Ag Striped Nanowires for Bioanalysis | Langmuir

Silica-coated nanowires before (D), and after 20 min (E) and 30 min (F) sonication ...... Alexey Povolotskiy, Anastasia Povolotckaia, Yuriy Petrov, Al...
3 downloads 0 Views 329KB Size
Download PDF
11334

Langmuir 2007, 23, 11334-11341

Silica-Coated, Au/Ag Striped Nanowires for Bioanalysis James A. Sioss,† Rebecca L. Stoermer,†,‡ Michael Y. Sha,‡ and Christine D. Keating*,† Department of Chemistry, The PennsylVania State UniVersity, UniVersity Park, PennsylVania 16802, and Oxonica Inc., Mountain View, California 94043 ReceiVed July 3, 2007. In Final Form: August 3, 2007 Striped metallic nanowires (NW) have been coated with a silica shell of controllable thickness (6-150 nm), and the assay performance of coated vs uncoated NW has been compared. The silica coating does not interfere with identification of the metal striping pattern and protects Ag segments from oxidation, extending the range of assay conditions under which barcoded NW can be used. Much higher and more uniform fluorescence intensities were observed for dye-labeled ssDNA bound to SiO2-coated as compared to intensities for uncoated NW. Simultaneous, multiplexed DNA hybridization assays for three pathogen-specific target sequences on SiO2-coated NW showed good discrimination of complementary from noncomplementary targets. Application of SiO2-coated NW in discrimination of single base mismatches corresponding to a mutation of the p53 gene was also demonstrated. Finally, we have shown that thiolated probe DNA resists desorption under thermocycling conditions if attached via siloxane chemistry to SiO2-coated NW, but not if it is attached via direct adsorption to bare Au/Ag NW.

Introduction Noble metal nano- and microparticles are increasingly used for signal amplification and/or identification in a range of analytical and bioanalytical applications.1-10 Probe chemistries such as DNA oligonucleotides are often attached to these particles * To whom correspondence should be addressed. E-mail: keating@ chem.psu.edu. † The Pennsylvania State University. ‡ Oxonica Inc. (1) (a) Rosi, N. L.; Mirkin, C. A. Chem. ReV. 2005, 105, 1547-1562. (b) Wang, J. Small 2005, 1, 1036-1043. (c) Alvisatos, P. Nat. Biotechnol. 2004, 22, 47-52. (d) Cheng, M. M.-C.; Cuda, G.; Bunimovich, Y. L.; Gasperi, M.; Heath, J. R.; Hill, H. D.; Mirkin, C. A.; Nijdam, A. J.; Terracciano, R.; Thundat, T.; Ferrari, M. Curr. Opin. Chem. Biol. 2006, 10, 11-19. (2) (a) Taton, T. A.; Mirkin, C. A.; Letsinger, R. L. Science 2000, 289, 17571760. (b) Nam, J.-M.; Thaxton, C. S.; Mirkin, C. A. Science 2003, 301, 18841886. (c) Cao, Y. C.; Jin, R.; Mirkin, C. A. Science 2002, 297, 1536-1540. (d) Stoeva, S. I.; Lee, J.-S.; Smith, J. E.; Rosen, S. T.; Mirkin, C. A. J. Am. Chem. Soc. 2006, 128, 8378-8379. (3) (a) Willets, K. A.; Van Duyne, R. P. Ann. ReV. Phys. Chem. 2007, 58, 267-97. (b) Stuart, D. A.; Yuen, J. M.; Shah, N. C.; Lyandres, O.; Yonzon, C. R.; Glucksberg, M. R.; Walsh, J. T.; Van Duyne, R. P. Anal. Chem. 2006, 78, 7211-7215. (c) Zhao, J.; Das, A.; Zhang, X.; Schatz, G. C.; Sligar, S. G.; Van Duyne, R. P. J. Am. Chem. Soc. 2006, 128, 11004-11005. (4) (a) Nicewarner-Pena, S. R.; Freeman, R. G.; Reiss, B. D.; He, L.; Pena, D. J.; Walton, I. D.; Cromer, R.; Keating, C. D.; Natan, M. J. Science 2001, 294, 137-141. (b) Keating, C. D.; Natan, M. J. AdV. Mater. 2003, 15, 451-454. (5) (a) Stoermer, R. L.; Cederquist, K. B.; McFarland, S. K.; Sha, M. Y.; Penn, S. G.; Keating, C. D. J. Am. Chem. Soc. 2006, 128, 16892-16903. (b) Sha, M. Y.; Yamanaka, M.; Walton, I. D.; Norton, S. M.; Stoermer, R. L.; Keating, C. D.; Natan, M. J.; Penn, S. G. NanoBiotechnology 2005, 1, 327-336. (6) (a) Sha, M. Y.; Walton, I. D.; Norton, S. M.; Taylor, M.; Yamanaka, M.; Natan, M. J.; Xu, C.; Drmanac, S.; Huang, S.; Borcherding, A.; Drmanac, R.; Penn, S. G. Anal. Bioanal. Chem. 2006, 384, 658-666. (b) Tok, J. B.-H.; Chuang, F. Y. S.; Kao, M. C.; Rose, K. A.; Pannu, S. S.; Sha, M. Y.; Chakarova, G.; Penn, S. G.; Dougherty, G. M. Angew. Chem., Int. Ed. 2006, 45, 6900-6904. (7) (a) Favier, F.; Walter, E. C.; Zach, M. P.; Benter, T.; Penner, R. M. Science 2001, 293, 2227-2231. (b) Gasparac, R.; Taft, B. J.; Lapierre-Devlin, Lazarek, A. D.; Xu, J. M.; Kelley, S. O. J. Am. Chem. Soc. 2004, 126, 12279-12271. (8) (a) Wang, J. Electroanalysis 2007, 19, 769-776. (b) Castaneda, M. T.; Alegret, S.; Merckoci, A. Electroanalysis 2007, 19, 743-753. (9) (a) Lyon, L. A.; Musick, M. D.; Smith, P. C.; Reiss, B. D.; Pena, D. J.; Natan, M. J. Sens. Actuators, B 1999, 54, 118-124. (b) He, L.; Musick, M. D.; Nicewarner, S. R.; Salinas, F. G.; Benkovic, S. J.; Natan, M. J.; Keating, C. D. J. Am. Chem. Soc. 2000, 122, 9071-9077. (c) Driskell, J. D.; Kwarta, K. M.; Lipert, R. J.; Porter, M. D.; Neill, J. D.; Ridpath, J. F. Anal. Chem. 2005, 77, 6147-6154. (d) Hazarika, P.; Ceyhan, B.; Niemeyer, C. M. Small 2005, 1, 844848. (10) (a) Yu, C.; Irudayaraj, J. Anal. Chem. 2007, 79, 572-579. (b) Bishnoi, S. W.; Rozell, C. J.; Levin, C. S.; Gheith, M. K.; Johnson, B. R.; Johnson, D. H.; Halas, N. J. Nano Lett. 2006, 6, 1687-1692. (c) Hirsch, L. R.; Jackson, J. B.; Lee, A.; Halas, N. J.; West, J. L. Anal. Chem. 2003, 75, 2377-2381.

