: (503) 748-1673. Fax: (503) 748-1464. E-mail:
[email protected]. ‡ Oregon Health and Science University. § University of California. 1 Abbreviations: MTB, Mycobacterium tuberculosis; NRP, nonreplicating persistence; GAF domain, protein domain conserved in cyclic GMP-specific and stimulated phosphodiesterases, adenylate cyclases, and Escherichia coli formate hydrogenlyase transcriptional activator (Pfam accession number PF01590); GAF A and GAF B, first and second N-terminal GAF domains of DevS and DosT, respectively; wt, wild type; Y171F, tyrosine 171 to phenylalanine mutation; IPTG, isopropyl β-D-thiogalactopyranoside; RR, resonance Raman.
R-crystallin, a heat-shock protein likely involved in the stabilization of essential proteins and cell structures during extended quiescence (3). Hypoxia and NO are likely environmental cues prompting entrance into NRP as expression of the dormancy regulon was found to be induced in response to both hypoxia and exposure to nontoxic concentrations of NO (4). Furthermore, O2 was shown to competitively inhibit NO-mediated induction of the dormancy regulon (4). These observations strongly suggest that one sensor is responsible for detecting both signals and initiating the expression profile responsible for NRP. Mutagenesis studies identified the DevR/DevS/DosT system as being required for induction of the dormancy regulon in response to hypoxia and NO (4, 5). This is a classical two-component regulatory system where DevR is a response regulator of the LuxR family (6) and DevS and its closely related (60% identical, 76% similar) paralog, DosT, are histidine protein kinases (HPK) (5) responsible for phosphorylation and activation of DevR. Both DevS and DosT are modular in nature with an N-terminal sensing core composed of two tandem GAF domains and a C-terminal kinase core with a HisKA (histidine kinase phospho-acceptor) domain where autophos-
10.1021/bi801234w CCC: $40.75 2008 American Chemical Society Published on Web 11/01/2008
Ligand Discrimination in DevS from M. tuberculosis phorylation occurs and an HATPase (histidine kinase-like ATPase) domain responsible for binding ATP (7). The first GAF domain (GAF A) binds heme and acts as a diatomic gas sensor (7-10). DevS and DosT exhibit autokinase activity when the heme is in the deoxy state, signaling hypoxia, and when NO or CO is bound to the Fe(II) ion (9). In contrast, the kinase activity is strongly inhibited by the binding of O2 (9). The ferric state (met) of DevS was also reported to lack autophosphorylation activity (10). Previously, we reported the resonance Raman (RR) characterization of truncated and full-length wt DevS (11). The results suggested that a specific hydrogen bond exists between a distal residue and the proximal oxygen atom of bound O2. This hydrogen bond was absent from CO and NO adducts as well as from the ferrous unligated state. On the basis of this evidence and the apparent function of DevS in vivo, we proposed that this hydrogen bond was responsible for differentiating exogenous ligands and that, when engaged, would inhibit kinase activity. Thus, only the kinase activity of the oxy complex would be inhibited, whereas the Fe(II), NO-, and CO-bound states should be active. These conclusions were confirmed by autophosphorylation experiments (9, 10). Moreover, CO sensing during macrophage infection has been shown to result in activation of the dormancy regulon (12, 13). The X-ray structure of GAF A of DosT shows that the hydroxyl group of Tyr169 (Tyr171 in DevS) acts as a hydrogen bond donor to oxygen (14). Since our experiments indicated stability issues with Y169F DosT, we report on the RR characterization and autokinase activity of the Y171F mutant of DevS in the Fe(III), Fe(II), Fe-CO, Fe-NO, and Fe-O2 states and compare the results to those of wt DevS. Because the wt Fe-O2 complex is inactive, and Tyr171 interacts with the bound O2, the