Acinetodin and Klebsidin, RNA Polymerase Targeting Lasso Peptides

Subscriber access provided by UB + Fachbibliothek Chemie | (FU-Bibliothekssystem)

Article

Acinetodin and Klebsidin, RNA Polymerase Targeting Lasso Peptides Produced by Human Isolates of Acinetobacter gyllenbergii and Klebsiella pneumoniae Mikhail Metelev, Anatolii Arseniev, Leah B. Bushin, Konstantin Kuznedelov, Tatiana O. Artamonova, Ruslan Kondratenko, Mikhail Khodorkovskii, Mohammad R. Seyedsayamdost, and Konstantin Severinov ACS Chem. Biol., Just Accepted Manuscript • Publication Date (Web): 20 Jan 2017 Downloaded from http://pubs.acs.org on January 20, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Chemical Biology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Chemical Biology

Acinetodin and Klebsidin, RNA Polymerase Targeting Lasso Peptides Produced by Human Isolates of Acinetobacter gyllenbergii and Klebsiella pneumoniae

Mikhail Metelev,1,2* Anatolii Arseniev,1 Leah B. Bushin,3 Konstantin Kuznedelov,3 Tatiana O. Artamonova,1 Ruslan Kondratenko,1 Mikhail Khodorkovskii,1 Mohammad R. Seyedsayamdost,3 and Konstantin Severinov 1,4,5, 6*

1Peter

the Great St.Petersburg Polytechnic University, St. Petersburg, 195251, Russia.

2Institute

of Antimicrobial Chemotherapy, Smolensk State Medical Academy, Smolensk, 214018, Russia

3Departments 4Waksman

of Chemistry and Molecular Biology, Princeton University, Princeton, NJ 08544, USA

Institute of Microbiology, Rutgers, the State University of New Jersey, Piscataway, NJ

08854, USA 5Skolkovo

Institute of Science and Technology, Skolkovo, 143025, Russia

6Institute

of Molecular Genetics, Russian Academy of Sciences, Moscow, 123142, Russia

*Correspondence: [email protected], [email protected]

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 39

Abstract We report the bioinformatic prediction and structural validation of two lasso peptides, acinetodin and klebsidin, encoded by the genomes of several humanassociated strains of Acinetobacter and Klebsiella. Computation of the threedimensional structures of these peptides using NMR NOESY constraints verifies that they contain a lasso motif. Despite the lack of sequence similarity to each other or to microcin J25, a prototypical lasso peptide and transcription inhibitor from Escherichia coli, acinetodin and klebsidin also inhibit transcript elongation by the E. coli RNA polymerase by binding to a common site. Yet, unlike microcin J25, acinetodin and klebsidin are unable to permeate wt E. coli cells and inhibit their growth. We show that the E. coli cells become sensitive to klebsidin when expressing the outer membrane receptor FhuA homolog from Klebsiella pneumoniae. It thus appears that specificity to a common target, the RNA polymerase secondary channel, can be attained by surprisingly diverse set of primary sequences folded into a common threaded-lasso fold. In contrast, transport into cells containing sensitive targets appears to be much more specific and must be the major determinant of the narrow range of bioactivity of known lasso peptides.


Page 3 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Microorganisms represent an important source of pharmacologically active natural products. The development of new strategies to explore microbial diversity, including in situ cultivation, genome and metagenome mining, and new methods to evaluate biosynthetic potential have facilitated the discovery of novel bioactive small molecules (1-3). Over the last decade tremendous efforts have been made to characterize the human microbiome, investigate its chemical potential, and expand our understanding of how microorganisms interact with each other and with their host (4-6). Systematic analysis of the biosynthetic potential of the human microbiome has revealed a widespread distribution of potential small-molecule biosynthetic gene clusters, including clusters of putative ribosomally-synthesized post-translationally modified peptides (RiPPs), which have been recognized as a major class of natural products (7, 8). The biosynthesis of RiPPs starts with ribosomal synthesis of an inactive precursor peptide that typically consists of an Nterminal leader and a C-terminal core peptide. The precursor peptide undergoes enzymatic post-translational modification to become a mature RiPP; the leader serves to engage enzymes performing post-translational modifications of the core and is ultimately removed. Classification of RiPPs is generally based on characteristic structural motifs and modifying enzymes that produce them. These enzymes are encoded in compact gene clusters alongside with the peptide precursor gene. Lasso peptides form a growing class of RiPPs characterized by a unique 3D structure that is reminiscent of a slipknot

(9-11).

Mature lasso peptides consist of 15-24 amino acids

and their post-translational modification comprises the formation of an isopeptide bond between the N-terminal primary amine of the core peptide and side chain carboxyl group of an Asp or Glu residue at position 7-9. Such a modification results in the formation of a 3 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 39

macrolactam ring with the C-terminal tail of the peptide threaded through the macrocycle. The tail is topologically trapped in the ring by bulky side chains that strut both sides of the ring and may be further stabilized by disulfide bonds. Initially, lasso peptides, such as siamycin I and microcin J25 were identified via classical activity-based screenings in search of receptor antagonists, antibiotics, and other biologically active compounds, followed by purification and structure determination

(12, 13).

Identification of gene clusters that encode

lasso peptides revealed that three genes encoding i) a precursor peptide, ii) a protein, containing a cysteine protease domain, implicated in leader peptide proteolysis, and iii) a macrolactam synthetase, responsible for the formation of the isopeptide bond, form a core gene set common to all clusters

(14, 15).

Notably, some of the characterized lasso peptide

clusters encode a single gene for the cysteine protease, while others contain two discrete shorter genes, which correspond to the split N- and C-terminal domains of larger lasso proteases and encode the leader peptide recognition element and the transglutaminaselike cysteine protease, respectively

(14, 16-18).

Diverse auxiliary genes coding for ABC-

transporters, peptidases, and transcriptional regulators often accompany the core genes (11, 14, 18).

The rapidly growing numbers of sequenced microbial genomes enable systematic searches for novel putative lasso clusters via two main approaches: “precursor-centric” and “cysteine-protease-centric” genome mining with subsequent experimental validation of the identified candidates

(18-20).

Heterologous expression of predicted lasso peptide

biosynthetic clusters in Escherichia coli and in Streptomyces coelicolor has been used successfully to validate bioinformatically predicted lasso peptides from Proteobacteria and Actinobacteria, respectively

(18, 21).

Recently heterologous expression in E. coli of a lasso

cluster from a firmicute Paenibacillus dendritiformis C454 was also demonstrated (22). Since maturation enzymes display remarkable promiscuity towards amino acid substitutions in 4 ACS Paragon Plus Environment

Page 5 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the core peptide part of lasso peptide precursors and because of the exceptional stability demonstrated by the lasso-peptide scaffold, lasso peptides are regarded as a promising platform for development of future peptide-based therapeutics (23-27). Microcin J25, an archetype lasso peptide, is produced by certain E. coli strains in stationary phase and possesses potent antibacterial activity against closely related strains that do not produce the microcin. Besides the mcjA, mcjB, and mcjC core genes, the microcin J25 biosynthesis cluster encodes an ATP-binding cassette transporter McjD, which ensures active export of the mature peptide from the producing cells and thereby provides self-immunity

(28, 29).

Microcin J25 inhibits RNA polymerase (RNAP) in Gram-

negative bacteria, a validated antibiotic target, by binding in the secondary channel through which the NTP substrates enter the catalytic center

(30).

Substitutions of amino

acids located in the RNAP secondary channel rim lead to microcin J25 resistance

(31).

Analysis of elongation by single RNAP molecules using optical trapping techniques showed that microcin J25 stalls RNAP without altering the elongation velocity between pauses (30). Transport of microcin J25 relies on the outer membrane siderophore receptor FhuA, inner membrane transporter SbmA, and the TonB-ExbB-ExbD energy transduction system (32).

Selection of spontaneous mutants resistant to microcin J25 usually yields mutants in

these genes (33). Moreover, it has been demonstrated that a Salmonella typhimurium strain resistant to microcin J25 becomes fully sensitive upon expression of E. coli FhuA, whereas an fhuA deletion mutant of E. coli expressing S. typhimurium FhuA is resistant, but becomes sensitive when FhuA from microcin J25-sensitive Salmonella paratyphi is expressed

(34, 35).

Comprehensive analysis of all possible singly-substituted derivatives of microcin J25 revealed that out of the 242 mutants, which were processed by the lasso peptide synthetase, were stable, and exported from the producer cells, 155 inhibited E. coli RNAP in vitro. Only 70 of these 155 variants inhibited bacterial growth. Thus, ~60% of single-amino 5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 39

acid substitutions, which are tolerated by the lasso-peptide biosynthetic machinery and inhibit RNAP, are not able to permeate bacterial cells (23). In this work we characterize two novel lasso peptides encoded in the genomes of Acinetobacter and Klebsiella species that have been isolated from various human samples (gut, urine, vaginal and oral samples) all over the world. We present three-dimensional models for these peptides, calculated using NMR constraints, and demonstrate that they inhibit wild-type E. coli RNAP, but have no effect on microcin J25-resistant, mutant RNAP. Despite a common mechanism of action, the new lasso peptides share no discernable primary sequence similarity with microcin J25. Thus, bacterial RNAP may be a common target of diverse lasso peptides.