via thiol-Au or thiol-Ag bonding, which is convenient, well understood, and thermodynamically stable.1,11,12 We have reported Ag/Au striped metal nanowires (NW) as encoded supports for multiplexed fluorescence biodetection using thiol as well as other attachment chemistries.4,5,13,14 The NW length and Ag/Au striping pattern are determined by the conditions used during electrodeposition of Ag and Au metals within the pores of alumina template membranes. Differences in the reflectivity of Au and Ag under blue illumination are used to visualize the striping, or “barcode” pattern.4,14 Potential advantages of barcoded nanowires in multiplexed analysis include the relatively large number of optically distinguishable striping patterns as compared with organic fluorophores, and the flexibility of suspension arrays15,16 as compared with planar surface arrays. Conventional optical microscopes are readily available for readout, probe-coated NW can be added at the same or different concentrations as each assay demands, and the ease of sample mixing leads to rapid target binding. In addition, the Ag/Au NW surfaces are readily functionalized with thiolated oligonucleotides, antibodies, neutravidin/biotin, or other probe chemistries.4,5,13,14 Direct attachment of bioassay probe chemistries such as singlestranded DNAs to the metal surface can be undesirable for two reasons. First, proximity to metal surfaces can interfere with (11) (a) Ulman, A. Chem. ReV. 1996, 96, 1533-1554. (b) Love, J. C.; Estroff, L. A.; Kriebel, J. K.; Nuzzo, R. G.; Whitesides, G. M. Chem. ReV. 2005, 105, 1103-1170. (12) (a) Mirkin, C. A.; Letsinger, R. L.; Mucic, R. C.; Storhoff, J. J. Nature 1996, 382, 607-609. (b) Alivisatos, A. P.; Johnsson, K. P.; Peng, X.; Wilson, T. E.; Loweth, C. J.; Bruchez, M. P., Jr.; Schultz, P. G. Nature 1996, 382, 609611. (13) Mbindyo, J. K. N.; Reiss, B. R.; Martin, B. R.; Keating, C. D.; Natan, M. J.; Mallouk, T. E. AdV. Mater. 2001, 13, 249-254. (14) Nicewarner-Pena, S. R.; Carado, A. J.; Shale, K. E.; Keating, C. D. J. Phys. Chem. B 2003, 107, 7360-7367. (15) Nolan, J. P.; Sklar, L. A. Trends Biotechnol. 2002, 20, 9-12. (16) (a) Kellar, K. L.; Iannone, M. A. Exp. Hematol. 2002, 30, 1227-1237. (b) Dejneka, M. J.; Streltsov, A.; Pal, S.; Frutos, A. G.; Powell, C. L.; Yost, K.; Yuen, P. K.; Muller, U.; Lahiri, J. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 389393. (c) He, B.; Son, S. J.; Lee, S. B. Langmuir 2006, 22, 8263-8265. (d) Hernandez, C. J.; Mason, T. G. J. Phys. Chem. C 2007, 111, 4477-4480. (e) Han, M.; Gao, X.; Nie, S. Nat. Biotechnol. 2001, 19, 631-635. (f) Braeckmans, K.; De Smedt, S. C.; Roelant, C.; Leblans, M.; Pauwels, R.; Demeester, J. Nat. Mater. 2003, 2, 169-173. (g) Zhi, Z.-l.; Morita, Y.; Hasan, Q.; Tamiya, E. Anal. Chem. 2003, 75, 4125-4131. (h) He, B.; Son, S. J.; Lee, S. B. Anal. Chem. 2007, 79, 5257-5263. (i) Pregibon, D. C.; Toner, M.; Doyle, P. S. Science 2007, 315, 1393-1396.

10.1021/la7019846 CCC: $37.00 © 2007 American Chemical Society Published on Web 09/19/2007

Silica-Coated, Au/Ag Striped Nanowires

fluorescence emission (quenching, or in some cases, enhancing it).17,18 Although changes in emission intensity with metal-dye separation have been taken advantage of by ourselves and others in molecular beacon-style sensors,5,19,20 in other sensor designs it is preferable to avoid this complexity. Separation of the fluorescence-based sensing chemistry from the metal surface could reduce or eliminate dye-metal interactions and simplify sensor performance. Second, although thiol attachment chemistry is simple and widely used to bind molecules of interest to Au and Ag surfaces,1,11,12 the lability of the metal-S bond can be a problem, particularly at elevated temperature or in the presence of solution-phase thiols. Under these conditions, surface-bound thiols are lost or exchanged with thiols from solution.23,24 Biosensing applications requiring use in thiol-containing solutions and/or at elevated temperature are not uncommon: many enzymes commonly used in molecular biology are stored and/or assayed in solutions containing dithiothreitol (DTT) or β-mercaptoethanol (BME) and are used at mildly elevated (∼40 °C) or thermocycling (∼95 °C) temperatures. Under these conditions, probe molecules bound via thiol moieties can detach from the surface. Thus, some sensing applications require a more robust attachment chemistry. Here, we introduce a glass coating on the surface of the barcoded metal nanowires as a solution to problems inherent in both thiol-Au/Ag surface chemistry and dye-metal electromagnetic interactions. Nano- and microparticles of various sizes, shapes, and compositions have been coated with silica previously for a variety of applications.25-27 Liz-Marzan and Mulvaney first introduced synthetic protocols for silica coating of Au nanospheres via a modified Stober process28 more than a decade ago.29,30 Coating the Au nanoparticle surface with an organosilane to render it vitreophilic enabled deposition of homogeneous silica shells of controlled thickness.30 It is also possible to deposit (17) (a) Moskovits, M. ReV. Mod. Phys. 1985, 57, 783-819. (b) Meitiu, H. Prog. Surf. Sci. 1984, 17, 153-320. (c) Neumann, T.; Johannson, M.-L., Kambhampati, D.; Knoll, W. AdV. Funct. Mater. 2002, 12, 575-586. (18) (a) Lakowicz, J. R. Anal. Biochem. 2005, 337, 171-194. (b) Malicka, J.; Gryczynski, I.; Gryczynski, Z.; Lakowicz, J. R. Anal. Biochem. 2003, 315, 5766. (19) Stoermer, R. L.; Keating, C. D. J. Am. Chem. Soc. 2006, 128, 1324313254. (20) Dubertret, B.; Calame, M.; Libchaber, A. J. Nat. Biotechnol. 2001, 19, 365-370. (21) Maxwell, D. J.; Taylor, J. R.; Nie, S. J. Am. Chem. Soc. 2002, 124, 9606-9612. (22) (a) Du, H.; Disney, M. D.; Miller, B. L.; Krauss, T. D. J. Am. Chem. Soc. 2003, 125, 4012-4013. (b) Du, H.; Strohsahl, C. M.; Camera, J.; Miller, B. L.; Krauss, T. D. J. Am. Chem. Soc. 2005, 127, 7932-7940. (23) Demers, L. M.; Mirkin, C. A.; Mucic, R. C.; Reynolds, R. A.; Letsinger, R. L.; Elghanian, R.; Viswanadham, G. Anal. Chem. 2000, 72, 5535-5541. (24) (a) Nicewarner-Pena, S. R.; Raina, S.; Goodrich, G. P.; Fedoroff, N. V.; Keating, C. D. J. Am. Chem. Soc. 2002, 124, 7314-7323. (b) Dillenback, L. M.; Goodrich, G. P.; Keating, C. D. Nano Lett. 2006, 6, 16-23. (25) Caruso, R. A.; Antonietti, M. Chem. Mater. 2001, 13, 3272-3282. (26) (a) Mulvaney, S. P.; Musick, M. D.; Keating, C. D.; Natan, M. J. Langmuir 2003, 19, 4784-4790. (b) Doering, W. E.; Nie, S. Anal. Chem. 2003, 75, 61716176. (c) Aslan, K.; Wu, M.; Lakowicz, J. R.; Geddes, C. D. J. Am. Chem. Soc. 2007, 129, 1524-1525. (d) Tovmachenko, O. G.; Graf, C.; van den Heuvel, D. J.; van Blaaderen, A.; Gerritsen, H. C. AdV. Mater. 2006, 18, 91-95. (e) Smith, J. E.; Wang, L.; Tan, W. TrAC, Trends Anal. Chem. 2006, 25, 848-855. (f) Smith, J. E.; Medley, C. D.; Tang, Z.; Shangguan, D.; Lofton, C.; Tan, W. Anal. Chem. 2007, 79, 3075-3082. (g) Selvin, S. T.; Patra, P. K.; Ang, C. Y.; Ying, J. Y. Angew. Chem., Int. Ed. 2007, 46, 2448-2452. (27) (a) Cao, Y.-C.; Huang, Z.-L.; Liu, T.-C.; Wang, H.-Q.; Zhu, X.-X.; Wang, Z.; Zhao, Y.-D.; Liu, M.-X.; Luo, Q.-M. Anal. Biochem. 2006, 351, 193-200. (b) Nann, T.; Mulvaney, P. Angew. Chem., Int. Ed. 2004, 43, 5393-5396. (c) Lu, Y.; Yin, Y. D.; Mayers, B. T.; Xia, Y. N. Nano Lett. 2002, 2, 182-186. (d) Matoussevitch, N.; Gorschinski, A.; Habicht, W.; Bolle, J.; Dinjus, E.; Bonnemann, H.; Behrens, S. J. Magn. Magn. Mater. 2007, 311, 92-96. (e) Zhang, P.; Steelant, W.; Kumar, M.; Scholfield, M. J. Am. Chem. Soc. 2007, 129, 4526-4527. (f) Ung, T.; Liz-Marzan, L. M.; Mulvaney, P. Langmuir 1998, 14, 3740-3748. (28) Stober, W.; Fink, A.; Bohn, E. J. Colloid Interface Sci. 1968, 26, 62-69. (29) Liz-Marzan, L. M.; Philipse, A. P. J. Colloid Interface Sci. 1995, 176, 459-466. (30) (a) Liz-Marzan, L. M.; Geirsig, M.; Mulvaney, P. J. Chem. Soc., Chem. Commun. 1996, 731. (b) Liz-Marzan, L. M.; Giersig, M; Mulvaney, P. Langmuir 1996, 12, 4329-4335.