Y171F mutation might have been expected to release inhibitory constraints to produce a Y171F variant equally active in the O2, NO, and CO complexes. However, our results show that the Y171F variant lacks autokinase activity in all three states where the distal pocket is occupied by an exogenous ligand and retains activity only in the deoxy form. These activity measurements are discussed in conjunction with the RR analysis with the aim of proposing mechanistic models of regulation in DevS. MATERIALS AND METHODS Full-Length DeVS Mutagenesis. The full-length DevS gene previously cloned into pET23a+ was mutated using Pfu turbo and the following mutagenic primers: CGTTCGGCACTCTGTTCCTGACTGACAAGACC (forward primer) and GGTCTTGTCAGTCAGGAACAGAGTGCCGAACG (reverse primer). DNA sequencing was used to verify the mutated gene sequence. Y171F DeVS Expression. The mutant protein was expressed following the same protocol used in the case of DevS642 (8). Briefly, BL21gold DE3 cells were cotransformed with pET23a+ Y171F DevS and pT-GroE, and the cells were grown on LB plates containing both ampicillin (50 µg/mL) and chloramphenicol (34 µg/mL). Starter cultures were grown at 37 °C and then used to inoculate flasks containing 1.5 L of LB medium and the antibiotics ampicillin (100 µg/mL) and chloramphenicol (34 µg/mL). The cells were grown to an optical density (OD600) of 0.8-1 at 37 °C
Biochemistry, Vol. 47, No. 47, 2008 12533 and 230 rpm. Hemin was added before induction (45 mg/ 1.5 L of culture), and protein expression was induced with IPTG at a final concentration of 1 mM. The cultures were kept at 18 °C for 20 h, and then the cells were harvested by centrifugation at 5000 rpm for 25 min. Protein Purification. The cells were lysed in phosphate buffer (pH 7.6) [50 mM NaH2PO4, 10% glycerol, 200 mM NaCl, 1% Triton X-100, 0.5 mg/mL lysozyme, 5 mM MgCl2, 5 mM ATP, and protease inhibitors antipain (1 µg/mL), leupeptin (1 µM), pepstatin (1 µM), and PMSF (0.1 mM)]. Then the mixture was incubated with shaking at 37 °C for 30 min. The cell membranes were disrupted by repeated sonication cycles at 50% using a Branson model 450 sonifier from VWR Scientific while being cooled on ice. The insoluble fraction was isolated by centrifugation at 35000 rpm for 1 h at 4 °C. The cell lysate was applied to a 5 mL His trap column. The column was washed with 20 and 50 mM imidazole buffer. The recombinant protein was then eluted with 250 mM imidazole. The protein sample was applied to a DEAE column. The purified protein was obtained after gradient elution from 0 to 0.5 M NaCl in 50 mM Tris buffer containing 5% glycerol and 1 mM EDTA at pH 8. Electronic Absorption and Resonance Raman Spectroscopy. The RR experiments were performed with ∼100 µM protein solutions for the Fe(III) and deoxy-Fe(II) forms, and ∼300 µM protein solutions for the CO, NO, and O2 complexes. Ultrafree-0.5 ultrafiltration devices (Millipore) were used for concentrating the protein. A 50 mM potassium phosphate buffer at pH 7.5 with 100 mM NaCl was used for most protein samples; 100 mM MES (pH 6.0), 100 mM potassium phosphate (pH 7.0), 50 mM HEPES (pH 8.0), 200 mM CHES (pH 9.5), and 200 mM CAPS (pH 11.0) were used in pH dependence experiments. Reduction to the ferrous state was achieved by adding aliquots (a few microliters) of a concentrated sodium dithionite solution (35-50 mM) to an argon-purged sample. 12CO (Airgas) and 13CO (99% 13C; ICON Stable Isotopes) adducts were obtained by injecting CO through a septum-sealed capillary containing argonpurged, reduced protein (∼20 µL). O2 (Airgas), 18O2 (99% 18 O; ICON Stable Isotopes), NO (Aldrich), and 15N18O (98% 15 N and 95%18O; Aldrich) adducts were generated using the same procedure after excess dithionite was removed from the reduced sample with desalting spin columns (Zeba 0.5 mL; Pierce). These procedures were performed in a glovebox with a controlled atmosphere of