RESULTS AND DISCUSSION

Genome mining identifies clusters of putative novel lasso peptides We applied the cysteine-protease-centric mining approach to search for biosynthetic gene clusters of putative lasso peptides in the genomes of isolates belonging to the Acinetobacter and Klebsiella genera. Although part of the normal human microbiota, some representatives of Acinetobacter and Klebsiella have become important nosocomial pathogens. A BLASTN search of the nr and WGS databases using McjB (Q9X2V8) as a bait and in the Acinetobacter and Klebsiella genera resulted in identification of several homologs in Acinetobacter gyllenbergii (all 4 sequenced strains that are listed in GenBank), Klebsiella variicola (2 strains), Klebsiella oxytoca (1 strain) and Klebsiella pneumoniae (6 strains) with moderate amino acid sequence similarity to the query (E values ranging from 9e-11 to 9e-18, all identified strains and their genome accession numbers are listed in the 6 ACS Paragon Plus Environment

Page 7 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table S1). Further analysis confirmed the presence of nearby mcjA, mcjC, and mcjD homologs organized in compact clusters. In all cases, class II lasso peptide precursors were identified (representative clusters shown in Figure 1a). Further all genes (ABCD) were clustered in a single operon, as opposed to the gene cluster organization of microcin J25, in which expression of the precursor peptide and the BCD genes are regulated by different promoters burhizin

(36).

(18)

A similar arrangement was previously reported for the capistruin

(37)

and

gene clusters. Importantly, many characterized lasso peptide clusters lack a

dedicated ABC-transporter and phylogenetic analyses have revealed that such clusters often encode an isopeptidase, which can hydrolyze the isopeptide bond to yield the linear peptide

(14, 20).

The function of lasso peptides encoded in such gene clusters is unknown,

but scavenger and signaling functions have been proposed (10). A comparison of the newly identified genes and homologous genes of microcin J25, capistruin, burhizin, and astexin-1 (a representative member of isopeptidase-encoding clusters) is shown in Table S2. The putative lasso peptide cluster from A. gyllenbergii NIPH 230 contains a gene coding for a predicted transposase of the IS30 family, which may have caused inactivation of the biosynthetic enzymes. The predicted lasso cluster from K. variicola T29A has stop codons interrupting the mcjC and mcjD homologs reading frames, indicating that the cluster is inactive or that deposited sequence contains mistakes. Sequence analysis of the precursor peptides encoded by the A. gyllenbergii clusters revealed that they are identical. The predicted precursor peptides from the Klebsiella species are identical except at positions 9, 10, and 20 in the leader part (Table S1). For further study, we selected a cluster from each A. gyllenbergii CIP 110306 and K. pneumoniae 4541-2 as representatives for their corresponding genera. The primary structures of the putative lasso peptides could be predicted as the core regions met basic sequence requirements for mature lasso peptides: a Gly residue in the first position of the 7 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 39

core part, internal Glu or Asp in position 8 or 9 and a Thr residue in the penultimate position of the leader (20). Accordingly, lasso peptides from A. gyllenbergii CIP 110306 and K. pneumoniae 4541-2 should consist of 18 and 19 amino acids, respectively and, similar to microcin J25, contain a Gly1-Glu8 isopeptide bond, which forms an 8-residue macrolactam ring (Figure 1b). The bulky side chains of Tyr16 and Tyr17 of acinetodin and His17 and Tyr18 of klebsidin were predicted to be involved in entrapping the C-termini and thus prevent unthreading.

Isolation of the lasso peptides acinetodin and klebsidin Lasso peptides from Proteobacteria tend to be better produced in minimal media in the natural hosts. Those clusters that contain a dedicated ABC-transporter typically secrete the mature product into the culture medium

(13, 37).

When A. gyllenbergii CIP 110306 was

cultivated in basal mineral medium supplemented with 1% sodium acetate (38), MALDI-TOF mass spectra of the supernatant revealed the presence of an intense mass peak (m/z=1978.9), which corresponds to the predicted mass of a sodium adduct of the lasso peptide ([M+Na]+ = 1978.895). Fractionation of the culture supernatant using high performance liquid chromatography (HPLC, analytical C18 column) yielded a pure compound (Figures 2a and 2b). High-resolution mass spectrometry identified a primary mass ion at m/z=1956.914 ([M+H]+) consistent with the calculated m/z of the predicted product, corresponding to the last 18 amino acids of the precursor peptide with a loss of single molecule of H2O ([M+H]+ = 1956.913) (Figure 2c). The MS/MS fragmentation pattern was also consistent with the primary structure of the predicted lasso peptide (Figure 2d, Table S3). This lasso peptide was named acinetodin. A large-scale fermentation followed by fractionation of culture supernatant via Sep-Pack and HPLC produced pure acinetodin with yields ranging from 7 to 10 mg/L. 8 ACS Paragon Plus Environment

Page 9 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Heterologous expression of lasso clusters from Proteobacteria has been shown to be an efficient approach for isolation of novel lasso peptides when production in natural hosts is insufficient or hampered by problems related to cultivation (18). Since only genomic DNA of K. pneumoniae 4541-2 was available to us, the heterologous expression of the predicted biosynthetic gene cluster in E. coli was attempted. The entire kleABCD cluster was cloned into a plasmid expression vector under the control of an inducible araPBAD promoter, with the start codon of the first gene encoding the precursor peptide positioned at an optimal distance from the consensus ribosome binding site present in the vector. E. coli BW25113 cells containing the plasmid with the complete kleABCD lasso cluster were grown in M9 minimal medium supplemented with 1% glycerol as a carbon source and 0.2% L-arabinose as an inducer. During HPLC fractionation a prominent peak was detected that was absent in the supernatant of an E. coli BW25113 culture carrying an empty vector and cultivated under the same conditions (Figures 3a and 3b). A primary ion of m/z=2032.923 ([M+H]+) was detected by HR-MS, consistent with the calculated m/z of 2032.923 [M+H]+ for a lasso peptide containing 19 amino acids of the C-terminal part of the precursor peptide with a loss of a single molecule of H2O (Figure 3c). Analysis of MS/MS fragmentation spectra confirmed the primary structure of the lasso peptide (Figure 3d, Table S4). Upon largescale cultivation and purification 3-5 mg/L yields of recombinant lasso peptide, named klebsidin, were achieved. Similar production levels were observed during heterologous expression of other lasso clusters from Proteobacteria in E. coli (18).

Structural characterization of acinetodin and klebsidin using NMR spectroscopy To verify that acinetodin and klebsidin in fact contain a lasso motif, we calculated the three-dimensional structures of both peptides using NMR NOESY constraints and the CYANA algorithm (39). In this method, NOESY data, acquired with parameters that maximize 9 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 39

the number of cross-peaks while avoiding spin diffusion, are used to perform iterative rounds of molecular dynamics simulations and comparison of the computed structures with the provided constraints. To fully assign the NOESY cross-peaks, we also collected and analyzed a full set of 1D and 2D NMR data, including 1H, COSY, TOCSY, HSQC, and HMBC spectra (Figures S1 and S2, Tables S5 and S6). Complete assignment of these spectra followed by CYANA calculations led to the three-dimensional models shown, with the top ten calculated structures overlaid for each peptide (Figure 4a, c, Figure S3). For both acinetodin and klebsidin, the calculations converged with the top ten structures exhibiting a low rmsd. Both peptides clearly contain a lasso motif, consistent with the experiments above and the designation of these RiPPs as lasso peptides. The calculated structure of acinetodin shows a large but well-structured loop. The lasso structure is held in place by the di-Tyr motif (Tyr16 and Tyr17), with one of these located above the ring and the other below (Figure 4b), as predicted from the primary sequence. The klebsidin structure exhibits a slightly different topology with the loop appearing tighter and the ring occupying a bent conformation. Steric locks are also present in this peptide, provided by His17 above and Tyr18 below the ring (Figure 4d). We also compared the surface charge of these two peptides to each other and to that of microcin J25 (Figure S4). Previous mutagenesis studies have shown that Tyr9, Phe10, Phe19, and Tyr20 in microcin J25 are crucial for inhibition of E. coli RNAP (Figure 1) (23). Mutation to other residues renders the antibiotic significantly less active or abolishes activity completely. In the computed structure of microcin J25

(40, 41),

these residues form a

hydrophobic pocket with Tyr9/ Phe10 and Phe19/Tyr20 lining this binding surface (Figure S4). Interestingly, while klebsidin and acinetodin share little seqeuence homology with microcin J25, this hydrophobic patch is structurally conserved. In klebsidin, residues Phe9/Phe10 and Tyr18 contribute to this pocket. It is less hydrophobic than that of 10 ACS Paragon Plus Environment

Page 11 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


microcin J25, due to the lack of an additional aromatic residue at the C-terminus. In the case of acineotidin, Trp10 and Tyr16/Tyr17 form a hydrophobic patch. The indole side chain of Trp10 conveys a small degree of polar character to this area owing to its secondary amine (Figure S4). Further, the presence of Thr9 in acinetodin (Tyr9 in microcin J25 and Phe9 in klebsidin) also contributes to a more hydrophilic surface compared to the other two lasso peptides. We conclude that despite little sequence homology, microcin J25, klebsidin, and acinetodin share a hydrophobic surface patch, which in the case of microcin J25 has been shown to be important for inhibition of E. coli RNAP. The potential relevance of this common feature is further addressed below.