Langmuir, Vol. 23, No. 22, 2007 11335

silica shells without the organosilane coating; Hardikar and Matijevic demonstrated SiO2 deposition on untreated, ascorbatereduced Ag nanoparticles in 2000.31 Numerous variations on the silica-coating chemistry have appeared.32 Recently, several groups have prepared metal core-silica shell nanorods or nanowires.33-35 For example, Mallouk and co-workers prepared SiO2-coated nanowires within a membrane template,35 following early work on TiO2 sol-gel deposition by the Martin group.36 Several groups have reported synthesis of metal-SiO2 core-shell nanorods and nanowires via sol-gel deposition onto suspensions of particles.33,34 Silica coatings can protect the particles from chemical etchants and oxidation, prevent adsorption of molecules directly to the metal, and/or provide attachment points for biomolecules. The silica shell can also act as a structural support, holding metal nanoparticles in place after partial etching of the original metallic nanowire or nanorod core structure.37,38 In this paper, we describe the addition of a silica coating to Ag/Au barcoded NW, and show the impact of this coating on barcoded NW bioassay performance. Silica thickness was controlled from 6 to >150 nm by varying deposition conditions. The glass coating provided protection against chemical etching of Ag segments by nitric acid, and did not interfere with Au/Ag striping pattern identification. Probe DNA oligonucleotides were attached to the silica surface with the use of siloxane-based modification chemistries; these probe-functionalized nanowires were then used in a multiplexed sensing format to detect three different target sequences simultaneously. Readout for the simultaneous sandwich hybridization assays was via correlation of Alexa 647 fluorescence from labeled detection strands with underlying NW striping patterns. Multiplexed biosensing experiments performed with siloxane-based probe attachment to SiO2 as compared with parallel experiments using thiol attachment to Ag/Au metal showed much higher fluorescence intensity for assays performed on the glass-coated NW. Emission along the length of the NW was more uniform for NW coated with a thick silica shell as compared to uncoated NW or those coated with a thin shell. We have taken advantage of the improved fluorescence intensity and uniformity in an assay for single base mismatch sequences. Finally, the DNA probe attachment chemistry on silica-coated NW was stable at the high temperatures required for thermocycling reactions, in contrast to direct thiolNW (Au/Ag) attachment. Materials and Methods Materials. Tetraethoxysilane (TEOS) and 3-aminopropyltrimethoxy silane (APTMS) were purchased from Gelest. Cyless silver and orotemp 24 (Au) plating solutions were purchased from Technic. All water was purified to 18.2 MΩ with a Barnstead nanopure system. Reagents for buffers used in these experiments included 10 mM (31) Hardikar, V. V.; Matijevic, E. J. Colloid Interface Sci. 2000, 221, 133136. (32) (a) Hall, S. R.; Davis, S. A.; Mann, S. Langmuir 2000, 16, 1454-1456. (b) Liu, S.; Zhang, Z.; Han, M. Anal. Chem. 2005, 77, 2595-2600. (c) Graf, C.; Vossen, D. L. J.; Imhof, A.; van Blaaderen, A. Langmuir 2003, 19, 6693-6700. (d) Liu, S.; Han, M. AdV. Funct. Mater. 2005, 15, 961-967. (e) Kang, S. M.; Lee, K.-B.; Kim, D. J.; Choi, I. S. Nanotechnology 2006, 17, 4719-4725. (33) Yin, Y.; Lu, Y.; Sun, Y.; Xia, Y. Nano Lett. 2002, 2, 427-430. (34) (a) Obare, S. O.; Jana, N. R.; Murphy, C. J. Nano Lett. 2001, 11, 601603. (b) Pastoriza-Santos, I.; Perez-Juste, J.; Liz-Marzan, L. M. Chem. Mater. 2006, 18, 2465-2467. (35) Kovtyukhova, N. I.; Mallouk, T. E.; Mayer, T. S. AdV. Mater. 2003, 15, 780-785. (36) (a) Cepak, V. M.; Hulteen, J. C.; Che, G.; Jirage, K. B.; Lakshmi, B. B.; Fisher, E. R.; Martin, C. R.; Yoneyama, H. Chem. Mater. 1997, 9, 1065-1067. (b) Lakshmi, B. B.; Dorhout, P. K.; Martin, C. R. Chem. Mater. 1997, 9, 857862. (c) Cepak, V. M.; Hulteen, J. C.; Che, G.; Jirage, K. B.; Lakshmi, B. B.; Fisher, E. R.; Martin, C. R. J. Mater. Res. 1998, 13, 3070-3080. (37) Sioss, J. A.; Keating, C. D. Nano Lett. 2005, 5, 1779-1783. (38) Hunyadi, S. E.; Murphy, C. J. J. Phys. Chem. B 2006, 110, 7226-7231.