Thermal and proteolytic stability of acinetodin and klebsidin Generally, a lasso scaffold endows peptides with resistance against thermal denaturation and degradation by proteases, although not all lasso peptides show this behavior. Thermal stability of acinetodin and klebsidin was evaluated by incubation at 95 °C for 4 hours. While heat-treated acinetodin showed no change in chromatographic retention time and the subsequent MS/MS analysis confirmed it was identical to the untreated compound, a second peak with a different retention time was observed with heat-treated klebsidin (Figure S5). MS and MS/MS analysis revealed that the new peak contains a deamidated derivative of klebsidin, a result of hydrolysis of an Asn-carboxamide to a carboxylic acid, which likely causes the shift. These results indicate that klebsidin and acinetodin retain their threaded conformations. We also assessed their susceptibility to carboxypeptidase Y, because it has been validated as a useful approach for distinguishing threaded conformations of lasso peptides from their branched cyclic topoisomers. Neither heat-treated nor untreated acinetodin and klebsidin were susceptible to carboxypeptidase Y, thereby corroborating that acinetodin and klebsidin are highly heat stable (Figure S6). 11 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 39

To further study resistance to proteolyctic digestion, klebsidin and acinetodin were treated with the promiscuous proteinase K. Treatment of klebsidin with proteinase K resulted in cleavage of the peptide bond between Asn13 and Gly14, yielding a single new species with the linear part of the tail trapped in the ring, that has a different column retention time and m/z 2050.96 ([M+H]+) as revealed by HPLC, MS and MS/MS analysis (Figures S7, S8c, d). HPLC analysis of acinetodin treated by proteinase K for 4 hours at 55 °C yielded a pair of HPLC peaks with very similar retention times. Prolonged incubation (16 hours) resulted in disappearance of the peak corresponding to an intact acinetodin (Figure S7). In the digested material several different species were detected using MALDI-TOF-MS including the one with observed m/z 1974.91 ([M+H]+), MS/MS of this ion revealed that cleavage by proteinase K mainly occurs between Trp10 and Val11 (Figure S8a,b). Of all lasso peptides studied to date, similar behavior was reported only for microcin J25, whose digestion with thermolysin resulted in formation of two polypeptide chains that remained interlocked in solution and in gas phase due to topological trapping of the tail in the macrolactam ring (42). We conclude that results of proteolytical stability are in agreement with structural data revealed by NMR spectroscopy.

Antibacterial activity Acinetodin showed no growth inhibition of several Gram-negative and Gram-positive bacteria tested (E. coli DH5α, E. coli BW25113, Pseudomonas aeruginosa PA01, Acinetobacter baumannii ATCC 17978, A. baumannii 19606, Bacillus subtilis str. 168, Klebsiella pneumoniae and Staphylococcus aureus ATCC 25923) in the agar diffusion assay on LB or M9 media. Klebsidin was active only against K. pneumoniae strains at high concentration with an MIC of 256 µM in M9 medium. Since antimicrobial activity of microcins in numerous cases has been shown to be species-specific and dependent on 12 ACS Paragon Plus Environment

Page 13 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


active transport inside bacterial cells, we decided to test intracellular toxicity of recombinant acinetodin and klebsidin upon accumulation in E. coli cells (34, 35, 43). Secretion in culture medium of microcin J25 depends on the activity of a dedicated ATP-binding cassette transporter and expression of only the mcjABC is toxic to the cells

(28).

We

constructed an expression plasmid containing the klebsidin biosynthesis cluster with disrupted kleD gene and a similar plasmid bearing the aciABC genes. E. coli BW25113 cultures expressing the kleABC genes showed immediate cessation of growth in M9 minimal medium upon the addition of L-arabinose inducer. Expression of aciABC genes also considerably slowed down bacterial growth (Figure S9). Heterologous expression of aciABCD resulted in production of acinetodin in the medium (Figure S10) and was not toxic even in nutrient-poor medium. Cells producing klebsidin from a plasmid containing the entire operon kleABCD also grew normally (data not shown).

We conclude that

intracellular accumulation of acinetodin and klebsidin inhibits cell growth. The expression of fhuA from E. coli has been shown to render resistant S. typhumurium cells sensitive to micocin J25. We hypothesized that expression of fhuA homologs from strains encoding acinetodin and klebsidin in E. coli can enable corresponding lasso peptide penetration and thereby lead to growth inhibition. Because only K. pneumonia 4541-2, but not A. gyllenbergii, encodes an fhuA homolog (60% identical to E. coli fhuA), we investigated how expression of fhuA from K. pneumoniae in E. coli would influence sensitivity to klebsidin and acinetodin. Indeed, E. coli expressing K. pneumoniae fhuA became sensitive to klebsidin but not to acinetodin, thus supporting our hypothesis (Figure S11). Klebsidin and acinetodin inhibit elongation by E. coli RNA polymerase The results presented in the previous section suggest that klebsidin and acinetodin are able to target an essential cytoplasmic process in E. coli. Two class II lasso-peptides, microcin 13 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 39

J25 and capistruin, inhibit E. coli RNA polymerase despite the apparent lack of sequence similarity

(44).

We tested the ability of purified klebsidin and acinetodin to affect nascent

RNA elongation by single molecules of wild-type E. coli RNAP using a novel single molecule technique, acoustic force spectroscopy (AFS, Lumicks)

(45).

This technique allows the

experimenter to stretch a DNA molecule by a broad range of forces while simultaneously measuring its length with nanometer accuracy. AFS has a distinct advantage over optical tweezers methods used to study transcription elongation since it allows simultaneous observations of dozens of transcription complexes on individual templates offering a substantially higher throughput, a distinct advantage when screening for novel inhibitors. The set-up of our AFS experiment is shown in Figure S12. Stalled transcription elongation complexes (see Methods) were attached to streptavidin-coated beads via biotin-modified E. coli RNAP. The downstream end of the DNA template was labeled with multiple digoxigenin molecules and attached to the AFS chip surface coated with anti-digoxigenin antibodies. The DNA between stalled RNAP and digoxigenin-labeled end of the transcription template molecules was stretched by constant acoustic force generated by a piezo element. NTPs were next flushed in to restart the transcription elongation process and elongation profiles (Figure 5) were recorded by analyzing the displacement of individual microspheres resulting from RNAP movement. The parameters of transcript elongation (pauses/velocity pattern and transcription elongation rate) in the absence of inhibitors were in good agreement with those obtained with other single molecule techniques

(46-48).

The overall transcription rate, calculated as

total length of transcribed DNA/total time, was 15.9 ± 3.9 nt/s (mean ± SD). The addition of microcin J25 caused concentration-dependent increase in the appearance of long pauses interrupted by periods of transcription at seemingly unaffected rate, also consistent with previously published single-molecule analyses (30). The addition of klebsidin and acinetodin 14 ACS Paragon Plus Environment

Page 15 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


also caused extended pausing by individual elongating RNAP molecules. The slope between pausing events, reporting elongation rate, remained unchanged, while the probability and length of pausing events increased along with lasso peptide concentration. Klebsidin activity was comparable to that of microcin J25 while acinetodin was much less active (Figure 5). The overall transcription rates were 2.9 ± 1.4 nt/s and 1.2 ± 0.4 nt/s at 2.5 µM and 5 µM microcin J25, respectively. These values were 6 ± 2.4 nt/s and 1.9 ± 0.7 nt/s for 2.5 µM and 5 µM klebsidin, and 10.7 ± 4.2 nt/s and 4.6 ± 1.9 nt/s for 5 µM and 25 µM acinetodin.

Microcin J25-resistant RNAP is also resistant to klebsidin and acinetodin Microcin J25 and capistruin bind E. coli RNAP in the secondary channel, blocking the access of NTPs to the catalytic center. A T931I mutation in the largest RNAP subunit β’ alters a residue in the secondary channel and prevents lasso peptide binding, making cells resistant to both microcin J25 and capistruin

(44).

To validate results obtained in single-molecule

analysis and to determine if T931I substitution also causes resistance to klebsidin and acinetodin, transcription elongation by wild-type and mutant E. coli RNAP was performed using a bulk single-round transcription assay (Figure 6). As transcription template we used a linear DNA fragment containing a strong T7 A1 promoter and an intrinsic terminator located further downstream. In the absence of transcription inhibitors, RNAP produced two products – a 70 nt long terminated transcript and a 149 nt run-off transcript. When transcription by wild-type RNAP was performed in the presence of 50 µM microcin J25, both the terminated and run-off transcripts disappeared. Instead, shorter transcripts corresponding to microcin J25–induced pauses were observed. In the presence of 100 µM microcin J25, no transcripts were observed, indicating that the RNAP was unable to escape the promoter and synthesize RNA. Transcription by T931I RNAP was unaffected by 15 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 39

microcin J25. Similarly, klebsidin inhibited wild-type RNAP transcription at both concentrations tested but had no effect on T931I enzyme transcription. In agreement with AFS and intracellular toxicity data, acinetodin was a weaker inhibitor of transcription. In the presence of 50 µM of this lasso peptide, most wild-type RNAPs reached transcription terminator but became stalled there. The effect is likely due to a terminator hairpininduced pause that provides sufficient time for acinetodin to bind to the transcription complex. At 100 µM, acinetodin caused accumulation of shorter transcripts, whose electrophoretic mobilities matched those of paused transcripts induced by low concentrations of microcin J25 and klebsidin. The T931I RNAP transcription was resistant to acinetodin. Importantly, unlike wild-type E. coli mutated E. coli BW25113 cells carrying a T931I substitution in rpoC gene and expressin fhuA from K. pneumonia was shown to be resistant to klebsidin thus indicating that observed inhibition of cell growth was caused by inhibition of RNAP solely (data not show). We conclude that both klebsidin and acinetodin target RNAP through the secondary channel and their binding site overlaps, wholly or partially, with the microcin J25 binding site. Although the main factor that determines activity profiles of lasso peptides targeting RNAP is most probably the uptake by the target bacteria, the RNAP inhibition efficiency is also likely to be a factor. Acinetodin showed weaker RNAP inhibitory activity than microcin J25 or klebsidin, which correlates with weaker inhibition upon accumulation in E. coli cells. Besides E. coli RNAP, microcin J25 inhibits RNAPs from Gammaproteobacteria P. aeruginosa and Xanthomonas oryzae but does not inhibit RNAP from another Gammaproteobacteria Francisella tularensis

(31,

44).

Capistruin from Burkholderia

thailandensis E264 has also been shown to inhibit RNAP from E. coli and P. aeruginosa but not from F. tularensis (44). We speculate that the ability of RNAP-targeting lasso peptides to inhibit RNAP from other bacteria may partially correlate with genetic distances between 16 ACS Paragon Plus Environment

Page 17 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


these bacteria and lasso-peptide producing strains. While the amino acid sequence of the β’ subunit of the RNAP from K. pneumoniae 4541-2 shares 98% identity with the E. coli RNAP, the amino acid sequence of the β’ subunit of RNAP from A. gyllenbergii CIP 110306 is only 72% identical (83% similar). Testing expanded panels of RNAPs from bacteria of different clades may allow to reveal target-specificity determinants of microcin J25, capistruin, klebsidin, and acinetodin, compounds that have no apparent sequence similarity and yet act on identical or overlapping binding sites on at least one RNAP.

Conclusions Herein, we identified two new lasso peptides, klebsidin and acinetodin, encoded by several human-associated species of Klebsiella and Acinetobacter. Their detailed structural characterization by HR-MS, NMR, computational methods, and protease treatment verify that they contain a canonical lasso motif, with the ring formed between Gly1 and Glu8, and steric locks provided by aromatic amino acids above and below the macrolactam ring. Although klebsidin and acinetodin did not inhibit growth of wt E. coli, expression of the biosynthetic genes in E. coli without the cognate export pumps strongly inhibited cell growth. Using a novel single-molecule AFS technique, we designed a medium-throughput assay for kinetic analysis of transcription elongation by E. coli RNAP and showed that acinetodin and klebsidin, like microcin J25, inhibit transcript elongation. Analysis of a microcin J25-resistant RNAP indicates that the binding sites of acinetodin, klebsidin, microcin J25 overlap. Indeed, three-dimensional models of the three peptides reveal a hydrophobic patch, which appears to be conserved to some degree, despite the lack of primary sequence conservation. This patch has been shown to be important for inhibition of E. coli RNAP by microcin J25. Previously, it was shown that capistruin also binds to the same site on RNAP

(44),

suggesting that this region may be a common inhibition site by 17 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 39

diverse lasso peptides. The inability to permeate E. coli and at least some of the other bacteria tested in this work likely explains the observed absence of antimicrobial activity of klebsidin and acinetodin. The narrow range of bioactivity makes it likely that in complex microbial communities, the purpose of lasso peptide production may not be limited to inhibition of bacterial growth, but that it may convey other, yet-unknown benefits to the producing cells.


Page 19 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


METHODS Bacterial strains and growth conditions. A. gyllenbergii CIP 110306T was kindly provided by Dr. O. Soutourina and was originally obtained from the collection of Institute Pasteur (CIP). A. gyllenbergii CIP 110306T was grown in LB medium (1 L contains 10 g of NaCl, 10 g of tryptone, 5 g of yeast extract) and basal mineral medium (1 L contains 10 g of KH2PO4, 5 g of Na2HPO4, 2 g of (NH4)2SO4, 0.2 g of MgSO4∙7H2O, 0.001 g of CaCl2∙2H2O, 0.001 g of FeSO4∙7H2O, pH 7.0) described previously (2, 38) supplemented with 1% sodium acetate. E. coli DH5α, E. coli BW25113, E. coli BL21(DE3), Pseudomonas aeruginosa PA01, Acinetobacter baumannii ATCC 17978, A. baumannii 19606, Bacillus subtilis str. 168, Klebsiella pneumoniae (isolated in St. Petersburg Research Institute of Children’s Infections of the Federal Medical and Biological Agency of Russia), and Staphylococcus aureus ATCC 25923 were grown in LB medium or M9 minimal medium (1 L contains 12.8 g Na2HPO4∙7H2O, 3 g KH2PO4, 0.5 g NaCl, 1 g NH4Cl, 1 mL of 2M MgSO4 solution, 100 µL of 1M CaCl2 solution) supplemented with 1 % glycerol and 0.1% yeast extract. Genomic DNA of K. pneumoniae 4541-2

(49)

was kindly provided by Dr. David A.

Rasko (University of Maryland School of Medicine). Molecular cloning of lasso clusters Restriction enzymes, Pfu DNA polymerase and reagents for routine molecular cloning were purchased from Thermo Fisher Scientific. A 4.2 kb-fragment containing the entire kleABCD operon was amplified from K. pneumoniae 4541-2 genomic DNA by using oligonucleotides Klasso_NcoI_F (5’TATTACCATGGTGCAACAGAAAAAAAATGACC-3’)

and


Klasso_XhoI_R

(5’-


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 39

ATTAACTCGAGCTAAATCAAACCTTTACTCTTCCACT-3’). The fragment was digested with NcoI and XhoI restriction enzymes and cloned into the pBAD His/B plasmid, yielding plasmid pBAD-kleABCD. To construct a plasmid carrying the klebsidin cluster with disrupted kleD gene plasmid pBAD-kleABCD was digested with the EcoRI restriction enzyme, which resulted in excision of the 3’-terminal part of the kleD gene, the ends were blunted and ligated yielding the pBAD-kleABC plasmid. To construct a plasmid carrying the aciABC genes, a 2.6 kb-fragment of the aciABCD operon was amplified from A. gyllenbergii CIP 110306 by using oligonucleotides Alasso_Nco_F (5’- ATATACCATGGAAAATCTTAATAAAATGTTCAAAA-3’) and Alasso_Hind_R (5’- ATTATAAAGCTTTTATTTCACCCTCCAAACAAATTGTCTG-3’), digested with NcoI and HindIII and cloned into pBAD His/B, yielding plasmid pBAD-aciABC. MALDI-TOF MS and MS-MS analysis High-resolution mass spectra were recorded on a Fourier Transform Ion Cyclotron Resonance Mass Spectrometer (Varian 902-MS) equipped with a 9.4 T magnet (FTMS) in positive MALDI mode. The instrument was calibrated using a ProteoMass Peptide MALDIMS Calibration Kit (Sigma-Aldrich). The accuracy of the mass peak measurement was 2.5 ppm. Samples (0.5 µL) were spotted on a steel plate with 0.5 µL of a 2,5-Dihydroxybenzoic acid matrix (Sigma-Aldrich) and air-dried at room temperature. Fragment ion spectra were recorded on an AB SCIEX TOF/TOF 5800 MALDI massspectrometer. The instrument was calibrated using a Mass Standards Kit for Calibration of AB Sciex TOF/TOF Instruments (AB Sciex). Samples (0.5 µL) were spotted on a steel plate with 0.5 µL of α-cyano-4-hydroxycinnamic acid matrix solution (AB Sciex) and air-dried at room temperature. Fragment ion spectra were generated by collision-induced dissociation (CID) in MS/MS mode. The accuracy of the mass peak measurement was 30 ppm for parent


Page 21 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ions and 0.2 Da for daughter ions. Analysis of the MS and MSMS data was carried out manually by GPMAW4.04 software (Lighthouse Data).