11336 Langmuir, Vol. 23, No. 22, 2007

Sioss et al. Table 1. DNA Sequences Used in This Work

name

sequence 5′-3′

description

SSF P1 T1 F1 P2 T2 F2 P3 T3 F3 N21A N21A-T N21B N21B-T SSF2

TTTTTTTTTTCCATCAATGAGGAAGCTGCA GCT ATG TCA CTT CCC CTT TTT TTT TTT T AAG GGG AAG TGA CAT AGC AGG AAC TAC TAG TAC CCT AGG GTA CTA GTA GTT CCT CCT CTT CGT CTA ACA ACA TTT TTT TTT T TGT TGT TAG ACG AAG AGG CAG GTC CCC TAG AAG AAG CTT CTT CTA GGG GAC CTG CCA ACA CTA CTC GGC TAG TTT TTT TTT T CTA GCC GAG TAG TGT TGG GTC GCG AAA GGC CTT GTG CAC AAG GCC TTT CGC GAC TTT TTT TTT TTT TTT TTT TGT GAG GCG CTG CCC GGG CAG CGC CTC ACA TTT TTT TTT TTT TTT TTT TGT GAG GCA CTG CCC GGG CAG TGC CTC ACA TTT TTT TTT ATA GTA GAA ACC ACA AAG GAT TTT TTT

5′ thiol, 3′ Alexa 647 HIV probe, 3′ Thiol HIV target HIV tag, 5′ Alexa 647 HBV probe, 3′ thiol HBV target HBV tag, 5′ Alexa 647 HCV probe, 3′ thiol HCV target HCV tag, 3′ Alexa 647 P53 wild-type probe complement to N21A P53 mutant probe complement to N21B 5′ thiol, 3′ Tamra

PBS (0.138 M NaCl; 0.0027 M KCl; pH 7.4, from Sigma), 2-morpholinoethanesulfonic acid (MES, 50 mM, pH 4.5 from T. J. Baker), 2× tetramethyl ammonium chloride (TMAC, from Sigma) and, SSPE (150 mM sodium chloride, 10 mM sodium phosphate, 1.25 mM EDTA, Promega). Sodium dodecyl sulfate (SDS) and 10 mM N-cyclohexyl-2-aminoethanesulfonic acid (CHES) were purchased from Aldrich, and bovine serum albumin (BSA), 1-ethyl3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC), and sulfosuccinimidyl 4-[N-maleimidomethyl]cyclohexane-1-carboxylate (sulfo-SMCC) were purchased from Pierce. Streptavidin-Cy5 (SA) was purchased from eBioScience (San Diego, CA). DNA oligonucleotide sequences (listed in Table 1) were purchased from Integrated DNA Technologies or Biosource International Inc (Foster City, CA). Upon receipt of thiolated DNA, the disulfide was cleaved with 100 mM dithiothreitol (DTT) and purified with a centrispin 10 column from Princeton Separations.5 Nanowires. NW were either synthesized in-house or purchased from Nanoplex Technologies (now Oxonica, Mountain View, CA). The commercial NW are marketed as Nanobarcodes particles, and are prefunctionalized with a monolayer of mercaptoundecanoic acid (MUA). Both in-house and commercial striped NW are synthesized via templated electrodeposition39,40 using Whatman anodisc filter membranes 0.2 µm nominal pore diameter. Striped Ag/Au NW prepared in-house were synthesized as previously described.4 Briefly, Ag was deposited on one side of the membranes using an Edwards Auto 306 evaporator. NW were electrodeposited under constant current into the pores of the aluminum oxide filter with an EG&G model 273a potentiostat. Where noted in the text, these NW were coated with ω-functionalized alkanethiols (mercaptoundecanoic acid or mercaptopropyltriethoxysilane) after release from the Al2O3 template membranes. A 1-mL batch of either in-house or commercial NW contains ∼1 × 109 particles. Standard Silica Coating (20 nm). Silica was deposited onto in-house grown metallic NW by a modified Stober process, as previously reported.37 Typically, the silica coating was grown by adding to 300 µL of NW suspension, 40 µL of TEOS, 10 µL of 28% ammonium hydroxide, 160 µL of H2O, and 490 µL of ethanol. After sonicating the reaction for 1 h, the particles were washed three times with ethanol by centrifugation and resuspension. Samples were stored in 1 mL of ethanol for future use. Preparation of Thin Silica Coating (13.5 nm). NW with a thin silica shell were prepared using commercial striped NW (Nanobarcodes particles) in a modification of the standard procedure described above. A 1-mL batch of wires was rinsed two times in ethanol to remove some of the residual MUA and then was resuspended in 490 µL of ethanol, 160 µL of water, 40 µL of TEOS, and 10 µL of 28% ammonium hydroxide. The solution was sonicated for 1 min to suspend and mix all materials and then was allowed to react at room temperature with gentle rotation for 45 min. The resulting SiO2(39) Hornyak, G. L.; Patrissi, C. J.; Martin, C. R. J. Phys. Chem. B 1997, 101, 1548. (40) AlMawlawi, D.; Coombs, N.; Moskovits, M. J. Appl. Phys. 1991, 70, 4421.