Purification of lasso peptides A culture of E. coli BW25113 carrying the plasmid pBAD-kleABCD was grown overnight at 37 °C in 10 mL of LB medium supplemented with 100 µg/mL ampicillin. The bacterial cells were harvested by centrifugation for 10 min at 4000 × g, washed with PBS solution and used to inoculate 2 L of M9 supplemented with 1 % glycerol, 0.2 % arabinose and 100 µg/mL ampicillin. The culture was grown for 2 days at 30 °C and used for lasso peptide purification as described below. Acinetobacter gyllenbergii CIP 110306T was grown in 10 mL of LB medium for 24 hours at 30 °C, then the culture was centrifuged to pellet the cells, washed with PBS solution and used to inoculate 2 L of basal mineral medium supplemented with 1% sodium acetate. The culture was grown for 7 days at 30 °C. Bacterial cells were harvested by centrifugation for 20 min at 10000 × g. The supernatant was filtrated through a 0.45 µm filter and 200 µL aliquots were analyzed using a Shimadzu HPLC system (equipped with a LC-20AD pump, DGU-20A3R degasser and SPDM20A photodiode array detector) outfitted with a Supelcosil LC-18 HPLC column (120 Å; 250 × 4.6; 5 µm particle size) operating at a flow rate of 1.0 mL/min with a linear gradient of acetonitrile in 0.1% TFA (from 0 to 70% acetonitrile in 30 min). Absorbance was monitored at 220 nm. Fractions were collected manually and analyzed by MALDI-TOF MS. For large-scale purification of lasso peptides clarified supernatant (2 L) was loaded onto a Waters Sep-Pak 12 cc Vac C18 cartridge (55-105 µm particle size) and the cartridge was extensively washed with 20% acetonitrile-0.1% trifluoroacetic acid (TFA). Fractions 21 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 39

containing lasso peptides were eluted with 15 mL of 40% acetonitrile-0.1% TFA and concentrated at 40 °C and reduced pressure. Subsequent purification employed a Shimadzu HPLC outfitted with a Jupiter C18 HPLC column (300 Å; 250 × 4.6; 5 µm particle size) operating at 4 mL/min. The column was equilibrated with 0.1% TFA and the bound material was eluted with a linear gradient of acetonitrile in 0.1% TFA (from 0 to 70% acetonitrile in 30 min). Absorbance was monitored at 220 nm. Lasso peptide-containing fractions were dried using a vacuum concentrator. Structure calculations NMR spectra were acquired at the Princeton University Department of Chemistry NMR Facilities. Spectra were collected at a concentration of 5 mM for each peptide in the triple resonance cryoprobe of a Bruker A8 Avance III HD 800 MHz NMR spectrometer. For both acinetodin and klebsidin, a NOESY spectrum acquired in H2O/D2O (9:1) at 283 K with a mixing time of 300 ms exhibited the greatest number of correlations, while avoiding spin diffusion, and was therefore used for structure calculations. Cross-peak positions and volumes in this spectrum were measured in MestReNova and assigned manually. These were given as initial input data for the calculations, which were performed in CYANA 2.1 on a Linux cluster. The isopeptide bond was incorporated via explicit distance constraints for the N-C bond between the N of Gly1 and the Cδ of Glu8. Specifically, the upper and lower limits for the N-Cδ bond length were set to 1.6 Å and 1.4 Å, respectively, with weighting factors of 1.00. These distances were based on the average bond length of an amide bond. Seven cycles of combined NOESY assignment and structure calculation were performed followed by a final structure calculation. Calibration parameters for extraction of distance constraints from cross-peak volumes were determined automatically. For each cycle and for the final calculation, 100 initial conformers were generated and a simulated annealing schedule, composed of 10,000 torsion angle dynamic steps, was applied to each conformer. 22 ACS Paragon Plus Environment

Page 23 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Statistics were generated for the 10 conformers with the lowest final target functions (see Table S7). The calculated conformers were visualized in PyMoL. Heat Stability and protease assays 10 µg of each lasso peptide dissolved in water was incubated at 95 °C for 4 hours, and samples were analyzed using a Shimadzu HPLC operating at a flow rate of 1.0 mL/min with a linear gradient of acetonitrile in 0.1% TFA (from 0 to 70% acetonitrile in 30 min). Absorbance was monitored at 220 nm. Fractions were collected manually for subsequent analysis by MALDI-TOF-MS. Untreated and heat-treated samples were lyophilized, dissolved in 50 µL of 50 mM MES buffer supplemented with 1mM CaCl2 (pH 6.8) and containing 0.5U of carboxypeptidase Y, and incubated for 6 hours at 25 °C. The reaction mixtures were analyzed as described above. 10 µg of purified klebsidin or acinetodin were incubated with 2 µg/mL proteinase K (Thermo Fisher Scientific) in 50 µL of 100 mM Tris (pH 8) buffer for 4 or 16 hours at 55 °C. Samples were analyzed using a Shimadzu HPLC operating at a flow rate of 1.0 mL/min with a linear gradient of acetonitrile in 0.1% TFA (from 0 to 70% acetonitrile in 30 min). Absorbance was monitored at 220 nm. Fractions were collected manually for subsequent analysis by MALDI-TOF-MS. In vitro transcription Wild-type E. coli RNAP σ70 holoenzyme was purchased from NEB. The [Thr931Ile] β’-RNAP holoenzyme mutant was in-house purified using standard procedure (44). To test inhibitory activity of the lasso peptides towards E. coli RNAP, we used a routine radioactive run-off transcription assay exploiting a linear T7 A1 promoter based template described earlier (50).

Briefly, to form transcription open complex (RPo), PCR-generated DNA fragment

extending from position -96 to +149 (+1 is a start of transcription) and E. coli RNAP were combined respectively at 30 nM and 85 nM of final concentration in 15 µL of transcription 23 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 39

buffer (40 mM Tris-HCl, 150 mM KCl, 10 mM MgCl2, 1 mM dithiothreitol, 0.01% Triton X100, pH 7.5) and incubated for 20 min at 37 °C. Then, 1 µL RPo was mixed with 9 µL inhibitor (pre-heated to 37 °C) at indicated concentration (0-100 µM) in transcription buffer and incubated at 37 °C for 5 min. A single round transcription reaction was initiated by adding 2 µL hot mix containing 0.5 µL of [α-32P]-UTP (10 mCi/mL, 3000 Ci/mmole), 0.6 µl of 4 mM each ATP, GTP, 2 mM CTP, 0.1 mM UTP, final of 0.2, 0.2, 0.1, 0.005 mM respectively, and 0.9 µL heparin in transcription buffer (final concentration 0.05 mg/mL). After 5 min of incubation at 37 °C, transcription reactions were terminated by the addition of an equal volume of formamide-containing loading buffer. After heating at 100 °C for 1 min, RNA products were resolved by denaturing 20% PAGE and analyzed by autoradiography.

Single-molecule AFS experiment DNA template (4,413 bp) consisting of the T7 A1 promoter, the downstream E. coli rpoB gene and two terminator sequences rrnB T1 and rrnB T2 was prepared by PCR from plasmid pRL574 (provided by R. Landick)

(51)

using digoxigenin modified 100nt

megaprimer

prl574megadig100R

(CATATCTACAAGCCATCCCCCCACAGATACGGTAAACTAGCCTCGTTTTTGCATCAGGAAAGCA GAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTG)

(52).