coated NW were then rinsed three times in ethanol and stored in 1 mL of ethanol until use. Preparation of Thick Silica Coating (100 nm). NW with a thick silica shell were prepared from commercial striped NW (Nanobarcodes particles) in another modification of the standard procedure, in this case decreasing the quantity of NW while adding identical quantities of the other reagents to achieve a thicker coating. NW were rinsed and resuspended in ethanol, after which 500 µL of the NW sample was mixed with 500 µL of ethanol, 160 µL of water, 40 µL of TEOS, and 10 µL of 28% ammonium hydroxide. Samples were then sonicated for 30 s and allowed to react at room temperature for 1 h while tumbling. After rinsing the resulting silica-coated NW three times in ethanol and resuspending into 500 µL, the entire procedure was repeated a second time to deposit additional silica onto the particles. These samples were rinsed and stored in 1 mL of ethanol until use. Silver Etching. For silver etching studies, 10-µL aliquots of NW suspension were rinsed three times with distilled water and then sonicated in 400 µL of 10% nitric acid for varying lengths of time. Following sonication, samples were rinsed with water two times by centrifugation, followed by rinsing three times with ethanol prior to imaging. DNA Attachment to Silica Using Sulfo-SMCC. Thiolated DNA was attached to silica-coated nanowires using a bifunctional crosslinker, sulfo-SMCC, which links an amine to a thiol. To a 150-µL aliquot of silica-coated nanowires, 15 µL of aminopropyltrimethoxy silane was added, and the total volume was brought to 400 µL with ethanol. The sample was vortexed to keep the nanowires suspended for 30 min, after which the sample was rinsed three times by centrifugation at 7700g with ethanol and two times with CHES buffer (pH ∼9.0). A solution of 1 mg sulfo-SMCC in 400 µL of CHES buffer was added to the nanowire sample and vortexed for 1 h. The nanowires were rinsed twice with CHES buffer, followed by two rinses with 50 mM sodium phosphate buffer at pH 7.2 (SPB). The sample was then mixed with 50 µL of 20 µM probe DNA (P1, P2, or P3) and vortexed for 1 h, followed by three rinses in SPB, and resuspension in 150 µL of SPB. DNA Attachment Directly to Metallic NW Using Thiolated DNA. DNA was attached to metal NW by adding 50 µL of 20 µM probe DNA (P1, P2, or P3) to a 50-µL aliquot of wires (rinsed one time with SPB) and allowing them to react while vortexing for 1 h at room temperature. The wires were then rinsed three times by centrifugation at 7700g with SPB and resuspended in 50 µL of SPB. DNA Hybridization for Triplex Assay. Aliquots of bare (10 µL) or silica-coated (30 µL) nanowires with probe DNA attached were resuspended in 400 µL of SPB with 300 mM NaCl. Then 10 µL of 20 µM target DNA (T1, T2, or T3) was added, and samples were vortexed for 1 h at room temperature to allow hybridization of the target DNA, followed by rinsing three times with 0.3 M PBS. Fluorescently labeled DNA (10 µL of 20 µM F1, F2, or F3) was then added to the samples. After vortexing 1 h at room temperature to allow hybridization of the labeled DNA, samples were rinsed three times in 0.3 M PBS and resuspended in 100 µL of 0.3 M PBS

Silica-Coated, Au/Ag Striped Nanowires for imaging. In these multiplexed detection experiments, NW with probes (P1, P2, or P3) attached were mixed together before adding target sequences. Single Base Mismatch (SBM) Assay Probe Conjugation to NW. Nanowires (300 µL of Nanobarcodes particles) patterned 00010110100, and 000100110000 were silica coated with a 40nm-thick layer of silica. The coated wires were rinsed three times in ethanol and resuspended in 930 µL of ethanol, 50 µL of water, and 20 µL of APTMS. Nanowires were allowed to react at room temperature with gentle rotation for 1 h and then were rinsed two times in ethanol and two times in DMSO, and were resuspended in 1 mL of DMSO. Added to the APTMS functionalized NBCs was 10 µL of 0.4 M succinic anhydride (SSA) solution, which was allowed to react for 1 h at room temperature while rotating, after which an additional 10 µL of 0.4 M SSA was added and allowed to react at room temperature for another hour while tumbling. The samples were then rinsed three times in MES buffer (pH 4.5) and resuspended in 320 µL of 50 mM MES buffer (pH 4.5), to which 3 µL of 100 µM DNA probe (either N21A or N21B) was added. The DNA probes used in this assay mimic regions in DNA that affect the function of P53, a tumor suppressor protein.41 After addition of the probe DNA, samples were placed on ice until a 20% EDC solution was prepared in 50 mM MES (pH 7.0), of which 30 µL was added to each sample and allowed to react for 1 h at 4 °C. The samples were then washed four times by centrifugation in 10 mM PBS, resuspended in 100 µL of the same buffer, and stored at 4 °C until use. SBM Assay: Hybridization of Target(s) and Dye Labeling. For hybridization of target(s) in each SBM assay, 34 µL of 2× TMAC hybridization buffer (2 M tetramethylammonium chloride, 75 mM Tris, and 6 mM EDTA) was added to new tubes along with 3 µL of 2 µM each oligo target. The targets were boiled for 1 min to dehybridize any strands that may have been interacting with each other as a result of frozen storage and then were placed on ice for 30 s before use. Probe-coated nanowires were added (3 µL of each type N21A and N21B) to the DNA target(s) (N21A-T and/or N21BT). Samples that contained no targets (control samples) were prepared the same as above except that, in place of adding DNA target, 3 µL of water was added. The samples were allowed to incubate at 55 °C for 30 min and then were centrifuged to remove the supernatant and were resuspended in 500 µL of 1× SSPE-0.1% SDS buffer. The samples were rotated at room temperature in this wash buffer for 10 min before removing the supernatant and resuspending the samples in 500 µL of 0.1× SSPE-0.05% SDS-1% BSA buffer. These samples were sonicated for 10 s, incubated at 55 °C for 7 min, centrifuged, and then resuspended in 100 µL of 10 mM PBS buffer. As a stock solution, 3 µL of streptavidin-Cy5 was diluted in 1.1 mL of water with 1% BSA added. From this stock solution of diluted streptavidin-Cy5, 100 µL was removed and added to each SBM assay. Samples were not sonicated after adding the streptavidin, so as not to disrupt the biotin-streptavidin binding. After gently rotating at room temperature for 30 min, samples were spun down, washed one time with 500 µL of 10 mM PBS, and resuspended in 50 µL of 10 mM PBS for imaging (see below). Thermocycling. Samples of bare and silica-coated nanowires were derivatized with fluorescently labeled, thiolated DNA (SSF) as described in the DNA attachment section. The NW were then subjected to thermocycling conditions on an Applied Biosystems GeneAmp 9600 in GeneAmp 1× PCR Buffer (25 mM tris(hydroxymethyl)-methyl-amino-propanesulfonic acid, sodium salt (TAPS) (50 mM KCl, 2 mM MgCl2, 1 mM β-mercaptoethanol, Applied Biosystems) under the following conditions: 94 °C for 30 s; 68 °C, 1 min, 25 cycles.42 Nanowire Imaging. Transmission electron microscope (TEM) images of silica-coated NW were either acquired using a JEOL JEM-1200 EXII with a high-resolution Tietz F224 digital camera or sent to Accurel (Sunnyvale, CA) for imaging. Samples were (41) (a) Levine, A. J. Cell 1997, 88, 323-331. (b) Ko, L. J.; Prives, C. Genes DeV. 1996, 10, 1054-1072. (c) Jayaraman, L.; Prives, C. Cell. Mol. Life Sci. 1999, 55, 76-87. (42) Geneamp PCR Reagent Kit with Amplitaq DNA Polymerase instructions, Applied Biosystems.