E. coli RNAP modified with biotin

was purified from cells transformed with co-overexpression plasmid pIA497 (provided by I. Artsimovitch). Stalled RNAP transcription complexes were formed in transcription buffer after 20 min of incubation at 37 °C in the presence of ribonucleotides ATP (35 µM), GTP (35 µM), CTP (35 µM) and ApU (500 µM), 1.6 nM DNA template and 100nM RNAP. Heparin was added to the final concentration of 50 µg/mL. 24 ACS Paragon Plus Environment

Page 25 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


AFS chip (Figure S12) represents a flow cell that consists of two glass slides with a fluid chamber in between. A Piezo element integrated in a flow cell driven by an oscillating voltage is used to excite a standing planar acoustic wave over an AFS chip generating forces acting on beads inside the chamber. Objects are imaged using an inverted microscope and CMOS digital camera (45). After several passivation stages the flow cell was supplied with stalled elongation complexes fixed on the surface. Final passivation stages: fixing stalled complex, supplying with suspension of 2.13 µm polystyrene streptavidin coated microspheres (Spherotech) and all experiments were performed in reaction buffer (40 mM Tris-HCl, 80 mM KCl, 0.5 mM DTT, 10 mM MgCl2, 0.02% pluronic, 0.02% casein, heparin 50 µg/mL). After flushing out all unbound microspheres and all necessary calibrations, the flow cell was supplied with rNTPs at 1 mM and the elongation was monitored. Experiments were performed at room temperature at constant force of 5 pN. Several tens of tethers were observed in real time by analyzing images of the beads. The image recording frequency was varied ensuing of quantity of beads analyzing simultaneously but mostly was performed at 50 Hz. Beads coordinates were analyzed from recorded images using a specially written software in Labview

(45).

Detection of transcription elongation was determined by decreasing the

length of DNA tether between the microsphere and the anchor point of the downstream end immobilized on the surface. Accession Codes The computed structures have been deposited to the Protein Data Bank (PDB IDs: 5U16 for acinetodin, 5U17 for klebsidin).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 39

SUPPORTING INFORMATION Supplementary figures and supplementary tables can be found in the Supporting Information. This material is available free of charge via the internet at http://pubs.acs.org.

ACKNOWLEDGMENTS We thank R. H. Ebright and S. C. Liu for providing a sample of E. coli [931Ile]β'-RNAP holoenzyme. We thank D. A. Rasko for providing genomic DNA of Klebsiella pneumoniae 4541-2 and O. Soutourina for providing A. gyllenbergii CIP 110306.

FUNDING SOURCES This work was supported in part by the Ministry of Education and Science of the Russian Federation grant 14.B25.31.0004 (to KS), the Russian Science Foundation grant 15-15-10017 (to MM) and the Dynasty Foundation Fellowship (to MM), and by the Searle Scholars Program provided by the Kinship Foundation (to MRS). The authors declare no competing financial interest.

REFERENCES 1.

2.

Ling, L. L., Schneider, T., Peoples, A. J., Spoering, A. L., Engels, I., Conlon, B. P., Mueller, A., Schaberle, T. F., Hughes, D. E., Epstein, S., Jones, M., Lazarides, L., Steadman, V. A., Cohen, D. R., Felix, C. R., Fetterman, K. A., Millett, W. P., Nitti, A. G., Zullo, A. M., Chen, C., and Lewis, K. (2015) A new antibiotic kills pathogens without detectable resistance, Nature 517, 455-459. Nemec, A., Musilek, M., Maixnerova, M., De Baere, T., van der Reijden, T. J., Vaneechoutte, M., and Dijkshoorn, L. (2009) Acinetobacter beijerinckii sp. nov. and 26 ACS Paragon Plus Environment

Page 27 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.

4. 5. 6.

7.

8.

9. 10. 11. 12.

13. 14.

Acinetobacter gyllenbergii sp. nov., haemolytic organisms isolated from humans, Int. J. Syst. Evol. Microbiol. 59, 118-124. Nguyen, D. D., Wu, C. H., Moree, W. J., Lamsa, A., Medema, M. H., Zhao, X., Gavilan, R. G., Aparicio, M., Atencio, L., Jackson, C., Ballesteros, J., Sanchez, J., Watrous, J. D., Phelan, V. V., van de Wiel, C., Kersten, R. D., Mehnaz, S., De Mot, R., Shank, E. A., Charusanti, P., Nagarajan, H., Duggan, B. M., Moore, B. S., Bandeira, N., Palsson, B. O., Pogliano, K., Gutierrez, M., and Dorrestein, P. C. (2013) MS/MS networking guided analysis of molecule and gene cluster families, Proc. Natl. Acad. Sci. U. S. A. 110, E2611-2620. Human Microbiome Project, C. (2012) Structure, function and diversity of the healthy human microbiome, Nature 486, 207-214. Human Microbiome Project, C. (2012) A framework for human microbiome research, Nature 486, 215-221. Bouslimani, A., Porto, C., Rath, C. M., Wang, M., Guo, Y., Gonzalez, A., Berg-Lyon, D., Ackermann, G., Moeller Christensen, G. J., Nakatsuji, T., Zhang, L., Borkowski, A. W., Meehan, M. J., Dorrestein, K., Gallo, R. L., Bandeira, N., Knight, R., Alexandrov, T., and Dorrestein, P. C. (2015) Molecular cartography of the human skin surface in 3D, Proc. Natl. Acad. Sci. U. S. A. 112, E2120-2129. Donia, M. S., Cimermancic, P., Schulze, C. J., Wieland Brown, L. C., Martin, J., Mitreva, M., Clardy, J., Linington, R. G., and Fischbach, M. A. (2014) A systematic analysis of biosynthetic gene clusters in the human microbiome reveals a common family of antibiotics, Cell 158, 1402-1414. Arnison, P. G., Bibb, M. J., Bierbaum, G., Bowers, A. A., Bugni, T. S., Bulaj, G., Camarero, J. A., Campopiano, D. J., Challis, G. L., Clardy, J., Cotter, P. D., Craik, D. J., Dawson, M., Dittmann, E., Donadio, S., Dorrestein, P. C., Entian, K. D., Fischbach, M. A., Garavelli, J. S., Goransson, U., Gruber, C. W., Haft, D. H., Hemscheidt, T. K., Hertweck, C., Hill, C., Horswill, A. R., Jaspars, M., Kelly, W. L., Klinman, J. P., Kuipers, O. P., Link, A. J., Liu, W., Marahiel, M. A., Mitchell, D. A., Moll, G. N., Moore, B. S., Muller, R., Nair, S. K., Nes, I. F., Norris, G. E., Olivera, B. M., Onaka, H., Patchett, M. L., Piel, J., Reaney, M. J., Rebuffat, S., Ross, R. P., Sahl, H. G., Schmidt, E. W., Selsted, M. E., Severinov, K., Shen, B., Sivonen, K., Smith, L., Stein, T., Sussmuth, R. D., Tagg, J. R., Tang, G. L., Truman, A. W., Vederas, J. C., Walsh, C. T., Walton, J. D., Wenzel, S. C., Willey, J. M., and van der Donk, W. A. (2013) Ribosomally synthesized and post-translationally modified peptide natural products: overview and recommendations for a universal nomenclature, Nat. Prod. Rep. 30, 108-160. Li, Y., Zirah, S. v., and Rebuffat, S. Lasso peptides : bacterial strategies to make and maintain bioactive entangled scaffolds. Hegemann, J. D., Zimmermann, M., Xie, X., and Marahiel, M. A. (2015) Lasso peptides: an intriguing class of bacterial natural products, Acc. Chem. Res. 48, 1909-1919. Maksimov, M. O., Pan, S. J., and James Link, A. (2012) Lasso peptides: structure, function, biosynthesis, and engineering, Nat. Prod. Rep. 29, 996-1006. Chokekijchai, S., Kojima, E., Anderson, S., Nomizu, M., Tanaka, M., Machida, M., Date, T., Toyota, K., Ishida, S., Watanabe, K., and et al. (1995) NP-06: a novel anti-human immunodeficiency virus polypeptide produced by a Streptomyces species, Antimicrob. Agents Chemother. 39, 2345-2347. Salomon, R. A., and Farias, R. N. (1992) Microcin 25, a novel antimicrobial peptide produced by Escherichia coli, J. Bacteriol. 174, 7428-7435. Maksimov, M. O., and Link, A. J. (2013) Discovery and characterization of an isopeptidase that linearizes lasso peptides, J. Am. Chem. Soc. 135, 12038-12047.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

15.

16.

17.

18.

19.

20. 21.

22.

23.

24.

25.

26.

27.

28.

29.

Page 28 of 39

Yan, K. P., Li, Y., Zirah, S., Goulard, C., Knappe, T. A., Marahiel, M. A., and Rebuffat, S. (2012) Dissecting the maturation steps of the lasso peptide microcin J25 in vitro, Chembiochem : a European journal of chemical biology 13, 1046-1052. Metelev, M., Tietz, J. I., Melby, J. O., Blair, P. M., Zhu, L., Livnat, I., Severinov, K., and Mitchell, D. A. (2015) Structure, bioactivity, and resistance mechanism of streptomonomicin, an unusual lasso peptide from an understudied halophilic actinomycete, Chemistry & biology 22, 241-250. Burkhart, B. J., Hudson, G. A., Dunbar, K. L., and Mitchell, D. A. (2015) A prevalent peptide-binding domain guides ribosomal natural product biosynthesis, Nature chemical biology 11, 564-570. Hegemann, J. D., Zimmermann, M., Zhu, S., Klug, D., and Marahiel, M. A. (2013) Lasso peptides from proteobacteria: Genome mining employing heterologous expression and mass spectrometry, Biopolymers 100, 527-542. Severinov, K., Semenova, E., Kazakov, A., Kazakov, T., and Gelfand, M. S. (2007) Lowmolecular-weight post-translationally modified microcins, Mol. Microbiol. 65, 13801394. Maksimov, M. O., Pelczer, I., and Link, A. J. (2012) Precursor-centric genome-mining approach for lasso peptide discovery, Proc. Natl. Acad. Sci. U. S. A. 109, 15223-15228. Li, Y., Ducasse, R., Zirah, S., Blond, A., Goulard, C., Lescop, E., Giraud, C., Hartke, A., Guittet, E., Pernodet, J. L., and Rebuffat, S. (2015) Characterization of Sviceucin from Streptomyces Provides Insight into Enzyme Exchangeability and Disulfide Bond Formation in Lasso Peptides, ACS Chem. Biol. 10, 2641-2649. Zhu, S., Hegemann, J. D., Fage, C. D., Zimmermann, M., Xie, X., Linne, U., and Marahiel, M. A. (2016) Insights into the Unique Phosphorylation of the Lasso Peptide Paeninodin, J. Biol. Chem. Pavlova, O., Mukhopadhyay, J., Sineva, E., Ebright, R. H., and Severinov, K. (2008) Systematic structure-activity analysis of microcin J25, J. Biol. Chem. 283, 2558925595. Pan, S. J., and Link, A. J. (2011) Sequence diversity in the lasso peptide framework: discovery of functional microcin J25 variants with multiple amino acid substitutions, J. Am. Chem. Soc. 133, 5016-5023. Piscotta, F. J., Tharp, J. M., Liu, W. R., and Link, A. J. (2015) Expanding the chemical diversity of lasso peptide MccJ25 with genetically encoded noncanonical amino acids, Chem. Commun. (Cambridge, U. K.) 51, 409-412. Al Toma, R. S., Kuthning, A., Exner, M. P., Denisiuk, A., Ziegler, J., Budisa, N., and Sussmuth, R. D. (2015) Site-directed and global incorporation of orthogonal and isostructural noncanonical amino acids into the ribosomal lasso peptide capistruin, Chembiochem : a European journal of chemical biology 16, 503-509. Hegemann, J. D., De Simone, M., Zimmermann, M., Knappe, T. A., Xie, X., Di Leva, F. S., Marinelli, L., Novellino, E., Zahler, S., Kessler, H., and Marahiel, M. A. (2014) Rational improvement of the affinity and selectivity of integrin binding of grafted lasso peptides, J. Med. Chem. 57, 5829-5834. Solbiati, J. O., Ciaccio, M., Farias, R. N., Gonzalez-Pastor, J. E., Moreno, F., and Salomon, R. A. (1999) Sequence analysis of the four plasmid genes required to produce the circular peptide antibiotic microcin J25, J. Bacteriol. 181, 2659-2662. Choudhury, H. G., Tong, Z., Mathavan, I., Li, Y., Iwata, S., Zirah, S., Rebuffat, S., van Veen, H. W., and Beis, K. (2014) Structure of an antibacterial peptide ATP-binding cassette transporter in a novel outward occluded state, Proc. Natl. Acad. Sci. U. S. A. 111, 9145-9150.


Page 29 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


30.

31.

32.

33.

34. 35. 36.

37.

38. 39. 40.

41.

42.

43.

44.

45. 46.

Adelman, K., Yuzenkova, J., La Porta, A., Zenkin, N., Lee, J., Lis, J. T., Borukhov, S., Wang, M. D., and Severinov, K. (2004) Molecular mechanism of transcription inhibition by peptide antibiotic Microcin J25, Mol. Cell 14, 753-762. Yuzenkova, J., Delgado, M., Nechaev, S., Savalia, D., Epshtein, V., Artsimovitch, I., Mooney, R. A., Landick, R., Farias, R. N., Salomon, R., and Severinov, K. (2002) Mutations of bacterial RNA polymerase leading to resistance to microcin j25, J. Biol. Chem. 277, 50867-50875. Mathavan, I., Zirah, S., Mehmood, S., Choudhury, H. G., Goulard, C., Li, Y., Robinson, C. V., Rebuffat, S., and Beis, K. (2014) Structural basis for hijacking siderophore receptors by antimicrobial lasso peptides, Nature chemical biology 10, 340-342. Salomon, R. A., and Farias, R. N. (1995) The peptide antibiotic microcin 25 is imported through the TonB pathway and the SbmA protein, J. Bacteriol. 177, 33233325. Vincent, P. A., Delgado, M. A., Farias, R. N., and Salomon, R. A. (2004) Inhibition of Salmonella enterica serovars by microcin J25, FEMS Microbiol. Lett. 236, 103-107. Killmann, H., Braun, M., Herrmann, C., and Braun, V. (2001) FhuA barrel-cork hybrids are active transporters and receptors, J. Bacteriol. 183, 3476-3487. Chiuchiolo, M. J., Delgado, M. A., Farias, R. N., and Salomon, R. A. (2001) Growthphase-dependent expression of the cyclopeptide antibiotic microcin J25, J. Bacteriol. 183, 1755-1764. Knappe, T. A., Linne, U., Zirah, S., Rebuffat, S., Xie, X., and Marahiel, M. A. (2008) Isolation and structural characterization of capistruin, a lasso peptide predicted from the genome sequence of Burkholderia thailandensis E264, J. Am. Chem. Soc. 130, 11446-11454. Cruze, J. A., Singer, J. T., and Finnerty, W. R. (1979) Conditions for quantitative transformation in Acinetobacter calcoaceticus, Curr. Microbiol. 3, 129-132. Guntert, P., Mumenthaler, C., and Wuthrich, K. (1997) Torsion angle dynamics for NMR structure calculation with the new program DYANA, J. Mol. Biol. 273, 283-298. Bayro, M. J., Mukhopadhyay, J., Swapna, G. V., Huang, J. Y., Ma, L. C., Sineva, E., Dawson, P. E., Montelione, G. T., and Ebright, R. H. (2003) Structure of antibacterial peptide microcin J25: a 21-residue lariat protoknot, J. Am. Chem. Soc. 125, 1238212383. Wilson, K. A., Kalkum, M., Ottesen, J., Yuzenkova, J., Chait, B. T., Landick, R., Muir, T., Severinov, K., and Darst, S. A. (2003) Structure of microcin J25, a peptide inhibitor of bacterial RNA polymerase, is a lassoed tail, J. Am. Chem. Soc. 125, 12475-12483. Rosengren, K. J., Blond, A., Afonso, C., Tabet, J. C., Rebuffat, S., and Craik, D. J. (2004) Structure of thermolysin cleaved microcin J25: extreme stability of a two-chain antimicrobial peptide devoid of covalent links, Biochemistry 43, 4696-4702. Metelev, M., Serebryakova, M., Ghilarov, D., Zhao, Y., and Severinov, K. (2013) Structure of microcin B-like compounds produced by Pseudomonas syringae and species specificity of their antibacterial action, J. Bacteriol. 195, 4129-4137. Kuznedelov, K., Semenova, E., Knappe, T. A., Mukhamedyarov, D., Srivastava, A., Chatterjee, S., Ebright, R. H., Marahiel, M. A., and Severinov, K. (2011) The antibacterial threaded-lasso peptide capistruin inhibits bacterial RNA polymerase, J. Mol. Biol. 412, 842-848. Sitters, G., Kamsma, D., Thalhammer, G., Ritsch-Marte, M., Peterman, E. J., and Wuite, G. J. (2015) Acoustic force spectroscopy, Nat. Methods 12, 47-50. Forde, N. R., Izhaky, D., Woodcock, G. R., Wuite, G. J., and Bustamante, C. (2002) Using mechanical force to probe the mechanism of pausing and arrest during



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

47.

48.

49.

50.

51. 52.

Page 30 of 39

continuous elongation by Escherichia coli RNA polymerase, Proc. Natl. Acad. Sci. U. S. A. 99, 11682-11687. Neuman, K. C., Abbondanzieri, E. A., Landick, R., Gelles, J., and Block, S. M. (2003) Ubiquitous transcriptional pausing is independent of RNA polymerase backtracking, Cell 115, 437-447. Shaevitz, J. W., Abbondanzieri, E. A., Landick, R., and Block, S. M. (2003) Backtracking by single RNA polymerase molecules observed at near-base-pair resolution, Nature 426, 684-687. Hazen, T. H., Zhao, L., Boutin, M. A., Stancil, A., Robinson, G., Harris, A. D., Rasko, D. A., and Johnson, J. K. (2014) Comparative genomics of an IncA/C multidrug resistance plasmid from Escherichia coli and Klebsiella isolates from intensive care unit patients and the utility of whole-genome sequencing in health care settings, Antimicrob. Agents Chemother. 58, 4814-4825. Semenova, E., Kuznedelov, K., Datsenko, K. A., Boudry, P. M., Savitskaya, E. E., Medvedeva, S., Beloglazova, N., Logacheva, M., Yakunin, A. F., and Severinov, K. (2015) The Cas6e ribonuclease is not required for interference and adaptation by the E. coli type I-E CRISPR-Cas system, Nucleic Acids Res. 43, 6049-6061. Schafer, D. A., Gelles, J., Sheetz, M. P., and Landick, R. (1991) Transcription by single molecules of RNA polymerase observed by light microscopy, Nature 352, 444-448. Paik, D. H., Roskens, V. A., and Perkins, T. T. (2013) Torsionally constrained DNA for single-molecule assays: an efficient, ligation-free method, Nucleic Acids Res. 41, e179.