Langmuir, Vol. 23, No. 22, 2007 11337

Figure 1. TEM images of silica-coated nanowires coated with 0.14% (A), 0.28% (B), and 0.42% (C) NH4OH. The NW shown in (D) was coated two times with 0.28% NH4OH (scale bars ) 100 nm). prepared by dropping 8 µL of sample onto carbon-coated copper grids (EM sciences) and drying overnight. Two similar optical microscopes were used for imaging. For most experiments, a Nikon TE-300 inverted microscope with a Lambda 10-2 filter wheel (Sutter Instruments), a Xenon lamp, and a photometrics coolsnap HQ digital camera was used. NW were imaged with a 60× plan apo objective (1.4 NA) or 100× plan fluor objective (1.4 NA). Reflectivity images were taken under white light illumination or using a 430 ( 30-nm bandpass filter. Samples were prepared by sandwiching 8 µL of sample between a cover slip and microscope slide. For the SBM assay and thick silica shell experiments, images were collected using a Zeiss Axiovert 100 microscope outfitted with a Prior H107 stage, Sutter Instruments 300-W Xe lamp with liquid light guide, Physik Instrumente 400-µm travel objective positioner, and Photometrics CoolSnap HQ camera. A 63× objective was used with a NA 1.4. Reflectance images were acquired using a bandpass filter allowing for illumination using 406-nm light. Samples were prepared by adding 50-µL samples to the wells of a 96-well glass-bottom microscope plate and allowing the wires to settle to the bottom of the plate for at least 2 min before imaging. In all cases, fluorescence images were obtained using appropriate excitation and emission optical filters for the dye. NBSee software was used to identify NW barcode patterns and to quantify fluorescence intensity on each NW pattern within a sample, based on the reflectance and corresponding fluorescence images.

Results and Discussion Methods of Silica Coating. We varied silica coating thickness by control of (a) solution pH, (b) nanowire concentration, (c) NW chemical functionalization, and (d) number of sequential depositions. Optimization of these parameters provides uniform silica coating on the nanowires (Supporting Information, Figure 1) with minimal free silica formation. Figure 1 A-C shows the effect of increasing NH4OH concentration. SiO2 thickness was directly proportional to base concentration, increasing from 8 ( 2 at 0.14% NH4OH to 18 ( 2 and 40 ( 7 as [NH4OH] was increased 2-fold and 4-fold, respectively. For [NH4OH] > 0.28%, free SiO2 particles formed in solution. For NH4OH concentrations e0.28%, few to no SiO2 spheres were observed in the TEM images after rinsing. These results are in agreement with work by Xia and co-workers, in which 30-40-nm diameter Ag NW prepared by a polyol method were coated with 2-100 nm of SiO2.33 NW thickness also depended on NW concentration in

11338 Langmuir, Vol. 23, No. 22, 2007

the reaction, with thicker coatings forming when less NW surface area was available for deposition. For 320-nm diameter nanowires using our standard reaction conditions (300 µL of NW, 40 µL of TEOS, 10 µL of NH4OH, 160 µL of water, 490 µL of EtOH), uniform silica shell growth to 6 nm began to form after 5 min of reaction. This silica shell increased in thickness to ∼20 nm at 60 min; thicker SiO2 was deposited by repeated reaction (SiO2coated NW were rinsed and mixed with new reagents). Five consecutive coatings under these reaction conditions led to 150nm SiO2. We note that, while unfunctionalized NW can be coated with SiO2, pretreating the NW with mercaptoundecanoic acid gives a thicker coating for otherwise identical reaction conditions, while pretreatment with 3-mercaptopropyltriethoxysilane yielded a thinner and less homogeneous coating. The SiO2-coated NW shown in Figure 1D was prepared by first functionalizing the NW with mercaptoundecanoic acid prior to two consecutive reactions. It is important to note that the NW must be kept well suspended to prevent settling, which can lead to NW permanently linked through glass shells. We routinely vortex nanowire samples during surface functionalizations such as the silica deposition process. Nanowire Identification. NW barcode patterns are generally deciphered using NBSee software,5,43 which compares linescans for each NW in an image with a library of expected patterns based on differences in reflectivity for blue light (Ag . Au). We did not anticipate a substantial impact on reflectivity patterning from the change in refractive index (SiO2 vs H2O). However, if the SiO2-coating procedure led to NW damage, which could occur by Ag oxidation followed by Ag(NH3)2 complex formation,33 large changes in reflectivity patterning would result. Thus, it was important to confirm that the underlying Au/Ag barcode pattern in SiO2-coated NW could still be identified. We calculated Ag/Au reflectance intensity ratios from optical reflectance microscopy images acquired with 430-nm illumination for both SiO2-coated and uncoated NW. The reflectance ratios were similar (2.1 ( 0.3 for SiO2-coated vs 2.4 ( 0.4 for bare NW). At least 50 NW were used in these analyses. We next examined NW pattern identification by NBSee Software. Reflectance images for half-Au, half-Ag NW (pattern 000111, where 0 and 1 indicate Au and Ag segments, respectively) were used to test software identification from a library that included all possible combinations (36) for six-segment nanowires containing Au and Ag. The percentage of NW correctly identified was slightly higher for the silica-coated (92%) as compared to uncoated NW (89%), indicating no detrimental effect on identification due to the addition of the SiO2 shell. Freeman and co-workers have reported percent correct values from as high as 100% to as low as 29% for different NW samples in a 100-pattern, 8-segment Ag/Au NW library, with 75% of the patterns identified correctly 90% or more of the time.43 We note that the percent correctly identified for the batch of NW used here was relatively low even before silica coating. For multiplexed biosensing applications, identification rates can be improved by: (a) selection of sets of NW patterns that are rarely misidentified as each other, (b) setting more stringent identification parameters in software such that “questionable” NW are thrown out and not identified at all, and/or (c) improving NW synthesis conditions for better control. Protection from Oxidation. One potential advantage of the silica coating could be protection of the underlying Ag metal from oxidation. We previously reported that the Ag segments of (43) Walton, I. D.; Norton, S. M.; Balasingham, A.; He, L.; Oviso, D. F.; Gupta, D.; Raju, P. A.; Natan, M. J.; Freeman, R. G. Anal. Chem. 2002, 74, 2240-2247.

Sioss et al.

Figure 2. Etching of silver from silica-coated (40 ( 7 nm) and bare Au-Ag-Au nanowires. Bare nanowires before sonication in 10% HNO3 (A), after 20 min sonication (B), and after 30 min sonication (C). Silica-coated nanowires before (D), and after 20 min (E) and 30 min (F) sonication in 10% HNO3.

NW can undergo degradation by oxidation in water4 and standard hybridization buffers;44 addition of a mild reductant such as citrate provides excellent protection.44 Silica coating offers the possibility of protecting Ag segments without changing the solution chemistry. To investigate this possibility, bare and 40-nm silicacoated Au-Ag-Au NW were exposed to 10% nitric acid while sonicating for up to 30 min (Figure 2). After 20 min of etching, the bare samples (Figure 2B) are clearly degraded, with large parts of the Ag segments missing and broken nanowires present. The silica-coated samples (Figure 2E) have no visible degradation in the optical images. By 30 min, the bare nanowires (Figure 2C) are completely broken apart with no Ag segments visible, while the silica-coated NW have only minimal amounts of pitting (Figure 2F). The protection by silica is not complete. As we have previously reported, complete removal of Ag segments is possible when harsher etch conditions are used; the remaining Au segments are held in place by the glass shell, with controllable separations dictated by the size of the sacrificial Ag segments.37 Nonetheless, this porous silica shell substantially reduces the rate of Ag etch, which is beneficial for bioanalysis. Increasing the thickness of the SiO2 shell further increases the protection against Ag etching by nitric acid. Fluorescent DNA on SiO2-Coated vs Bare NW. Barcoded NW can be used as identification tags for multiplexed bioanalysis.4-6 For bioassays with fluorescence readout, an additional benefit of the silica coating could be the separation of dye molecules from the metal surface, which could reduce fluorescence quenching and potentially increase bioassay sensitivity. Figure 3 shows images of the attachment of a fluorescent single strand of DNA (oligo-SSF) to SiO2-coated and bare nanowires. While fluorescent DNA is observed on both types of NW, the emission intensity for silica-coated nanowires is significantly brighter than for bare nanowires. Although differences in intensity due to surface coverage cannot be ruled out in this experiment, we hypothesize that the principal reason for the difference in intensities is less efficient fluorescence quenching on the SiO2-coated NW. Image 3D shows higher fluorescence intensity from the tips of the NW. We commonly observe inhomogeneous fluorescence emission as a function of both nanoscale roughness features and NW metal patterning.4,14,19 Electromagnetic effects near metal surfaces can lead not only to quenching of emission (very close (44) Stoermer, R. L.; Sioss, J. A.; Keating, C. D. Chem. Mater. 2005, 17, 4356-4361.

Silica-Coated, Au/Ag Striped Nanowires

Langmuir, Vol. 23, No. 22, 2007 11339

Figure 5. Triplexed DNA assay on silica-coated nanowires. Top images are 430 nm reflectance, and bottom images show fluorescence. From left to right, HCV target (0110) added (A, C) and HBV target (0011) added (B, D). Figure 3. Optical microscope images for 3′ Alexa 647-labeled ssDNA bound to silica-coated (A, C) and bare (B, D) Au-Ag-Au NW. Top images show reflectivity at 430 nm, and bottom images show Alexa 647 fluorescence. Both fluorescence images were collected under identical conditions and were adjusted identically post-collection.

Figure 4. Thin (left) and thick (right) silica-coated nanowires with fluorescent DNA attached. Reflectance (top) and fluorescence (bottom) images for thin and thick (A and B) silica-coated NBCs. Fluorescent images were taken under the same conditions.

to the metal) but also to fluorescence enhancement some few tens of nanometers from the surface.17,18 For some bioassay applications, uniform fluorescence along the NW surface is desirable. To investigate whether removing the dye from the metal surface via an intervening silica film improved emission uniformity along the length of the NW, we compared NW with ∼13.5 nm (“thin”) and ∼100 nm (“thick”) silica. Figure 4 shows reflectance (A, B) and corresponding fluorescence (C, D) images of both thicknesses of silica-coated nanowires with fluorescent DNA probes attached. NW with the thin silica coating show regions of increased brightness at tips and other roughness features, qualitatively similar to emission from molecules bound to NW with no silica coating. In contrast, the thicker silica coating led to a significant improvement in the homogeneity of fluorescent

emission in these experiments (the 40-nm coating used in Figure 3 gives intermediate results). Thus, incorporation of the silica coating on the NW surface not only increases overall fluorescence intensity from molecules bound to the NW surface but also reduces inhomogeneities in intensity along the length of individual NW (Supporting Information, Figures 2, 3). We note that our previous work, in which sandwich immunoassays were performed on the NW surface, still gave strong fluorescence patterning (the dyeNW separation in those experiments was intermediate between the “thin” and “thick” silica used here).14 Triplexed Assay for HIV, HBV, and HCV Target Sequences. We next performed multiplexed sandwich DNA hybridization assays for oligonucleotide sequences specific for HIV, HBV, and HCV on SiO2-coated NW and compared the results to an identical, parallel assay on uncoated NW. Populations of NW with different barcode patterns (1001, 0011 or 0110, where 0 denotes a Au segment, and 1 denotes a Ag segment) were each functionalized with probe DNA for one of the viral pathogens (probe P1, P2, or P3, respectively). Silica thickness in these experiments was ∼20 nm. After probe conjugation by sulfo-SMCC chemistry, the three different NW patterns were mixed together to perform the triplexed assay. Target oligonucleotides with sequences corresponding to regions of none, one, or all of the three pathogens were added to the NW and allowed to hybridize, after which samples were rinsed, exposed to a fluorescently labeled detection probe, and finally rinsed for imaging. NW of a given pattern should appear fluorescent only if the correct target sequence was present in the sample. Representative images from three simultaneous (i.e., triplexed) sandwich hybridization assays on the SiO2-coated NW are shown in Figure 5. NW patterns are identified from the reflectance images (top panels), and assay results are apparent on the basis of which NW patterns display fluorescence (lower panels). Images from assays where only the HCV target was present and where only HBV target is present are shown on the left and right, respectively. In each case, significant fluorescence intensity is observed only for NW patterns corresponding to assays for which the target(s) were added. When only HCV target was present, only NW patterned 0110 (i.e., those derivatized with P3, the probe specific to the HCV target) are visible in the fluorescence image. When only HBV target was present, NW patterned 0011 (which are derivatized with probes for the HBV target) show fluorescence. Very little nonspecific binding is visible in the

11340 Langmuir, Vol. 23, No. 22, 2007

Figure 6. Mean fluorescence intensities for triplex assay. Nanowires have attached probe DNA for HBV (gray), HCV (black), and HIV (open). Fluorescence intensities are significantly brighter for silicacoated as compared to bare nanowires, with good specificity. (Inset) Mean fluorescence intensities for same experiment conducted on bare wires. Error bars shown are the 95% confidence intervals.

fluorescence images. Identical experiments on uncoated NW also showed good target specificity, but much lower intensity than the silica-coated nanowires (Supporting Information, Figure 4). Quantification for the triplexed sandwich hybridization assays on silica-coated and uncoated NW from Figure 5 and Supporting Information Figure 3 are presented in Figure 6, with data shown for addition of just HCV, just HBV, or all three oligonucleotide targets (HCV, HBV, and HIV). As discussed above, the SiO2coated NW show greater overall fluorescence intensity: mean intensities for a positive response for HCV and HBV targets on SiO2-coated NW were 80× and 112× higher, respectively, than on uncoated NW. Importantly, the discrimination between complementary and noncomplementary target strands is not degraded for the SiO2-coated NW. In fact, under the conditions of these assays, we observed much better target selectivity for the coated vs uncoated NW. For example, in an assay where only HCV target was added, HCV-specific SiO2-coated NW were ∼10× brighter than those functionalized for binding to the absent HIV or HBV targets. In contrast, on NW not coated with SiO2, intensity from HCV-specific NW was only ∼3× greater than for the HBV and HIV-specific NW. We note that these differences are not due to the DNA sequences or hybridization conditions, since the sequences and hybridization conditions were identical for both experiments. Rather, they presumably result from the low overall fluorescence intensity for the uncoated NW, and the consequently greater role played by background fluorescence. These greater signal/noise ratios for the silica-coated nanowire samples compared to the bare samples are encouraging for improved biosensor performance. Although no steps were taken to minimize nonspecific binding, this could be done in the future to give lower fluorescence for the noncomplementary probes. The error bars, corresponding to the 95% confidence interval, were greater for the SiO2-coated NW assay than for the bare nanowires. This is most likely due to the number of nanowires identified by NBSee (∼300 for coated, ∼850 for bare). In the future, the analysis parameters could be adjusted to help reduce this error, as well as increase the number of nanowires analyzed. Taken together, these results show that SiO2-coated NW can be used as encoded tags for multiplexed detection of oligonucleotides, with improved fluorescence intensities from the silica coating as compared with uncoated NW. Single Base Mismatch Detection. We also performed a 2-plex assay for detection of an oligonucleotide sequence corresponding to a cancer-related single base mutation of the p53 gene on SiO2coated NW. Probe sequences were attached to the NW by first using succinic anhydride to carboxylate the SiO2 surface, which

Sioss et al.