FIGURES Figure 1. Gene clusters of E. coli mcjABCD gene homologs in A. gyllenbergii CIP 110306 and K. pneumoniae 4541-2. (a) Schematic representation of the E. coli mcjABCD gene cluster (at the top) and predicted lasso clusters (below). (b) Alignment of McjA and predicted precursor peptides from A. gyllenbergii CIP 110306 and K. pneumoniae 4541-2. McjA amino acids involved in isopeptide bond formation of microcin J25 and corresponding residues in predicted precursor peptides are highlighted in red. The cleavage site between leader peptide and core part of McjA is indicated by an asterisk.

Figure 2. Characterization of acinetodin. (a) UV-HPLC trace (220 nm) of supernatant of an A. gyllenbergii CIP 110306 culture. (b) UV-HPLC trace (220 nm) of HPLC purified acinetodin. The fraction subjected to MS analysis is indicated by an arrow. (c) High 30 ACS Paragon Plus Environment

Page 31 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


resolution FT-MS spectrum of HPLC purified acinetodin. The m/z values of major peak [M+H]+ as well as [M+Na]+ are indicated. (d) MS/MS fragmentation spectrum of acinetodin, b-ions are much more prominent and labeled in the spectrum; observed b- and y-ions are shown on the diagram structure and listed in the Table S3.

Figure 3. Characterization of klebsidin. (a) UV-HPLC trace (220 nm) of supernatant of an induced culture of E. coli BW25113 cells carrying the kleABCD cluster on a pBAD/HisB expression vector. An arrow indicates a peak that is absent in the control (cells transformed with empty pBAD/HisB) culture cultivated under the same conditions. (b) UVHPLC trace (220 nm) of HPLC purified klebsidin. The fraction subjected to MS analysis is indicated by an arrow. (c) High resolution FT-MS spectrum of HPLC purified klebsidin. The m/z values of major peak [M+H]+ as well as [M+Na]+ and [M+K]+ are indicated. (d) MS/MS fragmentation spectrum of klebsidin, prominent b- and y-ions are labeled in the spectrum, observed b- and y-ions are shown on the diagram structure and listed in the Table S4.

Figure 4. Calculation of the three-dimensional structures of acinetodin and klebsidin. (a) Solution structure of acinetodin (PDB ID 5U16); the top ten calculated conformers are superimposed. The isopeptide bond between Gly1 and Glu8 is shown in red. (b) Acinetodin structure shown in a different orientation, highlighting the steric locks, Tyr16 and Tyr17 (both in red), above and below the ring, respectively. (c) Solution structure of klebsidin (PDB ID 5U17); the top ten calculated conformers are superimposed, with the isopeptide bond is shown in red. (d) Klebsidin structure shown in a different orientation, highlighting His18 and Tyr19 (both in red), above and below the ring, respectively. In all panels, the ring in the lasso motif is shown in yellow and the loop in blue.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 39

Figure 5. Inhibition of RNAP in a single-molecule AFS experiment. Representative elongation profiles for individual RNAPs for various concentrations of microcin J25, klebsidin, and acinetodin and in the absence of inhibitors plotted as nucleotides transcribed vs. time. Data were filtered by 0.5 Hz low pass filter.

Figure 6. Mutant microcin J25-resistant E. coli RNAP β’-[T931I] is resistant to klebsidin and acinetodin. Transcriptionally-competent open complexes (RPo) were formed by mixing E. coli RNAP holoenzyme or its derivative carrying the T931I substitution in β’ and a DNA template containing the T7 A1 promoter in the presence or in the absence of lasso peptides at indicated concentrations (µM). A single round transcription reaction was initiated by adding a radioactive NTP mix containing heparin. After 5 min of incubation at 37 °C, transcription reactions were stopped, and RNA products were resolved by denaturing 20% PAGE and analyzed by autoradiography. ROT – run-off transcript, TT – terminated transcript, mcj25 – microcin J25, kleb – klebsidin, acin – acinetodin.


Page 33 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Graphical Table of Contents 72x35mm (300 x 300 DPI)

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. Gene clusters of E. coli mcjABCD gene homologs in A. gyllenbergii CIP 110306 and K. pneumoniae 4541-2. (a) Schematic representation of the E. coli mcjABCD gene cluster (at the top) and predicted lasso clusters (below). (b) Alignment of McjA and predicted precursor peptides from A. gyllenbergii CIP 110306 and K. pneumoniae 4541-2. McjA amino acids involved in isopeptide bond formation of microcin J25 and corresponding residues in predicted precursor peptides are highlighted in red. The cleavage site between leader peptide and core part of McjA is indicated by an asterisk. 137x70mm (300 x 300 DPI)


Page 34 of 39

Page 35 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Characterization of acinetodin. (a) UV-HPLC trace (220 nm) of supernatant of an A. gyllenbergii CIP 110306 culture. (b) UV-HPLC trace (220 nm) of HPLC purified acinetodin. The fraction subjected to MS analysis is indicated by an arrow. (c) High resolution FT-MS spectrum of HPLC purified acinetodin. The m/z values of major peak [M+H]+ as well as [M+Na]+ are indicated. (d) MS/MS fragmentation spectrum of acinetodin, b-ions are much more prominent and labeled in the spectrum; observed b- and y-ions are shown on the diagram structure and listed in the Table S3. 90x58mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. Characterization of klebsidin. (a) UV-HPLC trace (220 nm) of supernatant of an induced culture of E. coli BW25113 cells carrying the kleABCD cluster on a pBAD/HisB expression vector. An arrow indicates a peak that is absent in the control (cells transformed with empty pBAD/HisB) culture cultivated under the same conditions. (b) UV-HPLC trace (220 nm) of HPLC purified klebsidin. The fraction subjected to MS analysis is indicated by an arrow. (c) High resolution FT-MS spectrum of HPLC purified klebsidin. The m/z values of major peak [M+H]+ as well as [M+Na]+ and [M+K]+ are indicated. (d) MS/MS fragmentation spectrum of klebsidin, prominent b- and y-ions are labeled in the spectrum, observed b- and y-ions are shown on the diagram structure and listed in the Table S4. 103x76mm (300 x 300 DPI)


Page 36 of 39

Page 37 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Calculation of the three-dimensional structures of acinetodin and klebsidin. (a) Solution structure of acinetodin (PDB ID 5U16); the top ten calculated conformers are superimposed. The isopeptide bond between Gly1 and Glu8 is shown in red. (b) Acinetodin structure shown in a different orientation, highlighting the steric locks, Tyr16 and Tyr17 (both in red), above and below the ring, respectively. (c) Solution structure of klebsidin (PDB ID 5U17); the top ten calculated conformers are superimposed, with the isopeptide bond is shown in red. (d) Klebsidin structure shown in a different orientation, highlighting His18 and Tyr19 (both in red), above and below the ring, respectively. In all panels, the ring in the lasso motif is shown in yellow and the loop in blue. 67x65mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5. Inhibition of RNAP in a single-molecule AFS experiment. Representative elongation profiles for individual RNAPs for various concentrations of microcin J25, klebsidin, and acinetodin and in the absence of inhibitors plotted as nucleotides transcribed vs. time. Data were filtered by 0.5 Hz low pass filter. 67x49mm (300 x 300 DPI)


Page 38 of 39

Page 39 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Mutant microcin J25-resistant E. coli RNAP β’-[T931I] is resistant to klebsidin and acinetodin. Transcriptionally-competent open complexes (RPo) were formed by mixing E. coli RNAP holoenzyme or its derivative carrying the T931I substitution in β’ and a DNA template containing the T7 A1 promoter in the presence or in the absence of lasso peptides at indicated concentrations (µM). A single round transcription reaction was initiated by adding a radioactive NTP mix containing heparin. After 5 min of incubation at 37 °C, transcription reactions were stopped, and RNA products were resolved by denaturing 20% PAGE and analyzed by autoradiography. ROT – run-off transcript, TT – terminated transcript, mcj25 – microcin J25, kleb – klebsidin, acin – acinetodin. 65x58mm (300 x 300 DPI)


Acinetodin and Klebsidin, RNA Polymerase Targeting Lasso Peptides

Recommend Documents