Figure 7. Single-base mismatch assay performed SiO2-coated NW in the presence of target N21A only, N21B only, both N21 A and B, or neither targets. Error bars are the 95% confidence intervals. Scheme 1. Detection Scheme for Sandwich DNA Hybridization (top) and SBM Assay (bottom) on SiO2-Coated NW

was then reacted with amine-terminated DNA probes using EDC chemistry. DNA probes for the wild-type (N21A) and mutant sequences (N21B) were attached to different batches of barcoded NW. The two NW batches were then mixed and exposed to biotinylated target sequences which may or may not have contained the single base mismatch (SBM). Following hybridization, fluorescently labeled streptavidin was added to label any bound target sequences via binding to their terminal biotin moieties (Scheme 1). Figure 7 shows the data for the SBM assay on silica-coated nanowires, which was generated from fluorescence and reflectance image pairs using NBSee software. Four separate experiments are shown, in which the fluorescence response of both NW barcode patterns was compared for every combination of the two targets (both, one, and none). The target sequences N21A and N21B differ only in the identity of a single base (Table 1). This simultaneous hybridization experiment was able to distinguish the two target sequences based on their binding to the probe-coated NW, which gave at least 2× higher fluorescence intensity for the fully complementary target vs the SBM. These data further support the use of SiO2-coated striped metal NW for bioassay performance. Additionally, since the fluorescence signal was relatively uniform on these 40-nm SiO2-coated wires and >1000 NW were counted, the error bars are smaller for these samples than for those performed on wires with no silica coating. Thermal Stability of DNA Probe Attachment. In addition to simplifying the fluorescence response for dye molecules near

Silica-Coated, Au/Ag Striped Nanowires

Langmuir, Vol. 23, No. 22, 2007 11341

Figure 9. Mean fluorescence intensity of DNA attached to both bare and silica-coated nanowires before and after thermocycling between 94 °C (30 s) and 68 °C (1 min) 25×.

possibility of photobleaching or lamp variations, prevents quantification of the absolute amount of DNA loss. Nonetheless, the difference in fluorescence retention for the two attachment chemistries is striking, and these results are encouraging for the future use of SiO2-coated, barcoded NW, in multiplexed PCR applications. Figure 8. Thermocycled silica-coated and bare nanowires with fluorescent DNA attached. Reflectance images (top) and fluorescent images (bottom) for silica-coated (A, C) and bare (B, D) nanowires. Samples were thermocycled between 94 °C (30 s) and 68 °C (1 min) 25×.

the metal NW surface, the SiO2-coating offers the possibility of more robust attachment chemistry. Thiolated DNA attached to Au or Ag performs well at ambient temperatures when no free thiols are present. However, this chemistry fails when the experiment is done at elevated temperatures, such as are required for polymerase chain reaction (PCR). This is due to instability of the Au/Ag-thiol bonding with increasing temperature.11 In contrast, siloxane-based attachment chemistries on SiO2 surfaces are more robust.45 We have compared the thermostability of these two chemistries by exposing both to thermocycling conditions. Fluorescently labeled, thiolated DNA sequence SSF was attached to both bare (via direct adsorption) and SiO2-coated (via SMCC chemistry) NW. Samples were imaged before and after exposure to a standard PCR thermocycling protocol, in the absence of PCR reagents (30 s at 94 °C, 1 min at 68 °C, 25 cycles, 1 × PCR buffer, which contains 1 mM β-mercaptoethanol).42 Figure 8 shows representative images for both samples after thermocycling. SiO2-coated NW are clearly brighter than the bare sample, indicating that the attached DNA is still present. However, since the direct attachment of fluorescent DNA to bare metal NW gives lower intensities even before heating, the relative loss of DNA probes is not apparent from these data alone. Figure 9 shows the normalized mean fluorescent intensity calculated by NBSee for DNA attached to bare and silica-coated nanowires before and after 25 thermocycles. Data were normalized to allow comparison of the much brighter SiO2-coated NW with the dimmer uncoated NW. For these experiments, performed identically and in parallel at the same time, loss of fluorescence for the bare wires is 84%, compared to just 16% for the DNA attached to silica-coated nanowires. These data show qualitatively that the attachment chemistry to SiO2 is more thermostable than direct thiol adsorption to the Au/Ag NW; however, the fact that surface coverage can impact emission intensities, along with the (45) (a) Chrisey, L. A.; Lee, G. U.; O’Ferrall, E. O. Nucleic Acids Res. 1996, 24, 3031-3039. (b) Andreadis, J. D.; Chrisey, L. A. Nucleic Acids Res. 2000, 28, e5. (c) Pirrung, M. C.; Davis, J. D.; Odenbaugh, A. L. Langmuir 2000, 16, 2185-2191.

Conclusions Taken together, the results reported here underscore the challenges of direct thiol-Au (or Ag) attachment chemistries for applications involving sample heating and/or fluorescence detection and point to thin silica coatings as a route to preserve the function of the underlying metal while providing protection from (1) electromagnetic effects (quenching, enhancement, responsiveness to surface roughness) that can result for dye molecules close to the metal surface, (2) oxidative degradation of Ag or other less noble metals, and (3) desorption of bound probe molecules such can occur when thiolated probes are heated or exposed to free thiols such as dithiothreitol or 2-mercaptoethanol. SiO2 coating therefore extends the applications of barcoded metal NW to more harsh solution conditions and should improve the sensitivity of fluorescence-based multiplexed assays performed on these particles. Acknowledgment. This work was supported by the National Institutes of Health (R01 EB00268 and R33 CA118591-02), the National Science Foundation (NER CHE 0304575), the PSU Materials Research Institute, and the PSU Huck Institute for the Life Sciences. C.D.K. also acknowledges support from a Sloan Fellowship, a Beckman Foundation Young Investigator Award, and a Dreyfus Teacher-Scholar Award. This project is funded, in part, under a grant with the Pennsylvania Department of Health using Tobacco Settlement Funds. The Department disclaims responsibility for analyses, interpretations, or conclusions. R.L.S and M.Y.S. acknowledge support from the National Institutes of Standards and Technology (Advanced Technology Program) (Grant 70NANB1H3028 for Nanoplex Technologies, Inc.). Supporting Information Available: Figures showing TEM images of uniformity of silica-coated NW, line scans of fluorescence images, and triplex on bare NW. This material is available free of charge via the Internet at http://pubs.acs.org. LA7019846